Table S1. sgRNA sequences identified in the screenings 6-TG [20mM] 1st screening (ESCas9 clone #1) Clone Number Gene(s) Identified sgRNA sequence Clone 1 PDE2A GCAGTTGACCATGGGACGTC Clone 2 HPRT GTAGAATGATCAGTCAACGG Clone 3 HPRT GTCATGGACTGATTATGGAC Clone 4 HPRT GTAGAATGATCAGTCAACGG Clone 5 HPRT GTAGAATGATCAGTCAACGG 2nd screening (ESCas9 clone #2) Clone 1 HPRT GTCATGGACTGATTATGGAC Clone 2 HPRT GATTCCTCATGGACTGATTA Clone 3 HPRT GTAGAATGATCAGTCAACGG Clone 4 HPRT GATTCCTCATGGACTGATTA Clone 5 HPRT GATTCCTCATGGACTGATTA Clone 6 HPRT GATTCCTCATGGACTGATTA ATRi [900 nM] 1st screening (ESCas9 clone #1) Clone 1 TMEM123 GTAGTTTTTGGCAGTACGGA Clone 2 - - Clone 3 CDC25a GCCTCAGAATCGACCGATTC Clone 4 CDC25a GCCTCAGAATCGACCGATTC Clone 5 CDC25a GCCTCAGAATCGACCGATTC Clone 6 CDC25a GCCTCAGAATCGACCGATTC Clone 7 CDC25a GCCTCAGAATCGACCGATTC 2nd screening (ESCas9 clone #2) Clone 1 CEACAM11, CNOT8 GCATTTTCTTCAACCCTAGA, GATGTCATAAGCAGCTCTGC Clone 2 CDC25a GCCTCAGAATCGACCGATTC Clone 3 CDC25a GCCTCAGAATCGACCGATTC Clone 4 PCDHB2, HOXB5 GGTCTTGAGCACGTTCTATT, GTGGCTGTCGCCGTTAGTGC Clone 5 CNOT8 GCAGAGCTGCTTATGACATC Clone 6 CDC25a GCCTCAGAATCGACCGATTC Clone 7 CDC25a GCCTCAGAATCGACCGATTC Clone 8 CDC25a GCCTCAGAATCGACCGATTC Clone 9 CDC25a GCCTCAGAATCGACCGATTC Clone 10 CNOT8 GCAGAGCTGCTTATGACATC Clone 11 CLCA1, IL20 GGTTTTGGCCTCGTATATTC, TTCCTTTTGTATTGCCTGT Clone 12 DGCR8, GACTACAGTTCGGGTCTATG Clone 13 OLFR877 GTATGGGATGGGAGTTTTTG Clone 14 CNOT8 GCAGAGCTGCTTATGACATC Clone 15 CNOT8 GCAGAGCTGCTTATGACATC Clone 16 CNOT8 GCAGAGCTGCTTATGACATC Supplementary Experimental Procedures ! Cell culture ES cells were grown on a feeder layer of inactivated mouse embryonic fibroblasts (MEF) with DMEM (high glucose) supplemented with 15% knockout serum replacement (Invitrogen), LIF (1000 U/ml), 0.1 mM non- essential aminoacids, 1% glutamax and 55 mM b-mercaptoethanol. MEFs were obtained from 13.5 embryos by standard methods. MEFs and NIH-3T3 cells were cultured in DMEM (Invitrogen), 15%FBS and 0.1 mM non-essential amino acids in low-oxygen conditions. 293T, Hela, U2OS, A549, A4573 and TC71 cells (ATCC) were grown in DMEM, 10% FBS and 0.1 mM non- essential amino acids. HAP1 cells (kind gift of T Brummelkamp) were grown in IMDM (Invitrogen) and 15%FBS. Plasmids The Cas9 expression vector was acquired from Addgene (42230) and used to amplify the coding sequences of Cas9 by PCR. The PCR product was digested with EcoRI and subcloned into an EcoRI-linearized pBS31 plasmid to generate pBS31-Cas9. The lentiviral plasmid pKLV-U6gRNA-PGKpuro2ABFP (Addgene, 50946) was used to express sgRNAs in cells. The sequences of the sgRNAs used were designed and cloned as described by using the MIT CRISPR design tool (http://www.genome-engineering.org/crispr/). Only sgRNAs with the higher scores and lower probabilities of generating exonic off-target effects were selected. The genomewide mouse lentiviral CRISPR sgRNA library (Koike-Yusa et al., 2014) was acquired from Addgene (50947) and amplified following supplier’s recommendations. pCMV-HA-CDC25A and pLenti-H2B-EGFP were kind gifts from Jiri Lukas and Marcos Malumbres, respectively. All generated constructs were sequenced to rule out the presence of mutations. Lentiviral production Individual lentiviral vectors (pKLV-U6gRNA-PGKpuro2ABFP) or the genomewide mouse lentiviral CRISPR sgRNA library (Koike-Yusa et al., 2014) (Addgene 50947) were co-transfected with 3rd generation packaging vectors in 293T cells using Lipofectamine 2000 (Invitrogen) in order to generate viral supernatants as described (Ruiz et al., 2011). The lentiviral vector used contain a PGKpuro2ABFP cassette and thus, the library was titrated by using a serial dilution of the viral supernatant and evaluating the percentage of BFP-expressing cells 72 hours after infection. ! Western blot Cell pellets were lysed in 50mM Tris, 150mM NaCl, 1% TritonX-100 or in 50mM Tris pH 7.9/8M Urea/1%Chaps and incubated with shaking at 4˚C for at least 30 min. 25 µg of supernatants were run and transferred for detection by using the corresponding antibodies. Tubulin was used as control loading (see the Table below for further details about Antibodies). High-throughput microscopy High Throughput Microscopy (HTM) analysis was performed as previously described (Toledo et al., 2008). Briefly, a total of 8,000-20,000 cells per well, depending on the cell type or experiment, were seeded on μCLEAR bottom 96-well plates (Greiner Bio-One). One day after seeding, cells were untreated or treated with ATRi and/or WEE1i at the indicated concentrations and incubation times. γH2AX, 53BP1 and H3S10P immunofluorescences were performed using standard procedures. To measure ssDNA, cells were cultured in 10 μM BrdU for 36 h before adding ATRi for 4h. Cells were fixed with methanol at -20ºC, blocked with PBS containing 5% of BSA and then incubated overnight at 4ºC with an anti-BrdU antibody and a secondary antibody AlexaFluor-488 (1:250, Life Technologies). Images from each well were automatically acquired by an Opera High-Content Screening System (Perkin Elmer) at non-saturating settings. Images were segmented using the DAPI staining to generate masks matching cell nuclei from which the mean signals or number of foci were calculated. Data were represented with the Prism software (GraphPad Software). For Edu incorporation analyses, EdU was added to the media at a final concentration of 20μM during the last 45 minutes of incubation with the drug. EdU incorporation into DNA was detected using the Click-iT™ EdU Alexa Fluor® Imaging kit (Invitrogen/Molecular Probes). Flow cytometry To analyse cell cycle profiles by flow citometry, ES cells were incubated with ATRi for the indicated time and 20µM EdU was added during the last 45 minutes of incubation. Tripsinized cells were fixed with 4% paraformaldehyde for 10 minutes and EdU was detected by the Click-iT™ EdU Alexa Fluor® Imaging kit (Invitrogen/Molecular Probes). To analyse the percentage of H3S10P or γH2AX-positive cells, ES cells were incubated with ATRi, trypsinized and fixed in suspension by the addition of cold 70% ethanol and maintained at -20ºC at least for 24h. Cells were suspended in 0.25% Triton X- 100 in PBS, and incubated on ice for 15 min. After centrifugation, the cell pellets were suspended in PBS containing 1% BSA and antibodies recognizing H3S10P and mouse γH2AX. Secondary antibodies conjugated with Alexa-647 or Alexa-488 (Life Technologies) were used at a dilution of 1:250. DNA content was visualized with either propidium iodide (PI) or Cell Cycle blue-405. DNA fiber analyses Exponentially growing cells were pulse-labeled with 50 µM CldU (20 min) followed by 250 µM IdU (20 min). Labeled cells were collected and DNA fibers were spread in buffer containing 0.5% SDS, 200 mM Tris pH 7.4 and 50 mM EDTA. For immunodetection of labeled tracks, fibers were incubated with primary antibodies (for CldU, rat anti-BrdU; for IdU, mouse anti-BrdU) for 1 hour at room temperature and developed with the corresponding secondary antibodies for 30 minutes at room temperature. Mouse anti-ssDNA antibody was used to assess fiber integrity. Slides were examined with a Leica DM6000 B microscope, as described previously (Jacome et al., 2015). The conversion factor used was 1 µm=2.59 kb. In each assay, >300 tracks were measured to estimate fork rate and >50 fibers containing two or more origins were analyzed to estimate inter-origin distance. ! RNA isolation and real-time PCR Total RNA was isolated using the Absolutely RNA Microprep Kit (Stratagene) and cDNA was synthesized using the SuperScript III Reverse Transcriptase kit for RT–PCR (Invitrogen). Real-time PCR was performed using the SYBR- Select Master Mix (Applied Biosystems) in the QuantStudio 6K (Thermo Scientific). GAPDH expression level was used to normalize values of gene expression. Data are shown as fold change relative to the sample control and at least two independent experiments in triplicate were performed. See the Table below for further details about the sequences of the sgRNA primers used in this work. Cell viability assays Cells were seeded at 10,000 cells per well in a 96-well tissue culture plate and treated with the indicated concentrations of ATRi or left untreated. 24-36 hours after the treatment, cell viability was measured using either a XTT colorimetric assay (Roche) or a luminescent system (CellTiter-Glo, Promega), according to the manufacturer’s protocols. Viability is plotted as percentage of viability compared to untreated control. Knockdown experiments Exponentially growing Hela, U2OS, A549, A4573 and TC71 cells (ATCC) were tripsinized and transfected in suspension with 75nM of human siRNAs targeting CDC25A or CDC25B (SMART pools, Dharmacon) by using Lipofectamine RNAiMAX reagent (Thermo Fisher Scientific). For each independent experiment, the efficiency of the knockdown on transfected cells was evaluated by WB. Live cell imaging To evaluate mitosis entry and duration on ES cells, exponentially growing ESCas9 cells were infected with lentiviruses encoding the histone H2B-eGFP and seeded on 8 wells µ-Slide (Ibidi, 80826) pre-treated with gelatin 0.1%. The day after, cells were untreated or treated with 900nM ATRi and imaged every 15 minutes for a total of 15 hours in a Leica DMI 6000 B system. Mitotic events were easily observed by chromatin condensation. At least 40 cells were followed for the duration of the recording in order to evaluate the time spent in mitosis and interphase for each individual cell. !!!!!!!! Table of oligos used in this work: ! Primer name Sequence 5’-3’ Cas9-qPCR-F CCGAAGAGGTCGTGAAGAAG Cas9-qPCR-F GCCTTATCCAGTTCGCTCAG pKLV-U6gRNA-EGFP- sgRNA1-F CACCGGGCACGGGCAGCTTGCCGGGT pKLV-U6gRNA-EGFP- sgRNA1-R TAAAACCCGGCAAGCTGCCCGTGCCC pKLV-U6gRNA-m-p53- sgRNA1-F CACCGTCTACAGATGACTGCCATGGGT pKLV-U6gRNA-m-p53- sgRNA1-R TAAAACCCATGGCAGTCATCTGTAGAC pKLV-U6gRNA-m-p53- sgRNA2-F CACCGCTCTCTACAGATGACTGCCAGT pKLV-U6gRNA-m-p53- sgRNA2-R TAAAACTGGCAGTCATCTGTAGAGAGC pKLV-U6gRNA-m-p53- sgRNA3-F CCACGAGTGAAGCCCTCCGAGTGTCGT pKLV-U6gRNA-m-p53- sgRNA3-R TAAAACGACACTCGGAGGGCTTCACTC pKLV-U6gRNA-m-cdc25a- sgRNA1-F CACCGCCTCAGAATCGACCGATTCGT pKLV-U6gRNA-m-cdc25a - sgRNA1-R TAAAACGAATCGGTCGATTCTGAGGC pKLV-U6gRNA-m-cdc25a - sgRNA2-F CACCGTGCAAGCGAAGAACAGGCGGGT pKLV-U6gRNA-m-cdc25a - sgRNA2-R TAAAACCCGCCTGTTCTTCGCTTGCAC pKLV-U6gRNA-m-cdc25a - sgRNA3-F CACCGACGCCTGCGCCGCAGCCCACGT pKLV-U6gRNA-m-cdc25a - sgRNA3-R TAAAACGTGGGCTGCGGCGCAGGCGTC pKLV-U6gRNA-m-cdc25a –sgRNA4-F CACCGTTCCCCGTGGGCTGCGGCGCGT pKLV-U6gRNA-m-cdc25a –sgRNA4-R TAAAACGCGCCGCAGCCCACGGGGAAC pKLV-U6gRNA-m-cdc25b- sgRNA1-F CACCGATGCCACCCAGCACGCGGGCGT pKLV-U6gRNA-m-cdc25b- sgRNA1-R TAAAACGCCCGCGTGCTGGGTGGCATC pKLV-U6gRNA-m-cdc25b- sgRNA2-F CACCGTCTCAGTCCTGCCCGCGTGCGT pKLV-U6gRNA-m-cdc25b- sgRNA2-R TAAAACGCACGCGGGCAGGACTGAGAC pKLV-U6gRNA-m-cdc25b- sgRNA3-F CACCGTCAGCGGCCGCGCCACCTCTGT pKLV-U6gRNA-m-cdc25b- sgRNA3-R TAAAACAGAGGTGGCGCGGCCGCTGAC pKLV-U6gRNA-m-cdc25b- sgRNA4-F CACCGCCAGCCTGTTCTGGAACGACGT pKLV-U6gRNA-m-cdc25b- sgRNA4-R TAAAACGTCGTTCCAGAACAGGCTGGC pKLV-U6gRNA-h-cdc25a- sgRNA1-F CACCGCCAAATAGCGCCTTCACGACGT pKLV-U6gRNA-h-cdc25a - TAAAACGTCGTGAAGGCGCTATTTGGC sgRNA1-R pKLV-U6gRNA-h-cdc25a - sgRNA2-F CACCGTTCACGACGGGCTGCGACGCGT pKLV-U6gRNA-h-cdc25a - sgRNA2-R TAAAACGCGTCGCAGCCCGTCGTGAAC pKLV-U6gRNA-h-cdc25a - sgRNA3-F CACCGCGCGTCGCAGCCCGTCGTGAGT pKLV-U6gRNA-h-cdc25a - sgRNA3-R TAAAACTCACGACGGGCTGCGACGCGC pKLV-U6gRNA-h-cdc25a – sgRNA4-F CACCGTATTTGGCGCTTCAGCCGCCGT pKLV-U6gRNA-h-cdc25a – sgRNA4-R TAAAACGGCGGCTGAAGCGCCAAATAC mGAPDH-F TTCACCACCATGGAGAAGGC mGAPDH-R CCCTTTTGGCTCCACCCT !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Table of antibodies used in this work: ! Antibody Use Dilution Reference cdc25a Western blot 1:500 Santa Cruz sc7389 cdc25a Western blot 1:1000 Cell Signaling, #3652 cdc25b Western blot 1:1000 Santa Cruz, sc326 CDK1! Western blot 1:500 (Santa Cruz, sc54)! p-CDK1! Western blot 1:1000 Santa Cruz, sc7989! RPA! Western blot 1:1000 Cell Signaling, #2208! p-RPA! Western blot 1:750 Bethyl, A300-245A! H3S10P! Western blot 1:1000 Millipore, 06-570! CHK1! Western blot 1:500 Novocastra! p-CHK1! Western blot 1:500 Cell Signaling, #2348S! p-CDK substrates! Western blot 1:1000 Cell Signaling, #9477! γH2AX! Western blot 1:500 Millipore 05-636! p53! Western blot 1:1000 Cell Signaling, #2524! Tubulin! Western blot 1:50000 Sigma, #T9026! H3S10P! Immunofluorescence 1:500 Millipore, 06-570! γH2AX! Immunofluorescence 1:1000 Millipore 05-636! BrdU Immunofluorescence 1:100 GE Healthcare Life Sciences 53BP1 Immunofluorescence 1:2000 (Novus 100-304A2) H3S10P! FACS 1:50 Millipore, 06-570! γH2AX! FACS 1:500 Millipore 05-636! CldU Fiber analysis 1:100 Abcam ab6326 IdU Fiber analysis 1:150 BD Biosciences 347580 ssDNA Fiber analysis 1:200 Millipore MAB3034 !!!!!!!!!!!!!!!!!!!!!!!!! Supplementary References • Barretina, J., Caponigro, G., Stransky, N., Venkatesan, K., Margolin, A.A., Kim, S., Wilson, C.J., Lehar, J., Kryukov, G.V., Sonkin, D., et al. (2012). The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 483, 603-607. • Blomen, V.A., Majek, P., Jae, L.T., Bigenzahn, J.W., Nieuwenhuis, J., Staring, J., Sacco, R., van Diemen, F.R., Olk, N., Stukalov, A., et al. (2015). Gene essentiality and synthetic lethality in haploid human cells. Science. • Carette, J.E., Guimaraes, C.P., Wuethrich, I., Blomen, V.A., Varadarajan, M., Sun, C., Bell, G., Yuan, B., Muellner, M.K., Nijman, S.M., et al. (2011). Global gene disruption in human cells to assign genes to phenotypes by deep sequencing. Nat Biotechnol 29, 542-546. • Jacome, A., Gutierrez-Martinez, P., Schiavoni, F., Tenaglia, E., Martinez, P., Rodriguez-Acebes, S., Lecona, E., Murga, M., Mendez, J., Blasco, M.A., et al. (2015). NSMCE2 suppresses cancer and aging in mice independently of its SUMO ligase activity. EMBO J. • Koike-Yusa, H., Li, Y., Tan, E.P., Velasco-Herrera Mdel, C., and Yusa, K. (2014). Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol 32, 267-273. • Ruiz, S., Panopoulos, A.D., Herrerias, A., Bissig, K.D., Lutz, M., Berggren, W.T., Verma, I.M., and Izpisua Belmonte, J.C. (2011). A high proliferation rate is required for cell reprogramming and maintenance of human embryonic stem cell identity. Curr Biol 21, 45-52. • Toledo, L.I., Murga, M., Gutierrez-Martinez, P., Soria, R., and Fernandez- Capetillo, O. (2008). ATR signaling can drive cells into senescence in the absence of DNA breaks. Genes Dev 22, 297-302.