Citation: Del Monte-Monge, A.;
Ruiz-Polo de Lara, Í.; Gonzalo, P.;
Espinós-Estévez, C.; González-Amor,
M.; de la Fuente-Pérez, M.;
Andrés-Manzano, M.J.; Fanjul, V.;
Gimeno, J.R.; Barriales-Villa, R.; et al.
Lamin A/C Ablation Restricted to
Vascular Smooth Muscle Cells,
Cardiomyocytes, and Cardiac
Fibroblasts Causes Cardiac and
Vascular Dysfunction. Int. J. Mol. Sci.
2023, 24, 11172. https://doi.org/
10.3390/ijms241311172
Academic Editor: Andrea Ghiroldi
Received: 16 June 2023
Revised: 29 June 2023
Accepted: 3 July 2023
Published: 6 July 2023
Copyright: © 2023 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
 International Journal of 
Molecular Sciences
Article
Lamin A/C Ablation Restricted to Vascular Smooth Muscle
Cells, Cardiomyocytes, and Cardiac Fibroblasts Causes Cardiac
and Vascular Dysfunction
Alberto Del Monte-Monge 1,2, Íñigo Ruiz-Polo de Lara 1 , Pilar Gonzalo 1,2, Carla Espinós-Estévez 1,2 ,
María González-Amor 1,2 , Miguel de la Fuente-Pérez 1, María J. Andrés-Manzano 1,2, Víctor Fanjul 1,2,†,
Juan R. Gimeno 2,3, Roberto Barriales-Villa 2,4, Beatriz Dorado 1,2 and Vicente Andrés 1,2,*
1 Centro Nacional de Investigaciones Cardiovasculares (CNIC), Melchor Fernández Almagro 3,
28029 Madrid, Spain; alberto.delmonte@cnic.es (A.D.M.-M.); inigo.ruiz@cnic.es (Í.R.-P.d.L.);
pgonzalo@cnic.es (P.G.); carla.espinos@cnic.es (C.E.-E.); maria.gonzalez@cnic.es (M.G.-A.);
miguel.delafuente@cnic.es (M.d.l.F.-P.); mjandres@cnic.es (M.J.A.-M.); beatrizjulia.dorado@cnic.es (B.D.)
2 Centro de Investigación Biomédica en Red de Enfermedades Cardiovasculares (CIBERCV),
28029 Madrid, Spain; jgimeno@um.es (J.R.G.); rbarrialesv@gmail.com (R.B.-V.)
3 Cardiac Department, Hospital Clínico Universitario Virgen Arrixaca, 30120 Murcia, Spain
4 Unidad de Cardiopatías Familiares, Complexo Hospitalario Universitario A Coruña (INIBIC-CHUAC),
15006 A Coruña, Spain
* Correspondence: vandres@cnic.es; Tel.: +34-91-453-12-00 (ext. 1502)
† Present address: Savana Medical, 28013 Madrid, Spain.
Abstract: Mutations in the LMNA gene (encoding lamin A/C proteins) cause several human cardiac
diseases, including dilated cardiomyopathies (LMNA-DCM). The main clinical risks in LMNA-DCM
patients are sudden cardiac death and progressive left ventricular ejection fraction deterioration, and
therefore most human and animal studies have sought to define the mechanisms through which
LMNA mutations provoke cardiac alterations, with a particular focus on cardiomyocytes. To investi-
gate if LMNA mutations also cause vascular alterations that might contribute to the etiopathogenesis
of LMNA-DCM, we generated and characterized Lmnaflox/floxSM22αCre mice, which constitutively
lack lamin A/C in vascular smooth muscle cells (VSMCs), cardiac fibroblasts, and cardiomyocytes.
Like mice with whole body or cardiomyocyte-specific lamin A/C ablation, Lmnaflox/floxSM22αCre mice
recapitulated the main hallmarks of human LMNA-DCM, including ventricular systolic dysfunction,
cardiac conduction defects, cardiac fibrosis, and premature death. These alterations were associated
with elevated expression of total and phosphorylated (active) Smad3 and cleaved (active) caspase 3 in
the heart. Lmnaflox/floxSM22αCre mice also exhibited perivascular fibrosis in the coronary arteries and
a switch of aortic VSMCs from the ‘contractile’ to the ‘synthetic’ phenotype. Ex vivo wire myography
in isolated aortic rings revealed impaired maximum contraction capacity and an altered response to
vasoconstrictor and vasodilator agents in Lmnaflox/floxSM22αCre mice. To our knowledge, our results
provide the first evidence of phenotypic alterations in VSMCs that might contribute significantly
to the pathophysiology of some forms of LMNA-DCM. Future work addressing the mechanisms
underlying vascular defects in LMNA-DCM may open new therapeutic avenues for these diseases.
Keywords: lamin A/C; laminopathies; dilated cardiomyopathy; vascular smooth muscle cell;
vascular dysfunction; transgenic mice
1. Introduction
Nuclear A-type lamins are type V filaments that are predominantly located underneath
the inner nuclear membrane, where they are important components of the nuclear lamina
found in nearly all differentiated mammalian cells [1–3]. There are two main A-type
lamin proteins, lamins A and C, which are produced through alternative splicing of the
Int. J. Mol. Sci. 2023, 24, 11172. https://doi.org/10.3390/ijms241311172 https://www.mdpi.com/journal/ijms
Int. J. Mol. Sci. 2023, 24, 11172 2 of 18
same LMNA transcript (lamin C spans exons 1–10, while lamin A spans exons 1–12). A-
type lamins play a crucial role in maintaining nuclear integrity, structure, and function.
They ensure the proper spatial organization and function of chromatin, nuclear pore
complexes, and other proteins that interact with nuclear lamins; additionally, A-type
lamins are essential for nucleoskeleton–cytoskeleton connections, which are important for
signal mechanotransduction to the nucleus [4–6]. As a result, lamins A and C regulate
various cell functions, including cell proliferation, migration, and differentiation; signal
transduction and gene expression; responses to DNA damage; and mechanosensing [4–6].
Interestingly, the expression level of A-type lamins correlates with tissue stiffness and the
level of mechanical stress that cells experience. They are expressed at low levels in soft
tissues such as fat and the brain and at high levels in muscle tissues, where lamins protect
the nucleus from high mechanical stress [7,8].
Interest in A-type lamins has increased with the discovery of more than 400 LMNA
mutations that cause a broad range of human diseases collectively called laminopathies.
Laminopathies include systemic progeroid syndromes such as Hutchinson-Gilford progeria
syndrome and tissue-specific diseases, such as lipodystrophies, neurological diseases, and
a range of disorders affecting skeletal and/or cardiac muscle such as Emery–Dreifuss mus-
cular dystrophy, limb–girdle muscular dystrophy, and dilated cardiomyopathy (DCM) [3,9].
The second most frequent DCM, and the cause of more than 40% of sudden cardiac deaths,
is LMNA-associated DCM (LMNA-DCM), an autosomal dominant genetic disease charac-
terized by cardiac dilation, reduced systolic function, defective atrioventricular conduction,
cardiac arrythmias, extensive cardiac fibrosis, and heart failure [10–15]. Nearly 20% of
LMNA-DCM patients require heart transplantation, and sudden cardiac death due to ven-
tricular arrhythmias occurs frequently, often before the DCM becomes symptomatic [16].
There is a lack of specific therapies for LMNA-DCM, and patients are currently treated ac-
cording to the standard heart failure protocol, with those with malignant arrhythmic events
receiving an implantable cardioverter defibrillator to prevent sudden cardiac death [15,17].
There is, therefore, an urgent need for preclinical LMNA-DCM models that can be used
to identify mechanisms that govern disease progression and develop specific therapies
that have a real impact on society. Mouse models generated to investigate the molecular
and cellular pathogenesis of LMNA-DCM include knock-in mice ubiquitously expressing
Lmna mutations homologous to those that cause the disease in humans (LmnaN195K/N195K
and LmnaH222P/H222P) and knock-out mice with whole body Lmna deficiency, which progres-
sively develop cardiac fibrosis and conduction defects and DCM and die prematurely [18–21].
Similar to the whole body Lmna-null mice, Lmnaflox/floxMyh6-Cre mice with Lmna dele-
tion restricted to cardiomyocytes, develop severe cardiac dysfunction and conduction
defects, ventricular arrhythmias, cardiac fibrosis, and apoptosis and die within 4 weeks
of birth [22,23]. The cardiac phenotype of LMNA-DCM is also partially recapitulated in
Lmnaflox/floxPdgfra-Cre mice, in which A-type lamins are absent from ~80% of cardiac fibrob-
lasts and ~25% of cardiomyocytes [24]. Although studies using these cell-type-specific
mouse models identified the important role of cardiomyocytes and cardiac fibroblasts in
LMNA-DCM, they did not address the crosstalk among cardiac and non-cardiac cells, a
relevant issue considering that A-type lamins are broadly expressed in mammalian cells.
The purpose of this work was to examine the possible involvement in LMNA-DCM of Lmna
deletion in vascular smooth muscle cells (VSMCs), a cell type that plays a critical role in
cardiovascular pathophysiology. To this end, we generated Lmnaflox/floxSM22αCre mice to
evaluate the effects of combined Lmna deficiency in VSMCs, cardiomyocytes, and cardiac
fibroblasts, a situation that occurs in LMNA-DCM patients and provides a more transla-
tional model of the potential cross-talk between these cell types. In addition to developing
the expected severe cardiac phenotype and dying prematurely, Lmnaflox/floxSM22Cre mice
show VSMC alterations previously unrecognized in the context of LMNA-DCM that may
play an important role in the etiopathogenesis of this laminopathy.
Int. J. Mol. Sci. 2023, 24, 11172 3 of 18
2. Results
2.1. Lmnaflox/floxSM22αCre Mice with Lmna Deficiency Restricted to Vascular Smooth Muscle
Cells, Cardiac Fibroblasts, and Cardiomyocytes Die Prematurely
We crossed Lmnaflox/flox mice [25] with SM22αCre transgenic mice [26] to generate
Lmnaflox/floxSM22αCre mice with Lmna deletion restricted to VSMCs, cardiac fibroblasts,
and cardiomyocytes. To examine the efficiency and specificity of lamin A/C deletion in
Lmnaflox/floxSM22αCre mice, we performed immunofluorescence experiments with antibod-
ies against lamin A/C, CD31 (to detect endothelial cells), and SMA (to detect VSMCs).
As expected, lamin A/C expression was robust in all cell types in the aorta, liver, kidney,
and lung in control Lmnaflox/flox mice (Figure 1A) but was undetectable in medial VSMCs
in the vessels of Lmnaflox/floxSM22αCre mice, without apparent differences in other cell
types (Figure 1B). While gross examination revealed widespread and robust lamin A/C
expression in heart cross-sections in Lmnaflox/flox mice (Figure 2A), lamin A/C was unde-
tectable in the coronary artery VSMCs of Lmnaflox/floxSM22αCre mice and was below normal
levels in non-vascular myocardial tissue (Figure 2B). To identify which cell types in the
Lmnaflox/floxSM22αCre myocardium had lamin A/C deficiency, heart cross-sections were
co-stained with anti-lamin A/C antibodies, wheat germ agglutinin (WGA) to visualize
cardiomyocyte cell membranes, and anti-fibroblast specific protein 1 (FSP-1) antibodies to
detect cardiac fibroblasts. These studies revealed that lamin A/C expression was unde-
tectable in ~87% of cardiomyocytes and ~72% of cardiac fibroblasts in Lmnaflox/floxSM22αCre
mice (Figure 2C).
Phenotypic characterization of Lmnaflox/flox and Lmnaflox/floxSM22αCre mice revealed no
between-genotype differences in circulating blood cell populations (Figure 3A); however,
Lmnaflox/floxSM22αCre mice had slightly lower body weight (16.8% lower) (Figure 3B) and
dramatically reduced survival, with a median lifespan of 33 days and maximum survival
of 50 days (Figure 3C).
2.2. Lmnaflox/floxSM22α-Cre Mice Develop Cardiac Fibrosis and Severe Systolic Dysfunction and
Electrocardiographic Alterations
Immunohistopathological studies in 4-week-old Lmnaflox/floxSM22αCre mice and
Lmnaflox/flox controls showed no between-genotype differences in collagen content in tissue
sections from the liver, lung, and kidney (Figure 4A). However, Lmnaflox/floxSM22αCre mice
showed a trend towards increased collagen content in the aortic arch and thoracic aorta
(Figure 4B), which reached statistical significance in coronary arteries (Figure 4C). More-
over, Lmnaflox/floxSM22αCre hearts had significantly higher interstitial fibrosis (Figure 5A),
elevated WGA staining, and above-normal expression of the profibrotic markers FSP-1
and SMA (Figure 5B). These alterations in mutant hearts were associated with a higher
expression of p-Smad3, the active form of the pro-fibrotic transcription factor Smad3, as
revealed by immunofluorescence experiments (Figure 6A). Western blot analysis confirmed
an elevated expression of p-Smad3 in Lmnaflox/floxSM22αCre hearts, which was accompa-
nied by a higher expression of total Smad3 without changes in the p-Smad3/Smad3 ratio
(Figure 6B, left, middle, and right graphs, respectively). Lmnaflox/floxSM22αCre hearts also
had a higher expression of the active (cleaved) form of the pro-apoptotic protein caspase-3
(Figure 6C).
Echocardiography analysis detected significant systolic dysfunction in both the left
and right ventricles of Lmnaflox/floxSM22αCre mice, revealed by lower EF and TAPSE, re-
spectively (Figure 7A, Supplementary Table S1 and Videos S1–S4). Lmnaflox/floxSM22αCre
mice also showed a modest but statistically significant decrease in left ventricle mass thick-
ness (Figure 7A), whereas heart weight and tibia length were similar in both genotypes
(Figure 7B). ECG analysis revealed statistically significant between-genotype differences in
parameters indicative of a lower repolarization rate in Lmnaflox/floxSM22αCre mice, including
prolongation of the QRS and QT intervals and reduced T-wave steepness (Figure 7C). We
found no between-genotype differences in plasma levels of creatine kinase-MB and signifi-
Int. J. Mol. Sci. 2023, 24, 11172 4 of 18
cantly elevated plasma troponin in Lmnaflox/floxSM22α-Cre mice, despite high interindividual
variability in mutant mice (Figure 7D).
Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW  4  of  19  
 
LIVER KIDNEY LUNGAORTA
Lm
na
flo
x/
flo
x
200μm 100μm 100μm 100μm
Lm
na
flo
x/
flo
x 
SM
22
αC
re 200μm 100μm 100μm 100μm
CD31 SMA Lamin A/CDAPI
** *
*
*
*
****
*
*
*
*
****
A
B
** ** ** **
** ** ** **
** **
**
**
**
**
**
 
Figure  1.  Lamin  A/C  ablation  in  VSMCs  in  Lmnaflox/floxSM22αCre  mice.  Representative 
immunofluorescence images of aorta, liver, kidney, and lung from 4-week-old Lmnaflox/flox (A) and 
Lmnaflox/floxSM22αCre mice (B). Lamin A/C is visualized in white, endothelial cells in green (anti-CD31 
antibody), VSMCs in red (anti-smooth muscle α-actin (SMA) antibody), and nuclei in blue (DAPI 
staining). Magnified images show vessel-containing regions (*) and vessel-free regions (**). 
Figure 1. Lamin A/C ablation in VSMCs in Lmnaflox/floxSM22αCre mice. Representative im-
munofluorescence images of aorta, liver, kidney, and lung from 4-week-old L naflox/flox (A) and
L naflox/floxSM22αCre mice (B). Lamin A/C is visualized in white, endoth lial cells in green (anti-
CD31 antibody), VSMCs in red (anti-smooth muscle α-actin (SMA) antibody), and nuclei in blue
(DAPI staining). Magnified images show vessel-containing regions (*) and vessel-free regions (**).
Int. J. Mol. Sci. 2023, 24, 11172 5 of 18Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW  5  of  19  
 
 
 
Figure  2.  Lamin  A/C  ablation  in  heart  VSMCs,  cardiomyocytes,  and  cardiac  fibroblasts  in 
Lmnaflox/floxSM22αCre mice. (A,B) Representative immunofluorescence images of heart tissue from 4-
week-old  Lmnaflox/flox  (A)  and  Lmnaflox/floxSM22αCre  mice  (B).  Lamin A/C  is  visualized  in  white, 
endothelial cells in green (anti-CD31 antibody), VSMCs in red (anti-smooth muscle α-actin (SMA) 
antibody), and nuclei in blue (DAPI staining). Magnifications show vessel-containing (*) and vessel-
free  (**) regions.  (C) Representative  immunofluorescence  images of heart  tissue  from 4-week-old 
Lmnaflox/flox and Lmnaflox/floxSM22αCre mice. Lamin A/C is visualized in red, cell membranes in green 
(wheat germ agglutinin; WGA), cardiac fibroblasts in white (anti-FSP-1 antibody), and nuclei in blue 
(Hoechst  33342  staining).  Graphs  show  the  percentages  of  lamin  A/C-positive  nuclei  in 
cardiomyocytes and cardiac fibroblasts. Statistical analysis was conducted using an unpaired two-
tailed Student’s t-test. Data are mean ± SEM. Each symbol represents one animal. 
Figure 2. Lamin A/C ablation in heart VSMCs, cardiomyocytes, and cardiac fibroblasts in
Lmnaflox/floxSM22αCre mice. (A,B) Representative immunofluorescence images of heart tissue from
4-week-old Lmnaflox/flox (A) and Lmnaflox/floxSM22αCre mice (B). Lamin A/C is visualized in white,
endothelial cells in green (anti-CD31 antibody), VSMCs in red (anti-smooth muscle α-actin (SMA)
antibody), and nucl i in blue (DAPI staining). Magn fications show vessel-containing (*) and vessel-
free (**) regions. (C) Representative immunofluorescence images of heart tissue from 4-we k-old
Lmnaflox/flox and Lmnaflox/floxSM22αCre mice. Lamin A/C is visualized in red, cell membranes in green
(wheat germ agglutinin; WGA), cardiac fibroblasts in white (anti-FSP-1 antibody), and nuclei in
blue (Hoechst 33342 staining). Graphs show the percentages of lamin A/C-positive nuclei in car-
diomyocytes and cardiac fibroblasts. Statistical analysis was conducted using an unpaired two-tailed
Student’s t-test. Data are mean ± SEM. Each symbol represents one animal.
Int. J. Mol. Sci. 2023, 24, 11172 6 of 18
Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW  6  of  19  
 
Phenotypic  characterization  of  Lmnaflox/flox  and  Lmnaflox/floxSM22αCre  mice  revealed  no 
between-genotype differences in circulating blood cell populations (Figure 3A); however, 
Lmnaflox/floxSM22αCre mice had slightly lower body weight (16.8% lower) (Figure 3B) and 
dramatically reduced survival, with a median lifespan of 33 days and maximum survival 
of 50 days (Figure 3C). 
 
Figure 3. Lmnaflox/floxSM22αCre mice exhibit reduced body weight and lifespan. (A) Circulating blood 
cell counts in 4-week-old Lmnaflox/flox and Lmnaflox/floxSM22αCre mice. (B) Representative photograph 
of male and female mice of both genotypes. The graph shows body weight at 4 weeks of age. (C) 
Kaplan–Meier  survival  curves  of  Lmnaflox/floxSM22αCre  (median  survival  33  days)  and  control 
Lmnaflox/flox mice (n = 19 mice per genotype). Statistical analysis was conducted using an unpaired 
two-tailed Student’s t-test (A,B) and the log-rank (Mantel–Cox) test (C). Data are mean ± SEM. Each 
symbol represents one animal. 
2.2. Lmnaflox/floxSM22α‐Cre Mice Develop Cardiac Fibrosis and Severe Systolic Dysfunction and 
Electrocardiographic Alterations 
Immunohistopathological  studies  in  4-week-old  Lmnaflox/floxSM22αCre  mice  and 
Lmnaflox/flox controls showed no between-genotype differences in collagen content in tissue 
sections from the liver, lung, and kidney (Figure 4A). However, Lmnaflox/floxSM22αCre mice 
showed a trend towards increased collagen content in the aortic arch and thoracic aorta 
(Figure  4B),  which  reached  statistical  significance  in  coronary  arteries  (Figure  4C). 
Moreover, Lmnaflox/floxSM22αCre hearts had significantly higher interstitial fibrosis (Figure 
5A), elevated WGA staining, and above-normal expression of the profibrotic markers FSP-
1 and SMA (Figure 5B). These alterations in mutant hearts were associated with a higher 
expression of p-Smad3, the active form of the pro-fibrotic transcription factor Smad3, as 
revealed  by  immunofluorescence  experiments  (Figure  6A).  Western  blot  analysis 
confirmed an elevated expression of p-Smad3 in Lmnaflox/floxSM22αCre hearts, which was 
accompanied  by  a  higher  expression  of  total  Smad3  without  changes  in  the  p-
Smad3/Smad3  ratio  (Figure  6B,  left,  middle,  and  right  graphs,  respectively). 
Lmnaflox/floxSM22αCre hearts also had a higher expression of the active (cleaved) form of the 
pro-apoptotic protein caspase-3 (Figure 6C). 
Figure 3. Lmnaflox/floxSM22αCre mice exhibit reduced body weight and lifespan. (A) Circulating blood
cell counts in 4-week-old Lmnaflox/flox and L naflox/floxSM22αCre mice. (B) Representative photograph
of male and female mice of genotypes. The graph sh ws body weight at 4 weeks of age.
(C) Kaplan–Meier survival curves of Lmnaflox/floxSM22αCre (median survival 33 days) and control
Lmnaflox/flox mice (n = 19 mice per genotype). Statistical analysis was conducted using an unpaired
two-tailed Student’s t-test (A,B) and the log-rank (Mantel–Cox) test (C). Data are mean ± SEM. Each
symbol represents one animal.
Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW  7  of  19  
 
 
Figure  4.  Lmnaflox/floxSM22αCre  mice  show  increased  vascular  collagen  content.  Representative 
images of Masson’s trichrome staining in the (A) liver, lung, kidney, (B) aortic arch, thoracic aorta, 
and  (C)  coronary  arteries  of  4-week-old  Lmnaflox/flox  and Lmnaflox/floxSM22αCre mice. Graphs  show 
collagen content calculated relative  to the content  in Lmnaflox/flox mice  (=1). Statistical analysis was 
conducted  using  an  unpaired  two-tailed  Student’s  t-test. Data  are mean  ±  SEM.  Each  symbol 
represents one animal. 
Figure 4. Lmnaflox/floxSM22αCre mice show increased vascular collagen content. Representative
images of Masson’s trichr me stai ing in the (A) liver, lung, kidney, (B) aortic arch, thora ic a ta,
and (C) coronary arteries of 4-week-old Lmnaflox/flox and Lmnafl /floxSM22αCre mice. Graphs show
collagen content calculated relative to the content in Lmnaflox/flox mice (=1). Statistical analysis was
conducted using an unpaired two-tailed Student’s t-test. Data are mean ± SEM. Each symbol
represents one animal.
Int. J. Mol. Sci. 2023, 24, 11172 7 of 18
1 
 
 
Figure 5. Lmnaflox/floxSM22αCre mice develop cardiac fibrosis. Lmnaflox/flox 
and  Lmnaflox/floxSM22αCre  mice  were  examined  at  4  weeks  of  age.  (A) 
Representative  images of Masson’s trichrome and Sirius red staining; graphs 
show  collagen  content  in heart  vessel‐free  regions  calculated  relative  to  the 
content in Lmnaflox/flox mice (=1). One outlier identified with the GraphPad outlier 
calculator in the Lmnaflox/floxSM22αCre group was eliminated. (B) Representative 
immunofluorescence  images  of  heart  tissue  stained  with  wheat  germ 
agglutinin to visualize cell membranes (WGA, green), anti‐FSP‐1 antibody to 
identify cardiac fibroblasts (white), and anti‐smooth muscle actin antibody to 
identify fibrogenic activated fibroblasts (SMA, red). Graphs show the positive 
area relative to the total area of tissue. Statistical analysis was conducted using 
an unpaired  two‐tailed Student’s  t‐test. Data are mean ± SEM. Each symbol 
represents one animal. 
Figure 5. Lmnaflox/floxSM22αCre mice develop cardiac fibrosis. Lmnaflox/flox and Lmnaflox/floxSM22αCre
mice were exa ined at 4 weeks of age. (A) Representative images of Masson’s trichrome and Sirius
red staining; graphs show collagen content in heart vessel-free regions calculated relative to the
content in Lmnaflox/flox mice (=1). One outlier identified with the GraphPad outlier calculator in the
Lmnaflox/floxSM22αCre group was eliminated. (B) Representative immunofluorescence images of heart
tissue stained with wheat germ agglutinin to visualize cell membranes (WGA, green), anti-FSP-1
antibody to identify cardiac fibroblasts (white), and anti-smooth muscle actin antibody to identify
fibrogenic activated fibroblasts (SMA, red). Graphs show the positive area relative to the total area
of tissue. Statistical analysis was conducted using an unpaired two-tailed Student’s t-test. Data are
mean ± SEM. Each symbol represents one animal.
Int. J. Mol. Sci. 2023, 24, 11172 8 of 18Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW  9  of  19  
 
116
Lmnaflox/flox Lmnaflox/flox SM22αCre
Vinculin
p-Smad350
kDa
A
B
%
 p
-S
m
ad
3
po
si
tiv
e 
nu
cl
ei p=0.0014
10
20
30
p-
Sm
ad
3 
(M
IF
) p=0.0127
10,000
20,000
30,000
R
el
at
iv
e 
p-
Sm
ad
3
(v
er
su
s 
vi
nc
ul
in
) p<0.0001
1
2
Lmnaflox/flox SM22αCreLmnaflox/flox
Ac
tiv
e 
C
as
pa
se
-3
(%
 a
re
a) p=0.0047
2
4
6
8
C
Lmnaflox/flox
Lmnaflox/flox SM22αCre
Lmnaflox/flox SM22αCreLmnaflox/flox
Smad350
100 μm100 μm
100 μm100 μm
R
el
at
iv
e 
Sm
ad
3
(v
er
su
s 
vi
nc
ul
in
) 
1
2
3
p=0.0129
p-
Sm
ad
3/
Sm
ad
3
1
2
Hoechst
Active 
Caspase-3
Hoechst
p-Smad3
FIG.6
 
Figure  6.  Increased  total  Smad3, phosphorylated  Smad3,  and  active  caspase  3 protein  levels  in 
Lmnaflox/floxSM22αCre mouse hearts. Lmnaflox/flox  and Lmnaflox/floxSM22αCre mice were  examined  at  4 
weeks  of  age.  (A)  Representative  immunofluorescence  images  of  heart  tissue  showing 
phosphorylated Smad3 (S423 + S425; p-Smad3; white) and nuclei (stained with Hoechst 33342; blue). 
Graphs show p-Smad3-positive nuclei (top) and median intensity fluorescence (MIF) of p-Smad3-
positive  nuclei  (bottom).  (B) Representative Western  blots  of  heart  protein  lysates  probed with 
antibodies  against  p-Smad3,  Smad3,  and  vinculin  (the  latter  used  as  a  housekeeping  loading 
control). Each lane corresponds to the heart tissue from one mouse. Membranes incubated with anti-
p-Smad3 antibody were stripped off and used  for  incubation with anti-Smad3 antibody. Graphs 
show  relative p-Smad3  and  total Smad3  expression normalized  to vinculin  expression  (left  and 
middle graphs, respectively) and  the p-Smad3/Smad3 ratio after normalization  to vinculin (right 
graph). One  outlier  identified  in  the  Lmnaflox/floxSM22αCre group using  the Grubbs’  test was not 
included in the left graph. (C) Representative immunofluorescence images of the active (cleaved) 
form of caspase-3 (white) and nuclei (Hoechst 33342; blue). The graph shows the active caspase-3 
positive area as a percentage of the total area of tissue. Statistical analysis was conducted using an 
unpaired two-tailed Student’s t-test. Data are mean ± SEM. Each symbol represents one animal. 
Echocardiography analysis detected significant systolic dysfunction in both the left 
and  right  ventricles  of  Lmnaflox/floxSM22αCre mice,  revealed  by  lower  EF  and  TAPSE, 
respectively  (Figure  7A,  Supplementary  Table  S1,  and  Supplementary Videos  S1–S4). 
Lmnaflox/floxSM22αCre mice also showed a modest but statistically significant decrease in left 
ventricle mass thickness (Figure 7A), whereas heart weight and tibia length were similar 
in both genotypes  (Figure 7B). ECG analysis  revealed  statistically  significant between-
genotype  differences  in  parameters  indicative  of  a  lower  repolarization  rate  in 
Lmnaflox/floxSM22αCre  mice,  including  prolongation  of  the  QRS  and  QT  intervals  and 
reduced T-wave  steepness  (Figure  7C). We  found no between-genotype differences  in 
plasma  levels  of  creatine  kinase-MB  and  significantly  elevated  plasma  troponin  in 
Figure 6. Increased total Smad3, phos rylated Sma 3, and active caspase 3 protein levels in
Lmnaflox/floxSM2 αCre mouse h arts. Lmnaflox/flox and Lmnaflox/floxSM22αCre mice were examin d at
4 week of age. (A) Representative immunofluoresce ce image of heart tissue howing phosphory-
lated Smad3 (S423 + S425; p-Smad3; white) and nuclei (stained with Hoechst 33342; blue). Graphs
show p-Smad3-positive nuclei (top) and median intensity fluorescence (MIF) of p-Smad3-positive
nuclei (bottom). (B) Representative Wester blots of h art protein lysates probed with antibodies
against p-Smad3, Smad3, and vinculin (the latter used as a housekeeping loading control). Each
lane corresponds to the h art tissue from one mou e. Me branes incubated with anti-p-Smad3
antibody were stripped off and used for incubation with ant -Smad3 antibody. Graphs show rela ve
p-Smad3 and total ad3 expression normalized to vinculin expression (left and middle graphs,
respectively) and the p-Smad3/Sm d3 ratio after normalization to vinculin (right gr ph). One outlier
identified in the Lmnaflox/floxSM22αCre group using the Grubbs’ test was not included in the left graph.
(C) Representative immunofluorescence images of the active (cleaved) form of caspase-3 (white) and
nuclei (Hoechst 33342; blue). The graph shows the active caspase-3 positive area as a percentage of
the total area of tissue. Statistical analysis was conducted using an unpaired two-tailed Student’s
t-test. Data are mean ± SEM. Each symbol represents one animal.
Int. J. Mol. Sci. 2023, 24, 11172 9 of 18
Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW  10  of  19  
 
Lmnaflox/floxSM22α‐Cre mice, despite high interindividual variability in mutant mice (Figure 
7D). 
A C
Lmnaflox/flox SM22αCreLmnaflox/flox
B
Lmnaflox/flox SM22αCreLmnaflox/flox
LV
EF
 (%
)
LV function
p<0.0001
20
40
60
p<0.0001
RV function
TA
PS
E
0.5
1.0
Le
ng
th
(m
m
)
LV wall thickness
p=0.01
0.2
0.4
0.6
0.8
1 cm
He
ar
t
Ti
bi
a
Lmnaflox/flox Lmnaflox/flox SM22αCre
m
s
20
40
60
80
PQ Interval
m
s
QRS Interval
p<0.0001
5
10
15
20
QT Interval
m
s
p=0.0021
20
40
60
80
p<0.0001
T-wave steepness
m
V/
s
10
20
30
Ti
bi
a 
le
ng
ht
(m
m
)
5
10
15
H
ea
rt
 w
ei
gh
t(
g)
0.05
0.10
0.15
U
ni
ts
/L
Creatine kinase-MB
200
400
ng
/m
l
Troponin
D
0.2
0.4
0.6
p=0.0256
 
Figure 7. Lmnaflox/floxSM22αCre mice show a severe loss of cardiac function and electrocardiographic 
defects.  Lmnaflox/flox  and  Lmnaflox/floxSM22αCre  mice  were  examined  at  4  weeks  of  age.  (A) 
Representative echocardiography  images  (sagittal plane) and quantification of  left ventricle  (LV) 
function (EF, ejection fraction), right ventricle (RV) function (TAPSE, tricuspid annular plane systolic 
excursion), and LV wall thickness. These results are also shown in table format in Supplementary 
Table  S1.  Sagittal  and  longitudinal  planes  are  shown  in  Supplementary  Videos  S1–S4.  (B) 
Representative images of hearts and tibia bones and quantification of tibia length and heart weight. 
(C)  Quantification  of  PQ,  QRS,  and  QT  intervals  and  T-wave  steepness  obtained  by 
electrocardiography. (D) Plasma levels of creatine kinase MB isoform (CK-MB) and troponin. One 
outlier identified in the Lmnaflox/floxSM22αCre group using the Grubbs’ test was not included in the 
analysis  of  plasma  troponin.  Statistical  analysis  was  conducted  using  an  unpaired  two-tailed 
Student’s t-test for CK-MB and by the non-parametric Mann–Whitney test for troponin (troponin 
data did not  follow  a normal distribution). Data  are mean  ± SEM. Each  symbol  represents one 
animal. 
2.3. Lmnaflox/floxSM22αCre Mice Exhibit Contractile‐to‐Synthetic Phenotypic Switching in 
VSMCs and Vascular Dysfunction in the Aorta 
To investigate possible alterations in the vasculature of Lmnaflox/floxSM22αCre mice, we 
performed RT-qPCR on total RNA isolated from adventitia-free aortic tissue (Figure 8A). 
These  studies  revealed  significant  downregulation  in  the  expression  of  genes 
characteristic of ‘contractile’ VSMCs and upregulation of markers of ‘synthetic’ VSMCs in 
Lmnaflox/floxSM22αCre mice  (Figure  8B), with  no  between-genotype  differences  in  other 
genes relevant to VSMC function, including genes related to calcium homeostasis (Cam2), 
oxidative  stress  (Nox1,  Sod1),  and mitochondrial  and  sarcoplasmic  reticulum  function 
(Tfam, Calr) (Supplementary Figure S1).   
Figure 7. Lmnaflox/floxSM22αCre mice show a severe loss of cardiac function and electrocardiographic
defects. Lmnaflox/flox and Lmnaflox/floxSM22αCre mice were examined at 4 weeks of age. (A) Represen-
tative echocardiography images (sagittal plane) and quantification of left ventricle (LV) function (EF,
ejection fraction), right ventricle (RV) function (TAPSE, tricuspid annular plane systolic excursion),
and LV wall thickness. These results are also shown in table format in Supplementary Table S1. Sagit-
tal and longitudinal planes are shown in Supplementary Videos S1–S4. (B) Representative images of
hearts and tibia bones and quantification of tibia length and heart weight. (C) Quantification of PQ,
QRS, and QT intervals and T-wave steepness obtained by electrocardiography. (D) Plasma levels of
creatine kinase MB isoform (CK-MB) and troponin. One outlier identified in the Lmnaflox/floxSM22αCre
group using the Grubbs’ test was not included in the analysis of plasma troponin. Statistical analysis
was conducted using an unpaired two-tailed Student’s t-test for CK-MB and by the non-parametric
Mann–Whitney test for troponin (troponin data did not follow a normal distribution). Data are
mean ± SEM. Each symbol represents one animal.
2.3. Lmnaflox/floxSM22αCre Mice Exhibit Contractile-to-Synthetic Phenotypic Switching in
VSMCs and Vascular Dysfunction in the Aorta
To investigate possible alterations in the vasculature of Lmnaflox/floxSM22αCre mice, we
performed RT-qPCR on total RNA isolated from adventitia-free aortic tissue
(Figure 8A). These studies revealed significant downregulation in the expression of genes
characteristic of ‘contractile’ VSMCs and upr gulation of markers of ‘synthetic’ VSMCs
in L naflox/floxSM22αCre mice (Figure 8B), with no betwe -genotype differences in other
genes relevant to VSMC function, including genes related to calcium homeostasis (Cam2),
oxidative stress (Nox1, Sod1), and mitochondrial and sarcoplasmic reticulum function (Tfam,
Calr) (Supplementary Figure S1).
Int. J. Mol. Sci. 2023, 24, 11172 10 of 18
Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW  11  of  19  
 
B
Ac
ta2
Cn
n1
Pr
kg
1
Ta
gln
Sm
tn
So
x9
Sp
p1
Mm
p2
Vc
am
1
Klf
4
Lu
m log2FC
0.002 0.003 0.02 0.022 0.0035 0.0083 0.031
N
or
m
al
iz
ed
ex
pr
es
si
on
vs
 H
pr
t
‘Synthetic’ genes‘Contractile’ genes
Lmnaflox/flox
Lmnaflox/flox
SM22αCRE
p-value
C
D E
Lmnaflox/flox SM22αCre
Lmnaflox/flox * p<0.05
** p<0.01
G H
F
A
−9
−8
−7
−6
−5
Ph
en
yl e
ph
ri n
e
(l o
g
M
)
p=0.001
EC50
−9 −8 −7 −6 −5
0
20
40
60
80
100
DEA-NO (log M)
R
el
ax
at
io
n
(%
)
*
ANOVA p=0.0044
0
20
40
60
80
100
Acetylcholine (log M)
R
el
ax
at
io
n
(%
) *
*
*
ANOVA p=0.0344
−9 −8 −7 −6 −5
0.0
0.5
1.0
1.5
2.0
Phenylephrine (log M)
C
on
t r
a c
t io
n
(m
N
/ m
m
)
**
*
* **
ANOVA p<0.0001
−9 −8 −7 −6 −4−5
 
Figure 8. Lmnaflox/floxSM22αCre mice exhibit contractile-to-synthetic phenotypic switching in vascular 
smooth muscle cells and vascular dysfunction in the aorta. Lmnaflox/flox and Lmnaflox/floxSM22αCre mice 
were examined at 4 weeks of age. (A) Protocol for processing mouse thoracic aorta (TA) samples for 
real-time  quantitative  PCR  (RT-qPCR).  Aortas  were  isolated  from  Lmnaflox/flox  and 
Lmnaflox/floxSM22αCre mice. After removing the aortic arch and perivascular tissue, TA samples were 
incubated with type I collagenase. Adventitia was then removed manually, and samples from mice 
of the same genotype and sex were paired for isolation of total RNA. Created with BioRender.com. 
(B) RT-qPCR analysis of adventitia-free thoracic aorta, examining the expression of vascular smooth 
muscle cell ‘contractile’ and ‘synthetic’ genes (n = 5). Each replicate contained the thoracic aortas 
from two mice of the same genotype and sex. Data are presented as the ΔCt fold change relative to 
control samples. Hprt was used as the housekeeping gene. The heatmap shows the log2 of the fold 
change  relative  to  control  Lmnaflox/flox mice.  (C–H) Thoracic  aorta  rings were mounted  in  a wire 
myograph  system  to  examine  the  following parameters  (n  =  10  each genotype): diameter–force 
relationship and its linear regression slope (an estimation of vessel stiffness) (C); estimated aortic 
ring  diameter  at  100  mmHg  (D);  maximum  response  induced  by  120  mmol/L  KCl  (E); 
concentration–response curves to phenylephrine, and the concentration of phenylephrine giving the 
half-maximal  response  (EC50)  (F);  endothelium-dependent  vasodilation  induced  by  increasing 
concentrations  of  acetylcholine;  (G);  and  endothelium-independent  vasodilation  induced  by 
increasing  concentrations of diethylamine NONOate  (DEA-NO)  (H). Statistical differences were 
analyzed using an unpaired two-tailed Student’s t-test in (B,C) (right graph) and (D–F) (right graph) 
or by two-way ANOVA and Fisher’s LSD multiple comparisons test in the dose–response curves in 
(F–H). Data are mean ± SEM. 
Ex vivo wire myography experiments with thoracic aorta rings revealed no between-
genotype differences in vessel stiffness (Figure 8C) or physiological diameter (Figure 8D). 
However,  the  potassium-stimulated maximum  contraction was  significantly  lower  in 
Lmnaflox/floxSM22αCre mice (Figure 8E). Likewise, although aortic rings with VSMC-specific 
Figure 8. Lmnaflox/floxSM22αCre mice exhibit contractile-to-synthetic phenotypic switching in vascular
smooth muscle cells and vascular dysfunction in the aorta. Lmnaflox/flox and Lmnaflox/floxSM22αCre
mice were examined at 4 weeks of age. (A) Protocol for processing mouse thoracic aorta (TA)
samples for real-time quantitative PCR (RT-qPCR). Aortas were isolated from Lmnaflox/flox and
Lmnaflox/floxSM22αCre mice. After rem vin the aortic arch and perivascular tissue, TA samples were
incubated with type I collagenas . Adventitia was then removed m nually, and samples from mice
of the same genotype and sex wer paired for is lation of total RNA. Cre te with BioRender.com.
(B) RT-qPCR analysis of adv ntitia-free thoracic aorta, examining t expression of vasc l r smooth
muscle cell ‘contractile’ and ‘synthetic’ genes (n = 5). Each replicate c ntained the thoracic aortas from
two mice of the same genotype and sex. Data are presented as the ∆Ct fold change relative to control
samples. Hprt was used as the housekeeping gene. The heatmap shows the log2 of the fold change
relative to control Lmnaflox/flox mice. (C–H) Thoracic aorta rings were mounted in a wire myograph
system to examine the following parameters (n = 10 each genotype): diameter–force relationship and
its linear regression slope (an estimation of vessel stiffness) (C); estimated aortic ring diameter at 100
mmHg (D); maximum response induced by 120 mmol/L KCl (E); concentration–response curves
to phenylephrine, and the concentration of phenylephrine giving the half-maximal response (EC50)
(F); endothelium-dependent vasodilation induced by increasing concentrations of acetylcholine; (G);
and endothelium-independent vasodilation induced by increasing concentrations of diethylamine
NONOate (DEA-NO) (H). Statistical differences were analyzed using an unpaired two-tailed Stu-
dent’s t-test in (B,C) (right graph) and (D–F) (right graph) or by two-way ANOVA and Fisher’s LSD
multiple comparisons test in the dose–response curves in (F–H). Data are mean ± SEM.
Int. J. Mol. Sci. 2023, 24, 11172 11 of 18
Ex vivo wire myography experiments with thoracic aorta rings revealed no between-
genotype differences in vessel stiffness (Figure 8C) or physiological diameter (Figure 8D).
However, the potassium-stimulated maximum contraction was significantly lower in
Lmnaflox/floxSM22αCre mice (Figure 8E). Likewise, although aortic rings with VSMC-specific
Lmna ablation contracted more than controls at phenylephrine doses below 10−7 M, their
maximum contraction was lower at higher phenylephrine concentrations, with a sig-
nificantly lower EC50 (phenylephrine dose giving a half-maximal response) (Figure 8F).
Interestingly, a lack of lamin A/C in aortic VSMCs was also associated with significantly
lower endothelium-dependent vasorelaxation induced by acetylcholine (Figure 8G) and
endothelium-independent vasorelaxation induced by the NO donor DEA-NO (Figure 8H).
3. Discussion
The major severe clinical manifestations of LMNA-DCM are sudden cardiac death
and progressive LVEF deterioration [10–16]. Therefore, most studies have sought to de-
fine the mechanisms through which LMNA mutations provoke cardiac alterations, with
a particular focus on cardiomyocytes. However, A-type lamins are expressed in most
differentiated cells, and it is therefore of the utmost interest to investigate the potential
pathological effects of LMNA mutations on other cell types, which may cause alterations
in cardiac muscle through paracrine mechanisms. In the present study, we generated
and characterized Lmnaflox/floxSM22αCre mice with constitutive lamin A/C deficiency in
VSMCs, cardiac fibroblasts, and cardiomyocytes, abundant cell types in the heart. Consis-
tent with previous studies in Myh6-Cre:Lmnaf/f mice with lamin A/C deficiency exclusively
in cardiomyocytes [22,23], Lmnaflox/floxSM22αCre mice recapitulated the main hallmarks
of human LMNA-DCM, including cardiac fibrosis, ventricular systolic dysfunction, ECG
alterations, and premature death. Importantly, the time course and severity of disease in
Lmnaflox/floxSM22αCre mice were strikingly similar to observations in whole-body Lmna-null
mice and the cardiomyocyte-specific Myh6-Cre:Lmnaf/f mice [19,22,23]. Indeed, our new
model demonstrates that extending lamin A/C disruption to VSMCs and cardiac fibroblasts
does not aggravate the lifespan reduction caused by Lmna deficiency restricted to cardiomy-
ocytes (median lifespan ~1 month in both models). Recent studies in Pdfra-Cre:Lmnaf/f
mice with lamin A/C absence in ~80% of cardiac fibroblasts and ~25% of cardiomyocytes
partially recapitulated the LMNA-DCM phenotype, with a median lifespan of ~43 days [24].
Moreover, restoration of lamin A expression in ~40% of cardiomyocytes in Lmna−/−; Tg
mice partially rescued ECG alterations and extended lifespan by 12% compared with
controls with whole body Lmna ablation [21]. Collectively, the results in these mouse mod-
els suggest that cardiomyocyte-autonomous and non-cardiomyocyte-autonomous factors
play an important role in the etiopathogenesis of LMNA-DCM. Further discrimination of
the individual role of VSMCs and cardiac fibroblasts in LMNA-DCM would require the
generation of new mouse models with Lmna deficiency restricted to these cell types.
Consistent with previous studies in Lmna−/− and Myh6-Cre:Lmnaf/f mice [22,23],
Lmnaflox/floxSM22αCre mice showed evidence of cardiac fibrosis and apoptosis, which was
accompanied by elevated fibroblast and myofibroblast markers, including WGA staining
and immunostaining of FSP-1 and SMA. Previous studies have suggested that cardiomy-
ocyte apoptosis in Lmna-null mice may result from altered gene expression, disruption
of cytoskeleton tension, and defective force transmission [20]. Regarding fibrosis, it is
well-known that members of the transforming growth factor β (TGFβ) superfamily trigger
pro-fibrotic transcriptional programs through the activation of SMAD-dependent signaling
in cardiomyocytes, fibroblasts, immune cells, and vascular cells [27]. For example, phospho-
rylation of SMAD3 triggers the conversion of cardiac fibroblasts into secretory pro-fibrotic
myofibroblasts expressing extracellular matrix and contractile proteins (such as SMA) and
integrins, thus promoting myofibroblast migration, survival, and growth arrest and scar
formation [27]. We found elevated Smad3 and p-Smad3 expression in Lmnaflox/floxSM22αCre
hearts without changes in the p-Smad3/Smad3 ratio. Phosphorylation (activation) of
Smad proteins was also observed in the hearts of LmnaH222P/H222P mice [28], and Lmna-null
Int. J. Mol. Sci. 2023, 24, 11172 12 of 18
cardiomyocytes isolated from Lmnaflox/floxMyh6-Cre mice exhibited high TGFβ1 mRNA and
protein expression [22]. Collectively, these results suggest that lamin A/C deficiency and
expression of the DCM-causing LmnaH222P protein provoke cardiac fibrosis at least in part
through activation of TGFβ/SMAD signaling. Future studies are warranted to assess if
TGFβ/SMAD signaling is abnormally activated in the heart in other mouse models of
LMNA-DCM and in patients.
Uncertainty has surrounded the question of whether vascular abnormalities exist and
play a role in the pathogenesis and progression of non-ischemic DCM [29]. Mathier et al.
reported the presence of abnormal coronary endothelium-dependent vasodilation in the
epicardium and the microcirculation at early disease stages in patients with acute-onset
DCM [30]. These authors also found an association between the preservation of endothelial
function and improved LVEF in this population [30]. Furthermore, non-ischemic DCM has
been linked to vascular derangements and to defective vasculogenesis and angiogenesis in
patients [29]. Recently, Sayed et al. reported clinical endothelial dysfunction in patients
with LMNA-DCM, and human induced pluripotent stem cell-derived endothelial cells (ECs)
carrying DCM-causing LMNA mutations presented hallmarks of endothelial dysfunction,
including a decreased capacity to produce nitric oxide and impaired angiogenic potential
in vitro [31]. To our knowledge, our current results provide the first evidence that Lmna de-
ficiency also provokes VSMC alterations in vivo. Four-week-old Lmnaflox/floxSM22αCre mice
displayed a phenotype switch in the aorta from the ‘contractile’ phenotype characteristic of
‘healthy’ VSMCs to the ‘synthetic’ VSMC phenotype that characterizes the inflamed vessel
wall in various forms of vascular disease [32]. The mice also showed incipient fibrosis in
the aorta, which reached statistical significance in coronary arteries. Moreover, our myo-
graph studies show that aortic rings with VSMC-specific Lmna deficiency have impaired
maximum contraction and a defective response to vasodilators and vasoconstrictors with
accompanying alterations in relaxation induced by the nitric oxide donor DEA-NO, evidenc-
ing VSMC dysfunction. VSMC injury might also contribute to the endothelial dysfunction
reported in LMNA-DCM patients [31] since aortic rings lacking lamin A/C specifically in
VSMCs had depressed endothelium-dependent acetylcholine-induced relaxation despite
normal lamin A/C expression in ECs. Alterations in gene expression and function in lamin
A/C-deficient VSMCs and ECs are likely caused by defective mechanotransduction and
altered signaling, transcription, and chromatin organization, which are key processes that
are regulated by A-type lamins [4,6]. Collectively, these studies suggest that dysfunctional
ECs and VSMCs contribute to the etiopathogenesis of LMNA-DCM and that therapies to
ameliorate vascular cell function may have a beneficial effect on the heart. Consistent with
this, treatment with lovastatin ameliorated endothelial function in cultured LMNA iPSC-
ECs and in LMNA-DCM patients and also improved the functional phenotype of LMNA
iPSC-derived cardiomyocytes when co-cultured with LMNA iPSC-ECs [31]. Although
mouse models harboring cell-type-specific Lmna alterations have provided important in-
sights into the mechanisms underlying LMNA-DCM, future mechanistic and therapeutic
studies should use more translational ubiquitous models that consider the crosstalk among
cardiac and non-cardiac cells. More research is also warranted to identify the mechanisms
that cause vascular dysfunction in LMNA-DCM and to investigate vascular pathology in
LMNA-DCM patients, as these approaches may open new therapeutic avenues for the
treatment of these diseases.
4. Materials and Methods
4.1. Mice
Lmnaflox/flox mice [25] and SM22αCre mice (TaglnCre, The Jackson Laboratory, stock
no: 017491) [26], both on the C57BL/6J genetic background, were crossed to generate
Lmnaflox/floxSM22Cre mice. Genotyping was performed by PCR analysis of genomic DNA
extracted from mouse tails using the primers shown in Table 1. All experiments were
performed with 4-week-old mice and balanced numbers of males and females.
Int. J. Mol. Sci. 2023, 24, 11172 13 of 18
Table 1. Primer sequences used for mouse genotyping.
Genotyping Forward (5′ → 3′) Reverse (5′ → 3′)
SM22αCre Transgene GCGGTCTGGCAGTAAAAACTATC GTGAAACAGCATTGCTGTCACTT
SM22αCre Internal positive control CTAGGCCACAGAATTGAAAGATCT GTAGGTGGAAATTCTAGCATCATCC
Lmnaflox/flox AACCCAGCCTCAGAAACTGGTGGATG GACAGCTCTCCTCTGAAGTGCTTGGA
4.2. Longevity Studies
Animals were weighed periodically and inspected daily for health status and survival
by a veterinarian blinded to genotype. Animals that met humane end-point criteria were
euthanized and censored in the Kaplan–Meier survival analysis. Animals sacrificed due
to hydrocephalus, malocclusion, inter-male aggression, or other reasons unconnected to
phenotype were excluded from the analysis.
4.3. Hematology and Cardiac Biochemical Parameters
Blood was extracted from the submaxillary vein and collected in microvette 100 K3
EDTA tubes (Sarstedt, Nümbrecht, Germany), and circulating blood cell populations were
quantified using the PENTRA 80 hematology platform (HORIBA Medical, Madrid, Spain).
Plasma was isolated by centrifugation of whole blood (2000× g, 15 min at room tempera-
ture). Creatine kinase-MB and troponin were measured in plasma using a DIMENSION
RxL MAX chemistry analyzer (Siemens, Munich, Germany).
4.4. Histology and Immunofluorescence
All mouse organs were fixed in 4% paraformaldehyde for 48 h, dehydrated through
50%, 70%, 95%, and 100% alcohol, embedded in paraffin, and cut in 5 µm sections using a
HM 355S microtome (Thermo Scientific, Waltham, MA, USA). For immunofluorescence
analysis of active caspase-3 and phospho-Smad 3 (S423 + S425) (p-Smad 3) on heart sections,
antigens were retrieved with 10 mM sodium citrate buffer (pH6) or TRIZMA base EDTA
(pH9). Samples were then blocked and permeabilized for 1 h at room temperature in PBS
containing 0.3% Triton X100 (9002-93-1, Sigma, Kawasaki, Japan), 5% bovine serum albumin
(BSA, A7906, Sigma), and 5% normal goat serum (005-000-001, Jackson ImmunoResearch,
West Grove, PA, USA). Sections were then incubated overnight at 4 ◦C with antibodies
against CD31 (ab28364, Abcam, Cambridge, UK, 1:100), lamin A/C (sc-376248, Santacruz,
Santa Cruz, CA, USA, 1:100), FSP-1 (A5114, Dako, Glostrup, Denmark, 1:200), the active
(cleaved) form of caspase-3 (AF835, R&D Systems, Minneapolis, MN, USA, 1:200; distin-
guishes apoptotic cells from non-apoptotic cells), and p-Smad 3 (S423 + S425) [EP823Y]
(ab52903, Abcam, 1:100). After washes, sections were incubated for 2 h at room temperature
with an antibody to smooth muscle α-actin (SMA) conjugated to Cy3 (C6198, Sigma, 1:20),
anti-rabbit-Alexa Fluor 647 secondary antibody (111-607-008, Jackson ImmunoResearch,
1:400), wheat germ agglutinin-Alexa Fluor 488 (W11261, ThermoFisher, Waltham, MA, USA,
1:300), and Hoechst 33342 or DAPI (1:1000). Sections were mounted in Fluoromount-G
imaging medium (00-4958-02, ThermoFisher).
For histological studies, tissue sections were stained with hematoxylin/eosin, pi-
crosirius red, or Masson’s trichrome using standard protocols. Images were scanned
with a NanoZoomer-RS scanner (Hamamatsu, Shizuoka, Japan) and were exported using
NDP.view2. Immunofluorescence images were acquired with a Zeiss LSM700 confocal
microscope. Images were analyzed with ImageJ software version 1.53c by an operator
blinded to genotype. At least 3 tissue sections per animal were analyzed, with the removal
of the immunofluorescence signals from arterioles. Mean values were used for statistical
analysis.
Int. J. Mol. Sci. 2023, 24, 11172 14 of 18
4.5. Aortic RNA Extraction and Real-Time Quantitative PCR (RT-qPCR)
Mouse thoracic aortas were incubated for 10 min at 37 ◦C in DMEM (Gibco, Billings,
MT, USA) containing 2 mg/mL type I collagenase (Worthington, Columbus, OH, USA,
LS004194). Adventitia was then removed manually, and the remaining tissue was snap-
frozen and stored at −80 ◦C until further use. Each biological sample was a pool of two
aortas from mice of the same genotype and sex. RNA was isolated using the RNeasy
Mini Kit (Qiagen, Hilden, Germany). RNA (1 µg) was reverse-transcribed to cDNA using
the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Waltham, MA,
USA). Real-time quantitative PCR (RT-qPCR) was performed using the primers shown
in Table 2 and Power SYBR Green PCR Master Mix (Applied Biosystems) in a C1000
Touch Thermal Cycler (Bio-Rad, Hercules, CA, USA). All the values were normalized to
the housekeeping hypoxanthine-guanine phosphoribosyl transferase (HPRT) gene. All
reactions were performed in triplicate.
Table 2. Primer sequences used for real-time quantitative PCR.
Gene Forward (5′ → 3′) Reverse (5′ → 3′)
Acta2 AAGAGGAAGACAGCACAGCC AGCGTCAGGATCCCTCTCTT
Calr CCAGAAATTGACAACCCTGAA CCTTAAGCCTCTGCTCCTCAT
Cam2 AAGTTGATGAAATGATCAGGGAAG TGAAGTCCTAATTACTATACATGCATA
Cnn1 TGGGAGTCAAGTATGCAGAG CTGACTGGCAAACTTGTTGG
Hprt CCTAAGATGAGCGCAAGTTGAA CCACAGGACTAGAACACCTGCTAA
Klf4 TTGTGACTATGCAGGCTGTG TAGTGCCTGGTCAGTTCATC
Lum TTCACTGGGCTGCAATACC TCCCAGGATCTTACAGAAGC
Mmp2 ACCTTGACCAGAACACCATC AGCATCATCCACGGTTTCAG
Nox1 CAACAGCACTCACCAATGCC ACATCCTCACTGACTGTGCC
Prkg1 ACTGCATGTGTGGTAGAAGC GCCAGTCAGAAGCTCATACATC
Smtn AGAACACCATCACCCACATC TCTTGTCCAGGACTCCTTCG
Sod1 TGGGTTCCACGTCCATCAGTA ACCGTCCTTTCCAGCAGTCA
Sox9 AGAACAAGCCACACGTCAAG GTCTCTTCTCGCTCTCGTTC
Spp1 GGTGATAGCTTGGCTTATGG TGGGCAACAGGGATGACATC
Tagln CCCAGACACCGAAGCTACTC GACTGCACTTCTCGGCTCAT
Tfam CAGGAGGCAAAGGATGATTC CCAAGACTTCATTTCATTGTCG
Vcam1 TCAAGGGTGACCAGCTCATG TCGTTGTATTCCTGGGAGAG
4.6. Western Blot
Snap-frozen hearts were lysed in ice-cold 50 mM Tris-HCl buffer (pH 8.8) containing
2% SDS, 8 M Urea, and 2 M thiourea using a TissueLyser (Qiagen). Lysates (25 µg protein)
were mixed with loading buffer including 11 mg/mL 2-mercaptoethanol, incubated at
95 ◦C for 5 min, and resolved on SDS-10% polyacrylamide gels. Proteins were transferred to
a PVDF membrane (Immobilon-P pore 0.45 µm, Sigma Aldrich, St. Louis, MO, USA) using
standard methods for wet transfer. Membranes were blocked for 1 h in 5% BSA-TBS-T for
anti-p-Smad3 and 5% milk-TBS-T for the rest of the antibodies (TBS-T: Tris-buffered saline
supplemented with 0.2% Tween-20). Membranes were incubated overnight at 4 ◦C with
the following primary antibodies: anti-Smad3 (EP568Y) (ab40854, Abcam, 1:1000), anti-
phospho-Smad3 (S423 + S425) (EP823Y) (ab52903, Abcam, 1:1000), and anti-Vinculin Clone
hVIN-1 (V9131, Sigma, 1:1000). After extensive washes with TBST-T, immunocomplexes
in the membranes were detected with species-appropriate HRP-conjugated secondary
antibodies and were visualized using HRP Western Luminata Forte (WBLUF0100, Milli-
Int. J. Mol. Sci. 2023, 24, 11172 15 of 18
pore, Burlington, MA, USA). The relative intensity of protein bands was determined by
densitometry with ImageQuant software version 1.2.
4.7. Echocardiography
Transthoracic echocardiography was performed by expert operators using a high-
frequency ultrasound system (Vevo 2100, Visualsonics Inc., Toronto, ON, Canada) with
a 40 MHz linear probe. Operators were blinded to genotype. Two-dimensional (2D) and
M-mode (MM) echography scans were performed at a frame rate > 230 frames/sec, and
pulse wave Doppler (PW) was acquired with a pulse repetition frequency of 40 kHz. Mice
were anaesthetized with 0.5–2% isoflurane in oxygen, with isoflurane delivery adjusted to
maintain the heart rate at 450 ± 50 beats per minute (bpm). Mice were placed in a supine
position on a heating platform, warmed ultrasound gel was used to maintain normothermia,
and eye-drop gel was used to prevent dryness. A base apex electrocardiogram (ECG) was
continuously monitored. Images were analyzed off-line using the Vevo 2100 Workstation
software v5.6.1. For left ventricular systolic function assessment, parasternal standard 2D
and MM long and short axis views were acquired. Left ventricular ejection fraction (LVEF),
fractional shortening, stroke volume, cardiac output, and thickness were calculated from
these views. Right ventricular systolic function was indirectly estimated using tricuspid
annular plane systolic excursion (TAPSE), obtained from a MM 4-chamber apical view, to
measure maximum lateral tricuspid annulus movement.
4.8. Electrocardiography
Mice were anaesthetized with 0.5–1.5% isoflurane in oxygen. To avoid night–day
circadian variations, ECGs were always recorded in the morning. ECG electrodes were
inserted subcutaneously in the four limbs. Sequential ECG recordings were acquired at
2 kHz using an MP36R data acquisition workstation (Biopac Systems, Goleta, CA, USA)
and exported with AcqKnowledge software v4.1 (Biopac Systems). Automatic analysis
with custom R scripts was used to remove noise and baseline fluctuations; detect heartbeat,
peaks, and waves; exclude artifacts; and calculate heart rate, QRS and QT intervals, and
T-wave steepness. Lead II was selected for the study, since the signal was more stable in
most experiments, allowing more robust wave identification. Heart rate was calculated
as the inverse of the time difference between two consecutive R-wave peaks (RR). Due to
potential noise interference with the detection of the beginning of P-waves, the PQ interval
was measured from the P-wave peak to the beginning of the Q-wave. The end of the
S-wave (J) is not evident in mice because the ST segment is absent in this species and is
replaced by a J-wave corresponding to a positive segment of the T-wave. Therefore, the
QRS complex was calculated from the Qs to the S-wave minimum and the QT interval from
the Qs to the T-wave peak (also termed J-wave peak). T-wave morphological alterations
were quantified by defining T-wave steepness as an indicator of T-wave flattening that
represents the absolute value of the slope (voltage variation over time) between the T-wave
peak and T90.
4.9. Wire Myography
Aortas were dissected free of fat and connective tissue and placed in cold Krebs
Henseleit Solution (KHS: 115 mmol/L NaCl, 25 mmol/L NaHCO3, 4.7 mmol/L KCl,
1.2 mmol/L MgSO4·7H2O, 2.5 mmol/L CaCl2, 1.2 mmol/L KH2PO4, 11.1 mmol/L glucose,
and 0.027 mmol/L EDTA). Segments of thoracic aortas, 2 mm in length, were mounted
on a wire myograph system (620 M, DMT) for isometric tension recording. After a 30 min
equilibration period in KHS oxygenated with a mixture of 95% O2 and 5% CO2 at 37 ◦C
and pH 7.4, diameter–tension relationships were determined by increasing the distance
between the wires passing through the lumen, thus increasing its passive diameter. At
each step, the force and the internal circumference of the vessel were recorded [33]. Then,
segments were stretched to their optimal lumen diameter for active tension development
(LabChart software, ADInstruments, Sydney, Australia, [33]). This was determined based
Int. J. Mol. Sci. 2023, 24, 11172 16 of 18
on the internal circumference/wall tension ratio of the segments by setting their internal
circumference, Lo, to 90% of what the vessels would have if they were exposed to a passive
tension, which is equivalent to that produced by a transmural pressure of 100 mm Hg.
The contractility of the segments was tested by an initial exposure to a high K+ solution
(K+-KHS, 120 mmol/L). After an equilibration period, aortic segments were precontracted
with phenylephrine at ∼50% K+-KHS contraction in order to perform a concentration–
response curve to acetylcholine (1 nmol/L–10 µmol/L). After washing, a concentration–
response curve to phenylephrine (1 nmol/L–30 µmol/L) was performed. Finally, a
concentration–response curve to diethylamine NONOate (DEA-NO, 1 nmol/L–10 µmol/L)
was performed in phenylephrine pre-contracted arteries.
4.10. Statistical Analysis
Quantitative data are presented as the mean ± the standard error of the mean (SEM).
Statistical analysis was performed with GraphPad Prism. The normal distribution of the
data was analyzed using the Kolmogorov–Smirnov test. The statistical significance of
differences was assessed as indicated in the figure legends. Differences were considered
significant at p-values < 0.05. Outliers identified using the Grubbs’ test in the GraphPad
outlier calculator were eliminated as indicated in the legends of figures.
Supplementary Materials: The supporting information can be downloaded at: https://www.mdpi.
com/article/10.3390/ijms241311172/s1.
Author Contributions: Conceptualization, A.D.M.-M., B.D. and V.A.; formal analysis, A.D.M.-M.,
Í.R.-P.d.L., P.G., M.G.-A. and M.d.l.F.-P.; funding acquisition, V.A.; investigation, A.D.M.-M., Í.R.-
P.d.L., P.G., C.E.-E., M.G.-A., M.d.l.F.-P., M.J.A.-M., V.F. and V.A.; methodology, Í.R.-P.d.L., P.G., C.E.-E.,
M.G.-A., M.d.l.F.-P., M.J.A.-M. and V.F.; project administration, B.D.; resources, J.R.G., R.B.-V. and
V.A.; supervision, V.A.; visualization, A.D.M.-M. and M.J.A.-M.; writing—original draft, A.D.M.-M.,
B.D. and V.A.; writing—review and editing, Í.R.-P.d.L., P.G., C.E.-E., M.G.-A., M.d.l.F.-P., V.F., J.R.G.
and R.B.-V. All authors have read and agreed to the published version of the manuscript.
Funding: This study was supported by grants SAF2016-79490-R and PID2019-108489RB-I00 from the
Spanish Ministerio de Ciencia e Innovación (MCIN)/Agencia Estatal de Investigación (AEI)/10.13039/
501100011033, with co-funding from the European Social Fund (“The ESF invests in your future”).
Microscopy was conducted at the Microscopy and Dynamic Imaging Unit, CNIC, ICTS-ReDib,
co-funded by MCIN/AEI/10.13039/501100011033. A.D.M.-M. was supported by the MCIN (predoc-
toral contract BES-2014-067791), C.E.-E. and V.F. by the Fundación “la Caixa” (predoctoral contracts
LCF/BQ/DR19/1170012 and LCF/BQ/DE14/10320024, respectively), Í.R.-P.d.L. by MCIN/AEI/
10.13039/501100011033 and the European Social Fund (“The ESF invests in your future”) (predoc-
toral contract PRE2020-092264), and M.G.-A. by MCIN (post-doctoral contract FJC 2021-047576-I).
The CNIC is supported by the MCIN, the Instituto de Salud Carlos III, and the Pro-CNIC Foun-
dation and is a Severo Ochoa Center of Excellence (grant number CEX2020-001041-S funded by
MCIN/AEI/10.13039/501100011033).
Institutional Review Board Statement: The animal study protocol was approved by the local ethics
committees and the Animal Protection Area of the Comunidad Autónoma de Madrid (protocol code
PROEX 71.4/20; date of approval: 8 April 2020).
Informed Consent Statement: Not applicable.
Data Availability Statement: Data supporting the reported results are contained within the article.
Acknowledgments: We thank Yixian Zheng for providing Lmnaflox/flox mice, David Filgueiras for
advice on ECG analysis, Yaazan Blanco for body weight studies, Antonio de Molina for support
with histology, Eva Santos and the CNIC Animal Facility for animal care, Marta García and Belén
Ricote for help with the ECG, the CNIC Microscopy Unit for support in image analysis, and Simon
Bartlett for English editing. Graphics in Figure 8A and in the graphical abstract were created with
BioRender.com (under the license granted to V.A.).
Int. J. Mol. Sci. 2023, 24, 11172 17 of 18
Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design
of the study; the collection, analysis, or interpretation of data; the writing of the manuscript; or the
decision to publish the results.
References
1. Gerace, L.; Burke, B. Functional organization of the nuclear envelope. Annu. Rev. Cell Biol. 1988, 4, 335–374. [CrossRef]
2. Stuurman, N.; Heins, S.; Aebi, U. Nuclear lamins: Their structure, assembly, and interactions. J. Struct. Biol. 1998, 122, 42–66.
[CrossRef] [PubMed]
3. Broers, J.L.; Ramaekers, F.C.; Bonne, G.; Yaou, R.B.; Hutchison, C.J. Nuclear lamins: Laminopathies and their role in premature
ageing. Physiol. Rev. 2006, 86, 967–1008. [CrossRef] [PubMed]
4. Andrés, V.; González, J.M. Role of A-type lamins in signaling, transcription, and chromatin organization. J. Cell Biol. 2009, 187,
945–957. [CrossRef] [PubMed]
5. Dechat, T.; Pfleghaar, K.; Sengupta, K.; Shimi, T.; Shumaker, D.K.; Solimando, L.; Goldman, R.D. Nuclear lamins: Major factors in
the structural organization and function of the nucleus and chromatin. Genes. Dev. 2008, 22, 832–853. [CrossRef]
6. Kalukula, Y.; Stephens, A.D.; Lammerding, J.; Gabriele, S. Mechanics and functional consequences of nuclear deformations. Nat.
Rev. Mol. Cell Biol. 2022, 23, 583–602. [CrossRef]
7. Swift, J.; Ivanovska, I.L.; Buxboim, A.; Harada, T.; Dingal, P.D.P.; Pinter, J.; Pajerowski, J.D.; Spinler, K.R.; Shin, J.W.; Tewari,
M.; et al. Nuclear Lamin-A scales with tissue stiffness and enhances matrix-directed differentiation. Science 2013, 341, 975–990.
[CrossRef]
8. Carmosino, M.; Torretta, S.; Procino, G.; Gerbino, A.; Forleo, C.; Favale, S.; Svelto, M. Role of nuclear Lamin A/C in cardiomyocyte
functions. Biol. Cell 2014, 106, 346–358. [CrossRef]
9. Benedicto, I.; Dorado, B.; Andrés, V. Molecular and cellular mechanisms driving cardiovascular disease in hutchinson-gilford
progeria syndrome: Lessons learned from animal models. Cells 2021, 10, 1157. [CrossRef]
10. Taylor, M.R.; Fain, P.R.; Sinagra, G.; Robinson, M.L.; Robertson, A.D.; Carniel, E.; Di Lenarda, A.; Bohlmeyer, T.J.; Ferguson, D.A.;
Brodsky, G.L.; et al. Natural history of dilated cardiomyopathy due to lamin A/C gene mutations. J. Am. Coll. Cardiol. 2003, 41,
771–780. [CrossRef]
11. Bonne, G.; Ben Yaou, R.; Beroud, C.; Boriani, G.; Brown, S.; de Visser, M.; Duboc, D.; Ellis, J.; Hausmanowa-Petrusewicz,
I.; Lattanzi, G.; et al. 108th ENMC International Workshop, 3rd Workshop of the MYO-CLUSTER project: EUROMEN, 7th
International Emery-Dreifuss Muscular Dystrophy (EDMD) Workshop, 13–15 September 2002, Naarden, The Netherlands.
Neuromuscul. Disorder. 2003, 13, 508–515. [CrossRef] [PubMed]
12. Van Berlo, J.H.; De Voogt, W.G.; Van Der Kooi, A.J.; Van Tintelen, J.P.; Bonne, G.; Yaou, R.B.; Duboc, D.; Rossenbacker, T.;
Heidbüchel, H.; De Visser, M.; et al. Meta-analysis of clinical characteristics of 299 carriers of LMNA gene mutations: Do lamin
A/C mutations portend a high risk of sudden death? J. Mol. Med. 2005, 83, 79–83. [CrossRef] [PubMed]
13. Van Rijsingen, I.A.; Arbustini, E.; Elliott, P.M.; Mogensen, J.; Hermans-van Ast, J.F.; van der Kooi, A.J.; van Tintelen, J.P.; van den
Berg, M.P.; Pilotto, A.; Pasotti, M.; et al. Risk factors for malignant ventricular arrhythmias in Lamin A/C mutation carriers: A
European cohort study. J. Am. Coll. Cardiol. 2012, 59, 493–500. [CrossRef] [PubMed]
14. Arbustini, E.; Pilotto, A.; Repetto, A.; Grasso, M.; Negri, A.; Diegoli, M.; Campana, C.; Scelsi, L.; Baldini, E.; Gavazzi, A.; et al.
Autosomal dominant dilated cardiomyopathy with atrioventricular block: A lamin A/C defect-related disease. J. Am. Coll.
Cardiol. 2002, 39, 981–990. [CrossRef]
15. Crasto, S.; My, I.; di Pasquale, E. The Broad Spectrum of LMNA Cardiac Diseases: From Molecular Mechanisms to Clinical
Phenotype. Front. Physiol. 2020, 11, 761. [CrossRef]
16. Hasselberg, N.E.; Haland, T.F.; Saberniak, J.; Brekke, P.H.; Berge, K.E.; Leren, T.P.; Edvardsen, T.; Haugaa, K.H. Lamin A/C
cardiomyopathy: Young onset, high penetrance, and frequent need for heart transplantation. Eur. Heart J. 2018, 39, 853–860.
[CrossRef] [PubMed]
17. Zhang, H.; Ren, L.; Wu, J.C. New Insights Into the Therapy for Lamin-Associated Dilated Cardiomyopathy. J. Am. Coll. Cardiol.
Basic. Transl. Sci. 2022, 7, 1246–1248. [CrossRef]
18. Zhang, H.; Kieckhaefer, J.E.; Cao, K. Mouse models of laminopathies. Aging Cell 2013, 12, 2–10. [CrossRef]
19. Sullivan, T. Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J. Cell Biol.
1999, 147, 913–920. [CrossRef]
20. Nikolova, V.; Leimena, C.; McMahon, A.C.; Tan, J.C.; Chandar, S.; Jogia, D.; Kesteven, S.H.; Michalicek, J.; Otway, R.; Verheyen, F.;
et al. Defects in nuclear structure and function promote dilated cardiomyopathy in lamin A/C-deficient mice. J. Clin. Investig.
2004, 113, 357–369. [CrossRef]
21. Frock, R.L.; Chen, S.C.; Da, D.F.; Frett, E.; Lau, C.; Brown, C.; Pak, D.N.; Wang, Y.; Muchir, A.; Worman, H.J.; et al. Cardiomyocyte-
specific expression of lamin A improves cardiac function in Lmna−/− mice. PLoS ONE 2012, 7, 1–9. [CrossRef]
22. Auguste, G.; Rouhi, L.; Matkovich, S.J.; Coarfa, C.; Robertson, M.J.; Czernuszewicz, G.; Gurha, P.; Marian, A.J. BET bromodomain
inhibition attenuates cardiac phenotype in myocyte-specific lamin A/C-deficient mice. J. Clin. Investig. 2020, 130, 4740–4758.
[CrossRef]
Int. J. Mol. Sci. 2023, 24, 11172 18 of 18
23. Chai, R.J.; Werner, H.; Li, P.Y.; Lee, Y.L.; Nyein, K.T.; Solovei, I.; Luu, T.D.A.; Sharma, B.; Navasankari, R.; Maric, M.; et al.
Disrupting the LINC complex by AAV mediated gene transduction prevents progression of Lamin induced cardiomyopathy. Nat.
Commun. 2021, 12, 1–16. [CrossRef]
24. Rouhi, L.; Auguste, G.; Zhou, Q.; Lombardi, R.; Olcum, M.; Pourebrahim, K.; Cheedipudi, S.M.; Asghar, S.; Hong, K.; Robertson,
M.J.; et al. Deletion of the Lmna gene in fibroblasts causes senescence-associated dilated cardiomyopathy by activating the
double-stranded DNA damage response and induction of senescence-associated secretory phenotype. J. Cardiovasc. Aging 2022,
2, 30. [CrossRef] [PubMed]
25. Kim, Y.; Zheng, Y. Generation and characterization of a conditional deletion allele for Lmna in mice. Biochem. Biophys. Res.
Commun. 2013, 440, 8–13. [CrossRef] [PubMed]
26. Lepore, J.J.; Cheng, L.; Min Lu, M.; Mericko, P.A.; Morrisey, E.E.; Parmacek, M.S. High-efficiency somatic mutagenesis in smooth
muscle cells and cardiac myocytes in SM22α-Cre transgenic mice. Genesis 2005, 41, 179–184. [CrossRef]
27. Hanna, A.; Humeres, C.; Frangogiannis, N.G. The role of Smad signaling cascades in cardiac fibrosis. Cell Signal. 2021, 77, 109826.
[CrossRef] [PubMed]
28. Arimura, T.; Helbling-Leclerc, A.; Massart, C.; Varnous, S.; Niel, F.; Lacene, E.; Fromes, Y.; Toussaint, M.; Mura, A.M.; Keller, D.I.;
et al. Mouse model carrying H222P-Lmna mutation develops muscular dystrophy and dilated cardiomyopathy similar to human
striated muscle laminopathies. Hum. Mol. Genet. 2005, 14, 155–169. [CrossRef]
29. Roura, S.; Bayes-Genis, A. Vascular dysfunction in idiopathic dilated cardiomyopathy. Nat. Rev. 2009, 6, 590–598. [CrossRef]
[PubMed]
30. Mathier, M.A.; Rose, G.A.; Fifer, M.A.; Miyamoto, M.I.; Dinsmore, R.E.; Castaño, H.H.; Dec, G.; Palacios, I.F.; Semigran, M.J.
Coronary Endothelial Dysfunction in Patients With Acute-Onset Idiopathic Dilated Cardiomyopathy. J. Am. Coll. Cardiol. 1998,
32, 216–224. [CrossRef]
31. Sayed, N.; Liu, C.; Ameen, M.; Himmati, F.; Zhang, J.Z.; Khanamiri, S.; Moonen, J.-R.; Wnorowski, A.; Cheng, L.; Rhee, J.-W.;
et al. Clinical trial in a dish using iPSCs shows lovastatin improves endothelial dysfunction and cellular cross-talk in LMNA
cardiomyopathy. Sci. Transl. Med. 2020, 12, eaax9276. [CrossRef] [PubMed]
32. Sorokin, V.; Vickneson, K.; Kofidis, T.; Woo, C.C.; Lin, X.Y.; Foo, R.; Shanahan, C.M. Role of Vascular Smooth Muscle Cell Plasticity
and Interactions in Vessel Wall Inflammation. Front. Immunol. 2020, 11, 599415. [CrossRef] [PubMed]
33. Del Campo, L.; Ferrer, M. Wire Myography to Study Vascular Tone and Vascular Structure of Isolated Mouse Arteries. Methods
Mol. Biol. 2015, 1339, 255–276. [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.