This is the peer reviewed version of the following article: The red fox (Vulpes vulpes ) as a potential natural reservoir of human cryptosporidiosis by Cryptosporidium hominis in Northwest Spain Juan P. Barrera, David Carmena, Elena Rodríguez, Rocío Checa, Ana M. López, Luis E. Fidalgo, Rosa Gálvez, Valentina Marino, Isabel Fuentes, Guadalupe Miró, Ana Montoya. Transbound Emerg Dis. 2020 Apr 17. which has been published in final form at https://doi.org/10.1111/tbed.13569 1 The red fox (Vulpes vulpes) as a potential natural reservoir of human cryptosporidiosis by 1 Cryptosporidium hominis in Northwest Spain 2 Running head: Cryptosporidium hominis infection in red foxes 3 4 Juan Pedro Barrera1, David Carmena2, Elena Rodríguez1, Rocío Checa1, Ana María López3, Luis 5 Eusebio Fidalgo3, Rosa Gálvez1, Valentina Marino1, Isabel Fuentes2, Guadalupe Miró1, Ana 6 Montoya1 7 8 1 Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, 9 Madrid. Spain. 10 2 Laboratorio de Referencia e Investigación en Parasitología, Centro Nacional de Microbiología, 11 Instituto de Salud Carlos III, Majadahonda, Madrid, Spain 12 3 Departamento de Ciencias Clínicas Veterinarias, Facultad de Veterinaria, Universidad de Lugo, 13 Spain 14 15 Correspondence 16 David Carmena, Laboratorio de Referencia e Investigación en Parasitología, Centro Nacional de 17 Microbiología, Instituto de Salud Carlos III, Ctra. Majadahonda-Pozuelo Km 2, 28008 18 Majadahonda, Madrid, Spain. 19 Email: dacarmena@isciii.es 20 21 Guadalupe Miró, Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad 22 Complutense de Madrid, Avda. Puerta de Hierro s/n, 28040 Madrid. Spain. 23 Email: gmiro@ucm.es 24 2 SUMMARY 25 Giardia duodenalis and Cryptosporidium spp. are ubiquitous intestinal protozoa that 26 parasitize domestic and wild animals, as well as human beings. Due to their zoonotic potential, 27 the objective of the present study was to determine the presence of these pathogens in the fox 28 population (Vulpes vulpes) located in Northwest Spain. A total of 197 faecal samples from 29 legally hunted foxes were collected in the autonomous region of Galicia. The presence of G. 30 duodenalis and Cryptosporidium spp. was investigated by PCR-based methods amplifying the 31 small subunit ribosomal RNA (ssu rRNA) gene of the parasites. Attempts to genotype 32 obtained positive samples were subsequently conducted at the glutamate dehydrogenase (gdh) 33 and β-giardin (bg) genes of G. duodenalis, and the 60 kDa glycoprotein (gp60) gene of 34 Cryptosporidium. Giardia duodenalis and Cryptosporidium spp. were identified in 19 (9.6%) 35 and 12 (6.1%) of the investigated samples, respectively. However, five Cryptosporidium 36 species were detected at the ssu rRNA locus: C. hominis (33.4%, 4/12), C. canis (25.0%, 37 3/12), C. parvum (16.7%, 2/12), C. ubiquitum (8.3%, 1/12), and C. suis (8.3%, 1/12). An 38 additional Cryptosporidium-positive sample was identified at the genus level only. Typing 39 and subtyping of Giardia- and Cryptosporidium-positive samples was unsuccessful. The 40 detection of C. hominis in wild foxes indicates the probable overlapping of sylvatic and 41 domestic cycles of this parasite in rural settings. Besides, this finding raises the question of 42 whether red foxes may act as natural reservoirs of C. hominis. The detection of C. parvum and 43 C. suis is suggestive of active transmission events between farm and wild animals, opening 44 up the possibility of transmission to human beings. 45 46 KEYWORDS: Cryptosporidium hominis; Giardia; Foxes; Genotyping; Prevalence; Sylvatic 47 cycle; Spain 48 3 1. INTRODUCTION 49 Giardia (phylum Metamonada) and Cryptosporidium (phylum Apicomplexa) are worldwide 50 intestinal parasites that infect a broad spectrum of vertebrates. Both are considered relevant 51 pathogens in public and animal health and have a significant zoonotic impact because certain 52 species are able to infect animals and human beings (Thompson, 2004; Xiao, 2010; Ryan & 53 Cacciò, 2013; Ryan et al., 2016; Thompson & Ash, 2016). Infection typically occurs after 54 ingestion of contaminated water or food. Not surprisingly, Giardia and Cryptosporidium are 55 common causes of waterborne and foodborne outbreaks of diarrhoea globally (Chalmers et al., 56 2010; Efstratiou et al., 2017; Robertson, 2018). 57 Subclinical carriage of Giardia and Cryptosporidium is frequent (Reh et al., 2019), but 58 both pathogens can cause a wide range of gastrointestinal-related conditions including chronic 59 small bowel diarrhoea, vomiting, fever, and progressive weight loss. Cryptosporidium infection 60 is a major cause of diarrhoea in immunocompromised adults and immunocompetent children, 61 whereas G. duodenalis is the main intestinal parasite affecting people in developed countries 62 (Cacciò & Chalmers, 2016; Mmbaga & Houpt, 2017). In Spain, according to data from the 63 National Epidemiological Surveillance Network, human clinical cases of cryptosporidiosis and 64 giardiosis have gradually increased since 2010, with children aged between 1 and 9 years being 65 particularly at risk of these infections (NESN, 2016). 66 G. duodenalis is considered a multispecies complex with at least eight distinct 67 assemblages (A-H) differing in host specificities and genetic content. There is extensive genetic 68 sub-structuring within assemblages A and B, further divided within sub-assemblages AI-AIII 69 and BIII-BIV, respectively (Feng & Xiao, 2011). Assemblages A and B infect a wide diversity 70 of mammal species including humans and are therefore considered zoonotic. The remaining 71 assemblages are likely to be host-specific and are only sporadically found infecting humans. 72 4 The genus Cryptosporidium encompasses thus far 38 recognized species (Feng et al., 73 2018). C. hominis primarily (but not exclusively) infects humans, whereas C. parvum is 74 considered the most important Cryptosporidium zoonotic species, having as main reservoirs 75 cattle and humans. Several other Cryptosporidium species from mammals and birds (e.g. C. 76 meleagridis, C. canis, C. felis, and C. ubiquitum, among others) pose also zoonotic risk at 77 varying degrees, causing animal contact-associated or waterborne and foodborne 78 cryptosporidiosis in humans (Ryan et al., 2014; Efstratiou et al., 2017 ¸ Ryan et al., 2018). 79 Importantly, the notion that C. hominis is a human-specific Cryptosporidium species has being 80 increasingly challenged by numerous molecular epidemiological studies revealing that the 81 actual host range of C. hominis is much wider than initially thought (Widmer et al., in press). 82 Although there is some controversy about the role played by production animals in 83 transmission (e.g. O’Handley, 2007), genotyping of Giardia- and Cryptosporidium-positive 84 samples is essential to ascertain the epidemiology of these pathogens and their public veterinary 85 health relevance. Conventionally, livestock and companion animal species have been regarded 86 as the most important sources of zoonotic human cryptosporidiosis cases (Ryan & Cacciò, 87 2013; Slapeta, 2013; Ryan et al., 2014). However, due to the steady but continuous human 88 encroachment into wildlife habitats, free-living animals including foxes, raccoons, and wild 89 boars are becoming an increasingly common sight on the urban and peri-urban areas of many 90 European cities (Mackenstedt et al., 2015). Given this scenario, wild animals may play a more 91 important role in the spreading of pathogens and as natural source of human and pet infections 92 than previously anticipated (Thompson, 2013; Ryan et al., 2016; Zahedi et al., 2016). 93 In Spain, very few epidemiological surveys have attempted to investigate the occurrence 94 of G. duodenalis and Cryptosporidium spp. infection in the red fox (Vulpes vulpes). These 95 molecular-based studies revealed the presence of C. canis, C. felis, C. parvum, and C. ubiquitum 96 5 circulating in fox populations in the North and Central areas of the country (Mateo et al., 2017; 97 Navarro-i-Martinez et al., 2011). However, no data are currently available on the occurrence 98 and distribution of G. duodenalis and Cryptosporidium spp. in wild canids in Northwest Spain, 99 a region where these pathogens have been previously reported in wild and domestic animals, 100 humans, and even environmental (water) samples (Castro-Hermida et al., 2002, 2007, 2008, 101 2009, 2011; Castro-Hermida et al., 2006; Gómez-Couso et al., 2006; García-Presedo et al., 102 2013; Gabín-García et al., 2017). Because red fox populations have significantly increased in 103 rural and peri-urban settings of this region (average density: 3.9‒5.4 foxes/km2) in recent years, 104 this epidemiological scenario may favour the transition from sylvatic to domestic transmission 105 cycles of these parasites (López Becerro, 2009). The aims of the present study were i) to 106 determine the presence and molecular diversity of zoonotic protozoa in faeces from foxes living 107 in Northwest Spain, ii) to conduct a preliminary assessment of the zoonotic potential risk that 108 fox populations pose in areas where sylvatic and domestic transmission cycles overlap, and iii) 109 to identify biological and environmental factors potentially associated to a higher risk of 110 infection. 111 2. MATERIALS AND METHODS 112 2.1 Ethical statement 113 This study was carried out in accordance with Spanish legislation guidelines (RD 8/2003) and 114 with the International Guiding Principles for Biomedical Research Involving Animals issued 115 by the Council for International Organization of Medical Sciences and the International Council 116 for Laboratory Animal Science (RD 53/2013). 117 2.2 Study area, sampling and data collection 118 6 The carcases of 197 wild red foxes obtained in three out of the four provinces of the autonomous 119 region of Galicia (NW Spain) between 2015 and 2019 were included in this study (Figure 1). 120 The foxes had been legally shot during the official hunting season (from January to February) 121 of each year. Faecal samples were collected from the rectum, transferred into sterile containers, 122 and kept at 4 °C until further processing, usually within 72 h. 123 Information including specific coordinates of sampling sites, sample identification 124 number, date, capture site, age, clinical status and sex were carefully recorded for each animal 125 in an Excel spreadsheet. Clinical signs (change in the colour of mucous membranes, body and 126 skin condition, lymphadenomegaly) were also assessed at the time of sampling. A body 127 condition score (based on the thickness of the fat layer in the thoracic and abdominal cavities 128 and the amount of visceral fat observed at necropsy) ranging from 1 to 5 was used, with a score 129 of 1 being cachectic and 5 being overweight (Winstanley et al., 1998). Animal age was 130 estimated according to several factors including body development (complete or not), external 131 appearance, developmental stage of genitals (external or internal) and dentition (presence, 132 development and teeth wear, periodontal disease). Three age groups were stablished: immature 133 or juvenile (individuals <1 year-old), adults (reproductive individuals between 1‒5 years-old), 134 and old adults (individuals >5 years-old showing teeth wear and/or varying degree of 135 periodontal disease or even loss of teeth). 136 2.3 Faecal sample processing 137 An aliquot (3‒5 g) of each faecal sample was suspended into 20 mL volumes of 1× phosphate 138 buffered saline (PBS) and thoroughly homogenized. The homogenate was then filtered through 139 a sieve mesh (250 μm diameter) double gauze. The filtered suspension was divided into two 10 140 mL tubes and centrifuged at 500 × g for 10 min. After careful removal of the supernatant, the 141 7 remaining pellet was transferred to a clean 1.5 mL tube and stored at -20 ºC until DNA 142 extraction was performed. 143 2.4 DNA extraction and purification 144 DNA was extracted from faecal samples using the QIAmp DNA Stool Mini Kit (QIAGEN, 145 Hilden, Germany) following the manufacturer’s instructions. The extracted DNA was stored at 146 4 °C until PCR analyses. Elapsed time between sample processing and PCR testing was 1‒6 147 months. 148 2.5 Molecular detection and characterisation of G. duodenalis 149 To detect G. duodenalis, a real-time PCR (qPCR) protocol was used to amplify a ∼62-bp region 150 of the small subunit ribosomal RNA (ssu rRNA) gene of the parasite (Verweij et al., 2003). The 151 reaction mixture (25 µL) contained 3 µL of template DNA, 12.5 pmol of each primer Gd-80F 152 (5´‒GACGGCTCAGGACAACGGTT‒3´) and Gd-127R (5´‒TTGCCAGCGGTGTCCG‒3´), 153 10 pmol of probe (6-carboxyfluorescein[FAM]‒5´‒CCCGCGGCGGTCCCTGCTAG‒3´‒154 blackhole quencher 1 [BHQ1]), and 1X TaqMan® Gene Expression Master Mix (Applied 155 Biosystems, CA, USA). Negative and positive controls were included in all PCR runs. 156 Amplification reactions were performed in a Corbett Rotor-Gene 6000 qPCR cycler 157 (QIAGEN). Cycling conditions were: an initial hold step of 2 min at 55 ºC and 15 min at 95 ºC, 158 followed by 45 cycles of 15 s at 95 ºC and 1 min at 60 ºC. For genotyping purposes, a semi-159 nested and a nested PCR protocols were used, respectively, to amplify partial fragments of the 160 glutamate dehydrogenase (gdh; Read et al., 2004) and β-giardin (bg; Lalle et al., 2005) genes 161 of G. duodenalis. Amplification reactions (25 µL) contained 0.4‒0.5 μM of each primer, 2.5 162 units of MyTAQTM DNA polymerase (Bioline GmbH, Luckenwalde, Germany), 5 µL of 5× 163 MyTAQTM Reaction Buffer containing 5 mM dNTPs and 15 mM MgCl2, and 3‒5 µL of 164 8 template DNA. Amplifications were conducted in a 2720 thermal cycler (Applied Biosystems). 165 PCR products were resolved on 2% D5 agarose gels (Conda, Madrid, Spain) stained with 166 Pronasafe nucleic acid staining solution (Conda). 167 2.6 Molecular detection and characterisation of Cryptosporidium spp. 168 Detection and identification of Cryptosporidium species was achieved using a nested PCR 169 protocol to amplify a partial (∼587 bp) fragment of the ssu rRNA gene of the parasite (Tiangtip 170 & Jongwutiwes, 2002). The outer primers were CR-P1 (5′‒171 CAGGGAGGTAGTGACAAGAA‒3′) and CR-P2 (5′‒TCAGCCTTGCGACCATACTC‒3′) 172 and the inner primers were CR-P3 (5′‒ATTGGAGGGCAAGTCTGGTG‒3′) and CPB-DIAGR 173 (5´‒TAAGGTGCTGAAGGAGTAAGG‒3´). The reaction mix (50 µL) comprised 0.3 μM of 174 each primer, 2.5 units of DNA polymerase, 10 µL of 5× Reaction Buffer, and 3 µL of template 175 DNA. Cycling conditions for the primary and secondary PCR reactions included one cycle of 176 94 ºC for 3 min, followed by 35 cycles of 94 ºC for 40 s, 50 ºC for 40 s and 72 ºC for 1 min, 177 and a final extension of 72 ºC for 10 min. DNA samples positive to C. parvum/C. hominis and 178 C. ubiquitum at the ssu-PCR were subtyped at the 60-kDa glycoprotein (gp60) of the parasite 179 using specific protocols (Feltus et al., 2006; Li et al., 2014). PCR reagents and equipment used 180 were the same as described above for the gdh-PCR and the bg-PCR protocols. 181 2.7 Sequence analyses 182 Obtained PCR products were sequenced in both directions with the corresponding internal 183 primer sets described above using Big Dye™ chemistries and an ABI 3730xl sequencer 184 analyser (Applied Biosystems, Foster City, CA). Raw sequencing data in both forward and 185 reverse directions were viewed using the Chromas Lite version 2.1 sequence analysis 186 program. The BLAST tool was used to compare nucleotide sequences with appropriate 187 9 reference sequences retrieved from the National Center for Biotechnology Information 188 (NCBI) database. Generated DNA consensus sequences were aligned to appropriate reference 189 sequences using the MEGA 7 software to confirm species identity. Phylogenetic relationships 190 among Cryptosporidium sequences identified in the present survey and known 191 Cryptosporidium sequences retrieved from the NCBI public repository was done by the 192 Neighbor-Joining (NJ) method using MEGA 7 (Tamura et al., 2013). Genetic distance was 193 calculated with the Kimura 2-parameter model, and the rate variation among sites was 194 modelled with a gamma distribution (shape parameter = 2). 195 2.8 Statistical analysis 196 Potential association between all the variables examined were investigated with the Chi-197 square test. We also explored whether proximity of infected foxes to river courses could be 198 linked to an increased risk of environmental surface water contamination with Cryptosporidium 199 oocysts and Giardia cysts, or, on the contrary, foxes may acquire these infections through 200 consumption of water contaminated with faecal material from human or livestock origin. To do 201 so, we first use the GIS software ArcGis Pro v.2.3.3 (ESRI, Redlands, CA) to assign each 202 sampling site coordinate the real distance to the closest river course, taking into account spatial 203 information derived from a 200 m resolution digital elevation model provided by the National 204 Center for Geographic Information (CNIG). Secondly, T-student and Mann-Whitney U tests 205 were used to assess correlation between foxes testing positive to Cryptosporidium and Giardia 206 and distance from river courses. Analyses were conducted using SPSS Statistics package 17.0 207 (IBM, Chicago, IL, USA). Significance was set at p < 0.05. 208 3. RESULTS 209 10 A total of 197 faecal samples from individual red foxes were collected and included in the 210 present survey. After examination, foxes were classified according to sex (107 males, 90 211 females) and estimated age (60 juveniles, 109 adults and 28 old adults). Body condition 212 appraisal revealed that most (83%, 163/197) of the animals fell within scores 2 and 3. Overall, 213 40 animals were captured in the province of A Coruña, 94 in Lugo, 11 in Ourense, and 52 in 214 Pontevedra (Figure 1 and Table 1). 215 Based on PCR methods, G. duodenalis and Cryptosporidium spp. were identified in 216 9.6% (19/197) and 6.1% (12/197) of the investigated faecal samples, respectively. Giardia 217 duodenalis was equally present in male and female foxes of all age groups investigated. 218 However, vixens were more likely (P < 0.05) to be infected by Cryptosporidium spp. than male 219 foxes. Animals with a body condition score of 2 were more prone to have cryptosporidiosis, 220 although this difference was not statistically significant. No foxes with a body condition of 5 221 (overweight) were found. The three foxes with a body condition score of 1 (cachectic) were 222 found infected neither by G. duodenalis nor Cryptosporidium spp. None of these pathogens 223 were identified infecting foxes captured in Ourense, although this finding may be associated to 224 the relatively low number of animals sampled in that particular province (Table 1). 225 Samples that tested positive to G. duodenalis by qPCR had cycle threshold (Ct) values 226 ranging from 33.0 to 43.4 (median: 39.1). Attempts to amplify these samples at the gdh and bg 227 loci of the parasite failed repeatedly. BLAST sequence alignments of the Cryptosporidium-228 positive amplicons obtained at the ssu-PCR allowed the identification of five different 229 Cryptosporidium species including C. hominis (33.4%, 4/12), C. canis (25.0%, 3/12), C. 230 parvum (16.7%, 2/12), C. ubiquitum (8.3%, 1/12), and C. suis (8.3%, 1/12). An additional 231 Cryptosporidium-positive sample was only confirmed at the genus level. The main 232 11 epidemiological and clinical features of the red foxes harbouring Cryptosporidium infections 233 are summarized in Table 2. 234 Table 3 shows the main molecular features of the 12 Cryptosporidium ssu rRNA 235 sequences generated in the present survey. Representative nucleotide sequences were deposited 236 in the GenBank database under accession numbers MK770260-MK770267 and MN996814-237 MN996816. The two C. parvum sequences identified corresponded to known genetic variants 238 of the bovine genotype of the parasite, also known as C. pestis (GenBank accession number 239 AF108864) by some authors (Slapeta, 2006). Unexpectedly, a very high nucleotide diversity 240 was found among the four sequences assigned to C. hominis, including one known and three 241 novel genetic variants. The three sequences identified as C. canis are known to be circulating 242 in wild and domestic canids globally, but the C. ubiquitum and C. suis sequences corresponded 243 to genotypes not reported yet. 244 Attempts to determine the subtypes of the C. hominis, C. parvum, and C. ubiquitum 245 isolates at the gp60 marker were unsuccessful. The phylogenetic tree for partial ssu rDNA 246 sequences including those generated in the present study and known and reference genotypes 247 of the parasite is shown in Fig. 2. The three novel C. hominis genotypes (GenBank accession 248 numbers MK770262-MK770264) formed a well-defined group together with other C. hominis 249 sequences previously obtained in wild mesocarnivore species and domestic dogs from Spain. 250 The novel C. ubiquitum sequence identified here (MK770267) clustered with reference 251 sequences belonging to this Cryptosporidium species but showed marked genetic differences 252 with the only fox sequence reported in Spain to date, belonging to an animal from the Basque 253 Country (Northern Spain). The novel C. suis sequence identified here (MN996816) clustered 254 together with reference sequence AF115377, but was also closely related (99.8% identify) to 255 C. occultus (MG699176). 256 12 Interestingly, fox faecal samples collected near main river courses were found 257 significantly more infected with G. duodenalis, but not with Cryptosporidium spp., than those 258 from more distant sites (Table 4). 259 4. DISCUSSION 260 Livestock and companion animal species have been long regarded as the main reservoir of 261 protozoal diseases to humans (Feng & Xiao, 2011; Esch & Petersen, 2013; Ryan et al., 2014). 262 However, wildlife are being increasingly recognised as an important source of emerging and/or 263 re-emerging human pathogens, including the diarrhoea-causing protozoa Giardia duodenalis 264 and Cryptosporidium spp. (Polley, 2005; Ryan et al., 2016). Data presented here fall within this 265 frame of thinking, demonstrating that G. duodenalis and Cryptosporidum spp. are common 266 findings in red foxes living in Northwest Spain, and that this host species can act as a suitable 267 natural reservoir of species/genotypes potentially infective to human beings, including C. 268 hominis. 269 The overall G. duodenalis prevalence found (9.6%) in the surveyed fox population was 270 slightly higher than that (mean: 8%; range: 0‒18%) previously reported also by PCR in other 271 regions of the country (Mateo et al., 2017). In this very same area (Northwest Spain). G. 272 duodenalis has been detected previously in 7% of otters (Méndez-Hermida et al., 2007), 5% of 273 roe deer, and 1% of wild boars (Castro-Hermida et al., 2011b), but not in free-living foxes. In 274 the European scenario, documented infection rates in foxes ranged from 2‒5% in Norway and 275 Croatia (Hamnes et al., 2007; Beck et al., 2011), and up to 19% in Poland (Stojecki et al., 2015). 276 Our qPCR results revealed that all Giardia-positive samples delivered high (>33) Ct values, 277 strongly suggesting that infected foxes harboured light parasite burdens. This fact can explain 278 the failure to amplify Giardia DNA at the gdh and bg loci, as both markers are single-copy 279 13 genes with limited detection sensitivity. Unfortunately, this also means that we were unable to 280 assess the G. duodenalis assemblages/sub-assemblages (and their zoonotic relevance) 281 circulating in the fox population under study. This is a frequent problem encountered in many 282 molecular epidemiological investigations focusing on wild mesocarnivore species including 283 foxes (Mateo et al., 2017). Of note, zoonotic assemblages A and B have been identified in 284 Croatian and Norwegian foxes (Hamnes et al., 2007; Beck et al., 2011). Other wild canids 285 including wolves and raccoon dogs harboured infections with G. duodenalis assemblages A, C, 286 and D in Croatia (Beck et al., 2011) and Romania (Adriana et al., 2016). 287 Cryptosporidium infection was found in 6.1% of foxes, a prevalence similar to the 288 average rate (8%) previously reported at national level (Mateo et al., 2017). Additionally, the 289 parasite has also been identified in one out of four foxes in Eastern Spain (Navarro-i-Martinez 290 et al., 2010). In our study, female were significantly more infected by Cryptosporidium than 291 male foxes. This could be related to stress-induced immune compromise during the 292 reproductive season, since in the Iberian Peninsula matting usually occurs during the months of 293 January and February (López Becerro et al., 2009), overlapping with the hunting and capture 294 period of the foxes in the present study. This finding has not been described in previous studies, 295 so further research would be necessary to unravel the true influence of sex on the prevalence of 296 the infection by this parasite. 297 A striking finding was the confirmation of C. hominis as the most prevalent 298 Cryptosporidium species circulating in the investigated fox population. Until recent, C. hominis 299 was mainly thought to be specifically adapted to infect humans. However, an increasing number 300 of investigations, including experimental infections in animal models and molecular 301 epidemiological surveys in domestic and wildlife species, have demonstrated that C. hominis is 302 able to successfully infect a broad range of hosts including cattle, sheep, horses, donkeys, pigs, 303 14 rodents, geese, deer, dingoes, hedgehogs, kangaroos, wallabies, and several species of non-304 human primates (e.g. Akiyoshi et al., 2002; Guk et al., 2004; Schiller et al., 2016; Zahedi et al., 305 2016; Feng et al., 2018; Chen et al., 2019). Only in Spain, C. hominis has been reported in a 306 domestic dog from the Basque Country (Gil et al., 2017) and a free-living badger from Asturias 307 (Mateo et al., 2017). These findings raise interesting questions about the host specificity and 308 evolution of C. hominis (Widmer et al., in press). Even more intriguing was the fact that three 309 out of the four C. hominis sequences generated at the ssu rRNA locus corresponded to genetic 310 variants of the parasite not described previously, whereas the fourth one was identified as a 311 genotype commonly seen in Spanish clinical patients (e.g. GenBank accession number 312 KY499055) (de Lucio et al., 2016; Azcona-Gutiérrez et al., 2017). Such variety of distinct, 313 novel sequences may be indicative of true C. hominis infections rather than accidental carriage 314 (spurious infection) of ingested oocysts of the parasite. Unfortunately, our attempts to amplify 315 these samples at the gp60 marker did not yield readable sequences, so the subtypes of the 316 parasite involved in these infection remains unknown. These findings provide preliminary 317 molecular evidence supporting the existence of a peri-domestic transmission cycles of C. 318 hominis maintained within humans and foxes. This does not preclude that a sylvatic 319 transmission cycle of the parasite may also be occurring in this geographical area, as suggested 320 by the three novel C. hominis sequences described above. The former scenario would be 321 favoured by the increasing proximity of fox populations to human settlements in rural Galicia. 322 These foxes may acquire the parasite by feeding from garbage and carrion remains of domestic 323 animals, or from water or food contaminated with faeces of human origin (Navarro-i-Martinez 324 et al., 2011). This epidemiological situation fits well with the rural land tenure structure in 325 Galicia, characterized by the presence of small family farms, holdings and parcels and a 326 resulting landscape in the form of a complex mosaic, unlike the rest of Spain (Crecente et al., 327 15 2002). The extent and exact meaning of these results should be corroborated in further typing 328 and subtyping molecular surveys investigating simultaneously Cryptosporidium-positive faecal 329 specimens from human and animal (including wildlife) origin, and also from environmental 330 (soil, water) samples in this geographical area. Whatever the case, it seems clear that foxes 331 carrying and disseminating C. hominis oocysts should be considered as a potential source of 332 environmental contamination including surface waters intended for human consumption 333 (Gómez-Bautista et al., 2000; Navarro-i-Martínez et al., 2011). 334 The finding of zoonotic C. parvum is also relevant, as this Cryptosporidium species is a 335 major diarrhoea-causing agent in livestock (primarily calves) causing substantial economic 336 losses. Cryptosporidium parvum has been frequently reported in humans, domestic ruminants, 337 wildlife, and surface waters from Galicia (Castro-Hermida et al., 2011; García-Presedo et al., 338 2013; Abal-Fabeiro et al., 2014), so the finding of this species in free-living foxes was somehow 339 expected, pointing out to the existence of transmission events between sylvatic and domestic 340 (involving livestock species and humans) cycles of the parasite (Navarro-i-Martínez et al., 341 2003). Similar conclusions can be drawn for C. suis, a Cryptosporidium species adapted to 342 infect swine that has been previously described in farmed pigs in north-eastern Spain (Suárez-343 Luengas et al., 2007). This is, to the best of our knowledge, the first description of C. suis in 344 red foxes. Interestingly, C. suis has also been described in five of 209 wild boars in Galicia 345 (García-Presedo et al., 2013). These facts support the hypothesis of cross-transmission of 346 Cryptosporidium spp. between domestic and free-living animal species. 347 Zoonotic C. ubiquitum has been regarded as a pathogen emerging in humans (Li et al., 348 2014), although no human infections by this Cryptosporidium species have been documented 349 in Spain yet. The parasite is known to have a broad host spectrum including ruminants, rodents 350 and primates. Few studies have reported the presence of C. ubiquitum in different geographical 351 16 areas (Zahedi et al., 2016) including Spain (Mateo et al., 2017). Finally, C. canis is primarily 352 found infecting domestic and wild (including foxes) canids (Mateo et al., 2017; Zahedi et al., 353 2016). Because of its narrower host preferences, human infections by C. canis are rarely 354 described, mainly in children and immunocompromised individuals. Therefore, this 355 Cryptosporidium species is considered of low zoonotic potential. 356 Finally, we also found that fox faecal samples collected near main water streams were 357 more likely to harbour G. duodenalis cysts than those recovered from more distant sites. This 358 finding may pose a significant (but still not fully evaluated) public health threat, as foxes 359 carrying G. duodenalis (and Cryptosporidium) infections can contribute to the environmental 360 burden of infective (oo)cysts and contaminate surface waters intended for human consumption 361 or recreation. This does not preclude that foxes may also acquire these infections, at least 362 partially, through drinking water contaminated with human or livestock faecal material. In this 363 regard we should keep in mind that Galician surface water bodies have been shown to be heavily 364 polluted with viable G. duodenalis cysts (range: 1‒400 per litre) belonging to sub-assemblages 365 AI and AII and assemblage E, and Cryptosporidium oocysts (range: 1‒1,200 per litre) assigned 366 to C. hominis, C. parvum and C. andersoni (Castro-Hermida et al., 2009, 2010). More research 367 is clearly needed to ascertain the frequency, directionality, and extent of these events. 368 CONCLUSIONS 369 In addition to previously known C. canis, C. parvum and C. ubiquitum, this is the first 370 description of C. hominis and C. suis infections from foxes globally, and the first report of G. 371 duodenalis infection in free-living fox populations from Northwest Spain. Molecular data 372 presented here, although preliminary and in need of confirmation, may indicate that C. hominis 373 can be naturally infecting wild red foxes, and that this host may be a significant reservoir of 374 17 Cryptosporidium in humans and domestic animals. Given this scenario, the increasing 375 urbanization of fox habitats favoured by their scavenging behaviour and the accessibility of 376 anthroponotic food may pose a greater public veterinary health risk than previously anticipated. 377 ACKNOWLEDGEMENTS 378 The red foxes used in this study were provided by the Wildlife Recovery Centres of Galicia, 379 Dirección Xeral de Patrimonio Natural (Xunta de Galicia, Spain) and by Federación Galega de 380 Caza. Molecular analyses conducted in this survey were funded by the Health Institute Carlos 381 III, Spanish Ministry of Economy and Competitiveness under project CP12/03081. 382 CONFLICT OF INTEREST 383 The authors have no conflict of interest to declare. 384 DATA AVAILABILITY STATEMENT 385 The data that supports the findings of this study are available in the supplementary material of 386 this article. 387 REFERENCES 388 Abal-Fabeiro, J.L., Maside, X., Llovo, J., Bello, X., Torres, M., Treviño, M., Moldes, L., 389 Muñoz, A., Carracedo, A., & Bartolomé, C. (2014). High-throughput genotyping assay 390 for the large-scale genetic characterization of Cryptosporidium parasites from human 391 and bovine samples. Parasitology, 141(4), 491‒500. https://doi.org/ 392 10.1017/S0031182013001807 393 Adriana, G., Zsuzsa, K., Mirabela Oana, D., Mircea, G.C., & Viorica, M. (2016). Giardia 394 duodenalis genotypes in domestic and wild animals from Romania identified by PCR-395 18 RFLP targeting the gdh gene. Veterinary Parasitology, 217, 71–75. 396 https://doi.org/10.1016/j.vetpar.2015.10.017 397 Akiyoshi, D.E., Feng, X., Buckholt, M.A., Widmer, G., & Tzipori, S. (2002). Genetic analysis 398 of a Cryptosporidium parvum human genotype 1 isolate passaged through different host 399 species. Infection and Immunity, 70, 5670–5675. 400 https://doi.org/10.1128/iai.70.10.5670-5675.2002 401 Azcona-Gutiérrez, J.M., de Lucio, A., Hernández-de-Mingo, M., García-García, C., Soria-402 Blanco, L.M., Morales, L., Aguilera, M., Fuentes, I., & Carmena, D. (2017). Molecular 403 diversity and frequency of the diarrheagenic enteric protozoan Giardia duodenalis and 404 Cryptosporidium spp. in a hospital setting in Northern Spain. PLoS One, 12(6), 405 e0178575. https://doi.org/10.1371/journal.pone.0178575 406 Beck, R., Sprong, H., Lucinger, S., Pozio, E., & Cacciò, S.M. (2011). A large survey of Croatian 407 wild mammals for Giardia duodenalis reveals a low prevalence and limited zoonotic 408 potential. Vector Borne Zoonotic Dis. Larchmt. N 11, 1049–1055. 409 https://doi.org/10.1089/vbz.2010.0113 410 Cacciò, S.M., & Chalmers, R.M. (2016). Human cryptosporidiosis in Europe. Clinical 411 Microbiology and Infection, 22, 471–480. https://doi.org/10.1016/j.cmi.2016.04.021 412 Castro-Hermida, J.A., González-Losada, Y.A., & Ares-Mazás, E. (2002). Prevalence of and 413 risk factors involved in the spread of neonatal bovine cryptosporidiosis in Galicia (NW 414 Spain). Veterinary Parasitology, 106, 1–10. https://doi.org/10.1016/S0304-415 4017(02)00036-5 416 Castro-Hermida, JA., AlmeidA, A., González-Warleta, M., Da Costa, J.M.C., & Mezo, M. 417 (2006a). Prevalence and preliminary genetic analysis of Giardia isolated from adult 418 sheep in Galicia (northwest Spain). Journal of Eukaryotic Microbiology, 53 Suppl 1, 419 19 S172‒173. https://doi.org/10.1111/j.1550-7408.2006.00220.x 420 Castro-Hermida, J. A., Carro-Corral, C., González-Warleta, M., & Mezo, M. (2006b). 421 Prevalence and intensity of infection of Cryptosporidium spp. and Giardia duodenalis 422 in dairy cattle in Galicia (NW Spain). Journal of Veterinary Medicine, Series B, 53, 423 244–246. https://doi.org/10.1111/j.1439-0450.2006.00946.x 424 Castro-Hermida, J.A., Almeida, A., González-Warleta, M., Correia da Costa, J.M., Rumbo-425 Lorenzo, C., & Mezo, M. (2007). Occurrence of Cryptosporidium parvum and Giardia 426 duodenalis in healthy adult domestic ruminants. Parasitology Research, 101, 1443–427 1448. https://doi.org/10.1007/s00436-007-0624-6 428 Castro-Hermida, J.A., García-Presedo, I., Almeida, A., González-Warleta, M., Correia Da 429 Costa, J.M., & Mezo, M. (2008). Contribution of treated wastewater to the 430 contamination of recreational river areas with Cryptosporidium spp. and Giardia 431 duodenalis. Water Research, 42, 3528–3538. 432 https://doi.org/10.1016/j.watres.2008.05.001 433 Castro-Hermida, J.A., García-Presedo, I., Almeida, A., González-Warleta, M., Da Costa, 434 J.M.C., & Mezo, M. (2009). Detection of Cryptosporidium spp. and Giardia duodenalis 435 in surface water: a health risk for humans and animals. Water Research, 43, 4133–4142. 436 https://doi.org/10.1016/j.watres.2009.06.020 437 Castro-Hermida, J.A., García-Presedo, I., Almeida, A., González-Warleta, M., Correia Da 438 Costa, J.M., & Mezo, M. (2011a). Cryptosporidium spp. and Giardia duodenalis in two 439 areas of Galicia (NW Spain). Science of the Total Environment, 409, 2451–2459. 440 https://doi.org/10.1016/j.scitotenv.2011.03.010 441 Castro-Hermida, J.A., García-Presedo, I., González-Warleta, M., Mezo, M. (2010) 442 Cryptosporidium and Giardia detection in water bodies of Galicia, Spain. Water 443 20 Research, 44, 5887–5896. https://doi.org/10.1016/j.watres.2010.07.010 444 Castro-Hermida, J.A., García-Presedo, I., González-Warleta, M., & Mezo, M. (2011b). 445 Prevalence of Cryptosporidium and Giardia in roe deer (Capreolus capreolus) and wild 446 boars (Sus scrofa) in Galicia (NW, Spain). Veterinary Parasitology, 179, 216-219. 447 https://doi.org/10.1016/j.vetpar.2011.02.023 448 Chalmers, R.M., Robinson, G., Elwin, K., Hadfield, S.J., Thomas, E., Watkins, J., Casemore, 449 D., & Kay, D. (2010). Detection of Cryptosporidium species and sources of 450 contamination with Cryptosporidium hominis during a waterborne outbreak in north 451 west Wales. Journal of Water & Health, 8, 311–325. 452 https://doi.org/10.2166/wh.2009.185 453 Chen, L., Hu, S., Jiang, W., Zhao, J., Li, N., Guo, Y., Liao, C., Han, Q., Feng, Y., & Xiao, L. 454 (2019). Cryptosporidium parvum and Cryptosporidium hominis subtypes in crab-eating 455 macaques. Parasites and Vectors, 12, 350. https://doi.org/10.1186/s13071-019-3604-7 456 Crecente, R., Alvarez, C., & Fra, U. (2002). Economic, social and environmental impact of land 457 consolidation in Galicia. Land Use Policy, 19, 135‒147. https://doi.org/10.1016/S0264-458 8377(02)00006-6 459 de Lucio, A., Merino, F.J., Martínez-Ruiz, R., Bailo, B., Aguilera, M., Fuentes, I., & Carmena, 460 D. (2016). Molecular genotyping and sub-genotyping of Cryptosporidium spp. isolates 461 from symptomatic individuals attending two major public hospitals in Madrid, Spain. 462 Infection, Genetics and Evolution, 37, :49-56. 463 https://doi.org/10.1016/j.meegid.2015.10.026 464 Efstratiou, A., Ongerth, J.E., & Karanis, P. (2017). Waterborne transmission of protozoan 465 parasites: Review of worldwide outbreaks - An update 2011-2016. Water Research, 466 114, 14–22. https://doi.org/10.1016/j.watres.2017.01.036 467 21 Esch, K.J., & Petersen, C.A. (2013). Transmission and epidemiology of zoonotic protozoal 468 diseases of companion animals. Clinical Microbiology Reviews, 26, 58‒85. 469 https://doi.org/10.1128/CMR.00067-12 470 Feltus, D.C., Giddings, C.W., Schneck, B.L., Monson, T., Warshauer, D., & McEvoy, J.M. 471 (2006). Evidence supporting zoonotic transmission of Cryptosporidium spp. in 472 Wisconsin. Journal of Clinical Microbiology, 44, 4303‒4308. 473 https://doi.org/10.1128/JCM.01067-06 474 Feng, Y., & Xiao, L. (2011). Zoonotic potential and molecular epidemiology of Giardia species 475 and giardiasis. Clinical Microbiology Reviews, 24, 110–40. 476 https://doi.org/10.1128/CMR.00033-10 477 Feng, Y., Ryan, U.M., & Xiao, L. (2018). Genetic diversity and population structure of 478 Cryptosporidium. Trends in Parasitology, 34, 997‒1011. 479 https://doi.org/10.1016/j.pt.2018.07.009 480 Gabín-García, L.B., Bartolomé, C., Abal-Fabeiro, J.L., Méndez, S., Llovo, J., & Maside, X. 481 (2017). Strong genetic structure revealed by multilocus patterns of variation in Giardia 482 duodenalis isolates of patients from Galicia (NW-Iberian Peninsula). Infection, Genetics 483 and Evolution, 48, 131–141. https://doi.org/10.1016/j.meegid.2016.12.014 484 García-Presedo, I., Pedraza-Díaz, S., González-Warleta, M., Mezo, M., Gómez-Bautista, M., 485 Ortega-Mora, L.M., & Castro-Hermida, J.A. (2013). Presence of Cryptosporidium 486 scrofarum, C. suis and C. parvum subtypes IIaA16G2R1 and IIaA13G1R1 in Eurasian 487 wild boars (Sus scrofa). Veterinary Parasitology, 196, 497‒502. 488 https://doi.org/10.1016/j.vetpar.2013.04.017 489 García-Presedo, I., Pedraza-Díaz, S., González-Warleta, M., Mezo, M., Gómez-Bautista, M., 490 Ortega-Mora, L.M., Castro-Hermida, J.A. (2013). The first report of Cryptosporidium 491 22 bovis, C. ryanae and Giardia duodenalis sub-assemblage A-II in roe deer (Capreolus 492 capreolus) in Spain. Veterinary Parasitology, 197, 658–664. 493 https://doi.org/10.1016/j.vetpar.2013.07.002 494 Gil, H., Cano, L., de Lucio, A., Bailo, B., Mingo, M.H., Cardona, G.A., Fernández-Basterra, 495 J.A., Aramburu-Aguirre, J., López-Molina, N., & Carmena, D. (2017). Detection and 496 molecular diversity of Giardia duodenalis and Cryptosporidium spp. in sheltered dogs 497 and cats in Northern Spain. Infection, Genetics and Evolution, 50, 62‒69. 498 https://doi.org/10.1016/j.meegid.2017.02.013 499 Gomez-Bautista, M., Ortega-Mora, L.M., Tabares, E., Lopez-Rodas, V., & Costas, E. (2000). 500 Detection of infectious Cryptosporidium parvum oocysts in mussels (Mytilus 501 galloprovincialis) and cockles (Cerastoderma edule). Applied and Environmental 502 Microbiology, 66, 1866–1870. https://doi.org/10.1128/aem.66.5.1866-1870.2000 503 Gómez-Couso, H., Mendez-Hermida, F., Ares-Mazas, E. (2006). First report of 504 Cryptosporidium parvum ‘ferret’ genotype in American mink (Mustela vison Shreber 505 1777). Parasitology Research, 100, 877–879. https://doi.org/10.1007/s00436-006-506 0338-1 507 Guk, S.M., Yong, T.S., Park, S.J., Park, J.H., & Chai, J.Y. (2004). Genotype and animal 508 infectivity of a human isolate of Cryptosporidium parvum in the Republic of Korea. 509 Korean Jornal of Parasitology, 42, 85‒89. https://doi.org/10.3347/kjp.2004.42.2.85 510 Hamnes, I.S., Gjerde, B.K., Forberg, T., & Robertson, L.J. (2007). Occurrence of Giardia and 511 Cryptosporidium in Norwegian red foxes (Vulpes vulpes). Veterinary Parasitology, 143, 512 347–353. https://doi.org/10.1016/j.vetpar.2006.08.032 513 Lalle, M., Pozio, E., Capelli, G., Bruschi, F., Crotti, D., & Cacciò, S.M. (2005). Genetic 514 heterogeneity at the beta-giardin locus among human and animal isolates of Giardia 515 23 duodenalis and identification of potentially zoonotic subgenotypes. International 516 Journal for Parasitology, 35, 207–213. https://doi.org/10.1016/j.ijpara.2004.10.022 517 Li N, Xiao L, Alderisio K, Elwin K, Cebelinski E, Chalmers R, Santin M, Fayer R, Kvac M, 518 Ryan U, Sak B, Stanko M, Guo Y, Wang L, Zhang L, Cai J, Roellig D, & Feng Y. 519 (2014). Subtyping Cryptosporidium ubiquitum, a zoonotic pathogen emerging in 520 humans. Emerging Infectious Diseases, 20, :217‒224. 521 https://doi.org/10.3201/eid2002.121797 522 López Beceiro, A.M., Riguera Rey, L., Espino López, L., & González Machado M.A. (2009) 523 O Raposo en Galicia. Gráficas Sogal (ed.). Universidad de Santiago de Compostela. 524 Conselleria de Medio Ambiente e Desenvolvemento Sostible. Xunta de Galicia. pp 70. 525 Mateo, M., de Mingo, M.H., de Lucio, A., Morales, L., Balseiro, A., Espí, A., Barral, M., Lima 526 Barbero, J.F., Habela, M.Á., Fernández-García, J.L., Bernal, R.C., Köster, P.C., 527 Cardona, G.A., & Carmena, D. (2017). Occurrence and molecular genotyping of 528 Giardia duodenalis and Cryptosporidium spp. in wild mesocarnivores in Spain. 529 Veterinary Parasitology, 235, 86–93. https://doi.org/10.1016/j.vetpar.2017.01.016 530 Mackenstedt, U., Jenkins, D., & Romig, T. (2015). The role of wildlife in the transmission of 531 parasitic zoonoses in peri-urban and urban areas. International Journal for 532 Parasitology: Parasites and Wildlife, 4, 71‒79. 533 https://doi.org/10.1016/j.ijppaw.2015.01.006 534 Méndez-Hermida, F., Gómez-Couso, H., Romero-Suances, R., & Ares-Mazás, E. (2007). 535 Cryptosporidium and Giardia in wild otters (Lutra lutra). Veterinary Parasitology, 144, 536 153–156. https://doi.org/10.1016/j.vetpar.2006.09.029 537 Mmbaga, B.T., & Houpt, E.R. (2017). Cryptosporidium and Giardia infections in children: A 538 Review. Pediatric Clinics of North America, 64, 837–850. 539 24 https://doi.org/10.1016/j.pcl.2017.03.014 540 Navarro-i-Martinez, L., Bornay-Llinares, F.J., Rueda, C., del Aguila, C., da Silva, A.J., Oleaga, 541 A., Ramajo, V., Fenoy, S., & Pieniazek, N.J. (2003). Molecular characterization of 542 Cryptosporidium sp. from animals in Spain. Journal of Eukaryotic Microbiology, 50, 543 Suppl, 553–554. 544 Navarro-i-Martinez, L. (2010) Detección y Caracterización Molecular de Cryptosporidium spp. 545 Aislados de Humanos y Animales [Doctoral thesis]. Sant Joan D’Alacant: Universidad 546 Miguel Hernández. p. 197. 547 Navarro-i-Martinez, L., del Águila, C., & Bornay-Llinares, F.J. (2011). Cryptosporidium: a 548 genus in revision. The situation in Spain. Enfermedades Infecciosas y Microbiología 549 Clínica, 29, 135–143. https://doi.org/10.1016/j.eimc.2010.12.002 550 NESN (National Network of Epidemiological Surveillance). Red Nacional de Vigilancia 551 Epidemiológica. Instituto de Salud Carlos III. Ministerio de Ciencia, Innovación y 552 Universidades.Resultados de la Vigilancia Epidemiológica de las enfermedades 553 transmisibles. Informe anual. Año 2016. p. 146. 554 O’Handley, R.M. (2007). Cryptosporidium parvum infection in cattle: are current perceptions 555 accurate? Trends in Parasitology, 23, 477‒480. 556 https://doi.org/10.1016/j.pt.2007.08.005 557 Polley, L. (2005). Navigating parasite webs and parasite flow: emerging and re-emerging 558 parasitic zoonoses of wildlife origin. Int J Parasitol. 35(11-12):1279-94. https://doi.org/ 559 Read, C.M., Monis, P.T., & Thompson, R.C. (2004). Discrimination of all genotypes of Giardia 560 duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Infection, Genetics 561 and Evolution, 4, 125–130. https://doi.org/10.1016/j.ijpara.2005.07.003 562 Reh, L., Muadica, A.S., Köster, P.C., Balasegaram, S., Verlander, N.Q., Chércoles, E.R., & 563 25 Carmena, D. (2019). Substantial prevalence of enteroparasites Cryptosporidium spp., 564 Giardia duodenalis and Blastocystis sp. in asymptomatic schoolchildren in Madrid, 565 Spain, November 2017 to June 2018. Euro Surveillance, 24. 566 https://doi.org/10.2807/1560-7917.ES.2019.24.43.1900241. 567 Robertson, L.J. (2018). Parasites in food: From a neglected position to an emerging issue. 568 Advances in Food and Nutrition Research, 86, 71–113. 569 https://doi.org/10.1016/bs.afnr.2018.04.003 570 Ryan, U., Fayer, R., & Xiao, L. (2014). Cryptosporidium species in humans and animals: 571 current understanding and research needs. Parasitology, 141, 1667‒1685. 572 https://doi.org/10.1017/S0031182014001085 573 Ryan, U., & Cacciò, S.M. (2013). Zoonotic potential of Giardia. International Journal for 574 Parasitology, 43, 943‒956. https://doi.org/10.1016/j.ijpara.2013.06.001 575 Ryan, U., Zahedi, A., & Paparini, A. (2016). Cryptosporidium in humans and animals-a one 576 health approach to prophylaxis. Parasite Immunology, 38, 535–547. 577 https://doi.org/10.1111/pim.12350 578 Ryan, U., Hijjawi, & N., Xiao, L. (2018). Foodborne cryptosporidiosis. International Journal 579 for Parasitology, 48, 1‒12. https://doi.org/10.1016/j.ijpara.2017.09.004 580 Schiller, S.E., Webster, K.N., & Power, M. (2016). Detection of Cryptosporidium hominis and 581 novel Cryptosporidium bat genotypes in wild and captive Pteropus hosts in Australia. 582 Infection, Genetics and Evolution, 44, 254‒260. 583 https://doi.org/10.1016/j.meegid.2016.07.002 584 Šlapeta, J. (2006). Cryptosporidium species found in cattle: a proposal for a new species. Trends 585 in Parasitology, 22, 469‒474. https://doi.org/10.1016/j.pt.2006.08.005 586 26 Šlapeta, J. (2013). Cryptosporidiosis and Cryptosporidium species in animals and humans: a 587 thirty colour rainbow? International Journal for Parasitology, 43, 957‒970. 588 https://doi.org/10.1016/j.ijpara.2013.07.005 589 Stojecki, K., Sroka, J., Caccio, S.M., Cencek, T., Dutkiewicz, J., & Kusyk, P. (2015). 590 Prevalence and molecular typing of Giardia duodenalis in wildlife from eastern Poland. 591 Folia Parasitologica (Praha), 30, 62. https://doi.org/10.14411/fp.2015.042 592 Suárez-Luengas, L., Clavel, A., Quílez, J., Goñi-Cepero, M.P., Torres, E., Sánchez-Acedo, C., 593 & del Cacho, E. (2007). Molecular characterization of Cryptosporidium isolates from 594 pigs in Zaragoza (northeastern Spain). Veterinary Parasitology, 148, 231‒235. 595 https://doi.org/10.1016/j.vetpar.2007.06.022 596 Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013). MEGA6: molecular 597 evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30, 2725–598 2729. https://doi.org/10.1093/molbev/mst197 599 Thompson, R.C.A. (2004). The zoonotic significance and molecular epidemiology of Giardia 600 and giardiasis. Veterinary Parasitology, 126, 15–35. 601 https://doi.org/10.1016/j.vetpar.2004.09.008 602 Thompson, R.C. (2013). Parasite zoonoses and wildlife: One Health, spillover and human 603 activity. International Journal for Parasitology, 43, 1079‒1088. https://doi.org/ 604 Thompson, R.C.A., & Ash, A. (2016). Molecular epidemiology of Giardia and 605 Cryptosporidium infections. Infection, Genetics and Evolution, 40, 315–323. 606 https://doi.org/10.1016/j.ijpara.2013.06.007 607 Tiangtip, R., & Jongwutiwes, S. (2002). Molecular analysis of Cryptosporidium species 608 isolated from HIV-infected patients in Thailand. Tropical Medicine and International 609 Health, 7, 357–364. https://doi.org/10.1046/j.1365-3156.2002.00855.x 610 27 Verweij, J.J., Schinkel, J., Laeijendecker, D., van Rooyen, M.A., van Lieshout, L., & 611 Polderman, A.M. (2003). Real-time PCR for the detection of Giardia lamblia. 612 Molecular and Cellular Probes, 17, 223–225. https://doi.org/10.1016/S0890-613 8508(03)00057-4 614 Widmer, G., Köster, P.C., & Carmena, D. 2020. Cryptosporidium hominis infections in non-615 human animal species: Revisiting the concept of host specificity. International Journal 616 for Parasitology, in press. 617 Winstanley, R.K., Saunders, G., Buttermer, & W. Indices for predicting total body fat in red 618 foxes from Australia. 1998. Journal of Wildlife Management, 62, 1307‒1312. 619 https://doi.org/10.2307/3801995 620 Xiao, L. (2010). Molecular epidemiology of cryptosporidiosis: an update. Experimental 621 Parasitology, 124, 80–89. https://doi.org/10.1016/j.exppara.2009.03.018 622 Zahedi, A., Paparini, A., Jian, F., Robertson, I., & Ryan, U. (2016). Public health significance 623 of zoonotic Cryptosporidium species in wildlife: Critical insights into better drinking 624 water management. International Journal for Parasitology: Parasites and Wildlife, 5, 625 88–109. https://doi.org/10.1016/j.ijppaw.2015.12.001 626 FIGURE CAPTIONS 627 Figure 1. Map of the autonomous region of Galicia (Northwest Spain) showing the 628 geographical location where wild red foxes were sampled. Green and orange filled 629 circles/quadrants represent Cryptosporidium- and Giardia-positive results by PCR assays, 630 respectively. Yellow filled triangles represent samples that tested negative to both pathogens. 631 632 28 Figure 2. Phylogenetic tree depicting evolutionary relationships among Cryptosporidium 633 sequences at the ssu rRNA gene. The analysis was inferred using the Neighbor-Joining 634 method. Bootstrap values lower than 75% were not displayed. Filled triangles represent 635 sequences generated in the present study. Empty triangles indicate sequences from red foxes 636 previously reported in Spain and other countries, used for comparison purposes. Filled circles 637 represent reference sequences retrieved from the GenBank database. Cryptosporidium fragile 638 was used as outgroup taxa. 639