RESEARCH ARTICLE Measles virus genotype D4 strains with non- standard length M-F non-coding region circulated during the major outbreaks of 2011-2012 in Spain Horacio Gil1,2☯, Aurora Ferna´ndez-Garcı´a1,3☯*, Marı´a Mar Mosquera1,3, Judith M. Hu¨bschen4, Ana M. Castellanos1,3, Fernando de Ory1,3, Josefa Masa-Calles3,5, Juan E. Echevarrı´a1,3 1 National Reference Laboratory for Measles and Rubella, Centro Nacional de Microbiologı´a, Instituto de Salud Carlos III, Majadahonda, Madrid, Spain, 2 European Program for Public Health Microbiology Training (EUPHEM), European Centre for Disease Prevention and Control (ECDC), Solna, Sweden, 3 CIBER de Epidemiologı´a y Salud Pu´blica (CIBERESP), Madrid, Spain, 4 WHO European Regional Reference Laboratory for Measles and Rubella, Department of Infection and Immunity, Luxembourg Institute of Health, Esch-sur-Alzette, Luxembourg, 5 Centro Nacional de Epidemiologı´a, Instituto de Salud Carlos III, Madrid, Spain ☯ These authors contributed equally to this work. * aurorafg@externos.isciii.es Abstract In recent decades, vaccination has substantially reduced the number of measles cases to levels close to the elimination stage. However, major measles outbreaks occurred in Europe during 2010–2012, after the introduction of the D4-Enfield lineage. We have performed a molecular characterization of 75 measles virus genotype D4 strains from patients infected in Spain between 2004 and 2012 by sequencing the N-450 region and the M-F non-coding region (M-F NCR) in order to identify genetic features of these viruses. The analysis of the N-450 region confirmed that all samples obtained since 2008 belonged to variants or sets of identical sequences of the D4-Enfield lineage, including a new one named MVs/Madrid. ESP/46.10/. Analysis of the M-F NCR showed insertions and deletions associated with pre- viously described, uncommon non-standard genome length measles viruses. This genetic feature was identified in the D4-Enfield lineage viruses, but not in the other D4 viruses that were circulating in Spain before 2008, suggesting that these non-standard length M-F NCR sequences are characteristic of the D4-Enfield lineage. The results of the phylogenetic anal- ysis of Spanish M-F NCRs suggest higher resolution in discriminating strains than did the N- 450 analysis. In addition, the results of the analysis of the M-F NCR on the MVs/Madrid. ESP/46.10/ sub-lineage seem to support the potential utility of this region as a tool for epide- miological surveillance complementary to the N-450 region, as previously suggested. Fur- ther investigation on this question, as well as the surveillance of new potentially emerging strains with non-standard length M-F NCR are strongly recommended as part of future strat- egies for measles elimination. PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 1 / 12 a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 OPENACCESS Citation: Gil H, Ferna´ndez-Garcı´a A, Mosquera MM, Hu¨bschen JM, Castellanos AM, de Ory F, et al. (2018) Measles virus genotype D4 strains with non-standard length M-F non-coding region circulated during the major outbreaks of 2011- 2012 in Spain. PLoS ONE 13(7): e0199975. https:// doi.org/10.1371/journal.pone.0199975 Editor: Naomi Forrester, Keele University Faculty of Natural Sciences, UNITED KINGDOM Received: August 10, 2017 Accepted: June 18, 2018 Published: July 16, 2018 Copyright: © 2018 Gil et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: The sequences obtained in this study have been deposited in GenBank under the accession numbers KX518607- KX518619 and KX499400 for N-450, and KX525239-KX525321 for M-F NCR. Funding: This work was supported by the Fondo de Investigacio´n Sanitaria (FIS PI12/02006) y el Instituto de Salud Carlos III (PI15CIII/00023). AFG was funded by CIBER de Epidemiologı´a y Salud Pu´blica (ESPG13). The funders had no role in study Introduction Measles is a highly contagious infectious disease caused by the measles virus (MeV), which continues to be a major cause of infant mortality throughout the world and of continu- ing outbreaks in developed countries, despite the existence of an effective live-attenuated vaccine. In the WHO European Region, vaccination substantially reduced the number of measles cases from the 1990s to 2009. However, serious outbreaks of measles caused by genotype D4 MeV unexpectedly occurred across Europe between 2010 and 2012 after the introduction of the D4-Enfield variant or “named strain” in 2008 [1,2]. This variant was named after a strain detected in the UK in 2007 (MVs/Enfield.GBR/14.07/), which spread through Europe, generat- ing other successful “named strains” such as MVs/Hamburg.DEU/03.09/ and MVs/Manches- ter.GBR/10.09/, amongst others [1,2]. Similarly in Spain, large outbreaks mainly caused by genotype D4 occurred in 2011 and 2012, affecting 4,731 individuals, after several years of low incidence of the disease [3, 4]. MeV is a negative-sense non-segmented RNA virus of the genus Morbillivirus from the family Paramyxoviridae. The MeV genome has a standard size of 15,894 nucleotides (nt), thus obeying the rule of six, that characterizes the morbilliviruses. According to this rule, the total number of nucleotides comprising the MeV genome must be divisible by six for the virus to be viable. The MeV genome contains six transcription units that encode eight proteins (N, P/V/ C, M, F, H and L), separated by intergenic regions of 3 nt [5]. Each transcription unit contains a coding region preceded and followed by untranslated regions (UTRs) including the gene start signal and the gene end signal, respectively. The M-F non-coding region (M-F NCR) of the MeV genome comprises a 426-nt 3’ UTR of the matrix protein gene (M 3’UTR), an inter- genic region of 3 nt, and a 583-nt 5’ UTR of the fusion protein gene (F 5’UTR). This is the lon- gest non-coding region of the MeV (1012 nt), and it is rich in G-C- with homopolymeric sequences [5, 6]. The functionality of the M-F NCR of the morbilliviruses is not well under- stood, but it has been suggested that secondary structures are involved in regulating translation or mRNA location [7, 8]. Although the M-F NCR of MeV is not essential for virus replication, it has been associated with cytopathogenicity and the regulation of virus replication by modu- lating M and F protein expression [9]. A long M 3’UTR promotes M protein translation induc- ing efficient replication, and a long F 5’UTR discourages F protein translation, reducing the cytopathogenicity of the virus. The M-F NCR region is one of the most variable regions of the MeV genome [6, 10] and has recently been proposed as a new target for MeV molecular char- acterization [11]. Non-standard length M-F NCR sequences, with a 7-nt insertion in the M 3’ UTR and a deletion of 1 nt in the F 5’UTR, have been identified in D4 genotype MeV strains [12]. These atypical strains were found in cases imported from Europe and India to the USA between 2007 and 2010. A deviation from standard genome organization has recently been noted in 11 MeV genomes obtained from the GenBank database [13], ten of which belong to clade D. Nine of these genomes presented one indel (an insertion or a deletion) in a 28 nt-long homopolymeric region in the F 5’ UTR, and three of them contained the previously described non-standard length M-F NCRs [12]. To investigate the circulation of MeV strains with non-standard length M-F NCR in Spain and to extend our knowledge of the specific genetic features in the M-F NCR in MeV D4 geno- type strains, samples from patients infected before and during the major outbreaks of 2011 and 2012 were investigated. Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 2 / 12 design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. Materials and methods Ethics statement The samples used in this work were obtained in the context of the National Measles and Rubella Elimination Plan and used in accordance with the requirements of Spanish biomedical research law (Ley 14/2007 de Investigacio´n Biome´dica). The protocol was approved by the Comite´ de E´tica de la Investigacio´n y de Bienestar Animal of the Instituto de Salud Carlos III (approval no. CEI PI 35–2015). Clinical specimens and epidemiological data A total of 75 clinical samples identified as genotype D4 collected between 2004 and 2012 [2004 (n = 2), 2005 (n = 1), 2007 (n = 1), 2008 (n = 3), 2010 (n = 1), 2011 (n = 29) and 2012 (n = 38)], belonging to the collection of the National Reference Laboratory for Measles and Rubella at the Centro Nacional de Microbiologı´a of the Instituto de Salud Carlos III (CNM-ISCIII, Spain), were included in the study (Table 1). Epidemiological data related to cases and out- breaks of measles were obtained from the National Network of Epidemiological Surveillance (RENAVE) for years 2008 to 2012. Amplification and sequencing of targets The highly variable 450-nt fragment coding for the carboxyl terminus of the nucleocapsid protein (N-450), which has been defined by the WHO for genotyping, was amplified as previ- ously described [14]. The sequences obtained were compared to the MeaNS database [15] to identify any specific MeV variant, recently defined as “named strains” according to their geo- graphic and temporal dissemination [16]. Each set of identical sequences that was not linked to any “named strain” described in MeaNS were named with the earliest sequence name. The M-F NCR region was amplified and sequenced. Four primers were designed, based upon the consensus sequence obtained from all complete MeV genomes in GenBank: MV_F1 (5’-CAA GATAGTAAGAATCCAGGCAG) and MV_F2 (5’ -CGTGATCATAAATGATGACCAAGGAC) as forward primers and MV_R1 (5’- ACTTTGTAGCTTGCACTTCC) and MV_R2 (5’-TTGT AGCTTGCACTTCCTAYYCC) as reverse primers. RT-PCR was performed using the OneStep RT-PCR kit (QIAGEN) according to the manufacturer’s instructions, with 0.6 μM of each primer and 400 μM of dNTPs, and including buffer Q as adjuvant. The amplifying conditions were 50˚C for 30 min, followed by 95˚C for 15 min and 40 cycles of 94˚C for 30 s, 55˚C for 60 s and 72˚C for 90 s, finishing at 72˚C for 10 min. The nested PCR was performed using the BioTAQ DNA polymerase (Bioline, London, UK) according to the manufacturer’s recommen- dations, with 0.4 μM of each primer, 200 μM of dNTPs and 2 mM of Cl2Mg, using 1M of beta- ine (Sigma-Aldrich, St. Louis, MO, USA) as adjuvant. The amplification conditions included an initial denaturation step at 94˚C for 2 min, followed by 30 cycles of 94˚C for 30 s, 58˚C for 30 s and 72˚C for 80 s, and a final extension performed at 72˚C for 7 min. Amplicons were purified using Illustra ExoProStar 1-Step (GE Health Care Life Science, Freiburg, Germany) according to the manufacturer’s instructions. Amplicons were sequenced with the ABI Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Branchburg, NJ, USA) using the MV_F2 and MV_R2 primers described above, and the additional primers MV_F4 (5’-A AACTTAGGGCCAAGGAAYAYAC) and MV_R4 (5’-TTGCCGTGGTSKTGTG), which were designed to cover the central part of the M-F NCR sequence, and MV_Fsec_D (5’-GACC CAGACCACCAACC), which was designed to confirm the homopolymeric sequence in the M 3’ UTR. Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 3 / 12 Table 1. Molecular characterization of the samples analyzed in the study. ID Sample N450 Named Strain/ Group of identical N450 sequences a Group of identical M-F NCR sequences Indel typeb Origin YEAR 1 MVs/Baleares.ESP/36.04/ MVs/Baleares.ESP/36.04/ MVs/Baleares.ESP/36.04/ Type 8 ThroatSwab 2004 2 MVs/Baleares.ESP/38.04/ MVs/Baleares.ESP/36.04/ MVs/Baleares.ESP/36.04/ Type 8 ThroatSwab 2004 3 MVs/Barcelona.ESP/31.05/ MVs/Barcelona.ESP/31.05/ MVs/Barcelona.ESP/31.05/ Type 8 Urine 2005 4 MVs/Soria.ESP/12.07/ MVs/Soria.ESP/12.07/ MVs/Soria.ESP/12.07/ Type 8 ThroatSwab 2007 5 MVs/Cadiz.ESP/13.08/2 MVs/Enfield.GBR/14.07/ MVs/Cadiz.ESP/13.08/2 Type 1 Urine 2008 6 MVs/Cadiz.ESP/14.08/2 MVs/Cadiz.ESP/11.08/ MVs/Cadiz.ESP/13.08/2 Type 1 Urine 2008 7 MVs/Malaga.ESP/36.08/ MVs/Malaga.ESP/36.08/ MVs/Malaga.ESP/36.08/ Type 1 Urine 2008 8 MVs/Madrid.ESP/46.10/ MVs/Madrid.ESP/46.10/ MVs/Madrid.ESP/46.10/ Type 2 Urine 2010 9 MVs/Sevilla.ESP/1.11/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2011 10 MVs/Madrid.ESP/11.11/5 MVs/Manchester.GBR/10.09/ MVs/Madrid.ESP/11.11/5 Type 2 ThroatSwab 2011 11 MVs/Alicante.ESP/12.11/ MVs/Manchester.GBR/10.09/ MVs/Alicante.ESP/12.11/ Type 2 ThroatSwab 2011 12 MVs/Madrid.ESP/13.11/4 MVs/Manchester.GBR/10.09/ MVs/Madrid.ESP/11.11/5 Type 2 ThroatSwab 2011 13 MVs/Madrid.ESP/14.11/ MVs/Manchester.GBR/10.09/ MVs/Madrid.ESP/46.10/ Type 2 ThroatSwab 2011 14 MVs/Valencia.ESP/16.11/ MVs/Madrid.ESP/46.10/ MVs/Valencia.ESP/16.11/ Type 2 Urine 2011 15 MVs/Madrid.ESP/20.11/2 MVs/Madrid.ESP/17.11/ MVs/Madrid.ESP/20.11/2 Type 1 ThroatSwab 2011 16 MVs/Madrid.ESP/21.11/2 MVs/Manchester.GBR/10.09/ MVs/Madrid.ESP/21.11/2 Type 5 ThroatSwab 2011 17 MVs/Madrid.ESP/21.11/5 MVs/Enfield.GBR/30.07/ MVs/Madrid.ESP/21.11/5 Type 1 ThroatSwab 2011 18 MVs/Madrid.ESP/21.11/10 MVs/Manchester.GBR/10.09/ MVs/Madrid.ESP/21.11/10 Type 5 ThroatSwab 2011 19 MVs/Alicante.ESP/22.11/ MVs/Manchester.GBR/10.09/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2011 20 MVs/Madrid.ESP/23.11/4 MVs/Manchester.GBR/10.09/ MVs/Madrid.ESP/46.10/ Type 2 ThroatSwab 2011 21 MVs/Madrid.ESP/24.11/ MVs/Manchester.GBR/10.09/ MVs/Madrid.ESP/24.11/ Type 2 ThroatSwab 2011 22 MVs/Madrid.ESP/24.11/5 MVs/Manchester.GBR/10.09/ MVs/Madrid.ESP/24.11/5 Type 4 ThroatSwab 2011 23 MVs/Melilla.ESP/25.11/2 MVs/Enfield.GBR/14.07/ MVs/Melilla.ESP/25.11/2 Type 1 Urine 2011 24 MVi/Sevilla.ESP/25.11/ MVs/Madrid.ESP/46.10/ MVi/Sevilla.ESP/25.11/ Type 2 ThroatSwab 2011 25 MVs/SantaCruzTenerife.ESP/ 27.11/ MVs/Madrid.ESP/46.10/ MVs/SantaCruzTenerife.ESP/27.11/ Type 2 ThroatSwab 2011 26 MVs/Vizcaya.ESP/29.11/ MVs/Manchester.GBR/10.09/ MVs/Vizcaya.ESP/29.11/ Type 4 ThroatSwab 2011 27 MVs/Valencia.ESP/31.11/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2011 28 MVs/Valencia.ESP/31.11/2 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2011 29 MVs/Madrid.ESP/34.11/ MVs/Enfield.GBR/30.07/ MVs/Madrid.ESP/34.11/ Type 1 ThroatSwab 2011 30 MVs/Madrid.ESP/34.11/2 MVs/Enfield.GBR/30.07/ MVs/Madrid.ESP/21.11/5 Type 1 ThroatSwab 2011 31 MVs/Madrid.ESP/37.11/ MVs/Enfield.GBR/30.07/ MVs/Madrid.ESP/37.11/ Type 1 ThroatSwab 2011 32 MVs/Valencia.ESP/41.11/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2011 33 MVs/Madrid.ESP/45.11/8 MVs/Enfield.GBR/30.07/ MVs/Madrid.ESP/21.11/5 Type 1 ThroatSwab 2011 34 MVs/Valencia.ESP/45.11/ MVs/Madrid.ESP/46.10/ MVs/Valencia.ESP/45.11/ Type 4 Urine 2011 35 MVs/Valencia.ESP/45.11/3 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2011 36 MVs/Valencia.ESP/47.11/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2011 37 MVs/Valencia.ESP/47.11/3 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2011 38 MVs/LasPalmas.ESP/2.12/ MVs/Enfield.GBR/30.07/ MVs/Madrid.ESP/21.11/5 Type 1 ThroatSwab 2012 39 MVs/Madrid.ESP/4.12/ MVs/Madrid.ESP/4.12/ MVs/Madrid.ESP/4.12/ Type 3 ThroatSwab 2012 40 MVs/Alicante.ESP/4.12/3 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2012 41 MVs/Alicante.ESP/06.12/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 42 MVs/Alicante.ESP/6.12/5 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2012 43 MVs/Baleares.ESP/06.12/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 44 MVs/Alicante.ESP/6.12/9 MVs/Alicante.ESP/5.12/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2012 45 MVs/Alicante.ESP/7.12/6 MVs/Alicante.ESP/5.12/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2012 46 MVs/Alicante.ESP/7.12/7 MVs/Alicante.ESP/5.12/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2012 (Continued) Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 4 / 12 Analysis of the M-F NCR To analyze the M-F NCR, the existing complete MeV genomes (n = 118) and MeV M-F NCR sequences (n = 53) were obtained from GenBank (accessed in January 2017). Eight MeV genomes and 19 MeV M-F NCRs belonged to the D4 genotype. All these deposited sequences and those obtained in this study were aligned using MAFTT v.7 [17] and edited using BioEdit v.7.2.5 [18] to extract the M-F NCRs for subsequent analysis. Each set of identical sequences was identified using DNAsp v5 software [19]. Phylogenetic analysis The sequences obtained in this study were aligned with MAFTT v.7, including genotype D4 and D8 reference sequences from GenBank. D8 genotype sequences were used as outgroup. Phylogenetic trees were built using the maximum likelihood method with MEGA v.6 [20]. The Table 1. (Continued) ID Sample N450 Named Strain/ Group of identical N450 sequences a Group of identical M-F NCR sequences Indel typeb Origin YEAR 47 MVs/Madrid.ESP/7.12/11 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 48 MVs/Madrid.ESP/8.12/4 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 49 MVs/Baleares.ESP/9.12 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 50 MVs/Baleares.ESP/10.12/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Urine 2012 51 MVs/Alicante.ESP/10.12/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 Placenta 2012 52 MVs/Baleares.ESP/11.12/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 53 MVs/Baleares.ESP/13.12/2 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 54 MVs/Navarra.ESP/12.12/ MVs/Marmande.FRA/43.11/2 MVs/Navarra.ESP/12.12/ Type 6 ThroatSwab 2012 55 MVs/Baleares.ESP/13.12/5 MVs/Baleares.ESP/13.12/5 MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 56 MVs/Baleares.ESP/14.12/4 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 57 MVs/Baleares.ESP/14.12/ MVs/Baleares.ESP/14.12/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 58 MVs/Baleares.ESP/14.12/2 MVs/Baleares.ESP/14.12/2 MVs/Baleares.ESP/14.12/2 Type 2 ThroatSwab 2012 59 MVs/Baleares.ESP/14.12/3 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 60 MVs/Baleares.ESP/14.12/5 MVs/Baleares.ESP/14.12/2 MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 61 MVs/Baleares.ESP/15.12/4 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 62 MVs/Navarra.ESP/15.12/2 MVs/Marmande.FRA/43.11/2 MVs/Navarra.ESP/15.12/2 Type 6 ThroatSwab 2012 63 MVs/Baleares.ESP/16.12/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 64 MVs/Baleares.ESP/17.12/ MVs/Baleares.ESP/14.12/2 MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 65 MVs/Baleares.ESP/17.12/2 MVs/Madrid.ESP/46.10/ MVs/Baleares.ESP/17.12/2 Type 2 ThroatSwab 2012 66 MVs/Baleares.ESP/17.12/3 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 67 MVs/Baleares.ESP/19.12/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 68 MVs/Baleares.ESP/20.12/2 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 69 MVs/Baleares.ESP/21.12/ MVs/Madrid.ESP/46.10/ MVs/Baleares.ESP/21.12/ Type 5 ThroatSwab 2012 70 MVs/Baleares.ESP/22.12/ MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 71 MVs/Baleares.ESP/22.12/4 MVs/Baleares.ESP/22.12/4 MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 72 MVs/Baleares.ESP/23.12/2 MVs/Madrid.ESP/46.10/ MVs/Sevilla.ESP/1.11/ Type 2 ThroatSwab 2012 73 MVs/Baleares.ESP/23.12/ MVs/Madrid.ESP/46.10/ MVs/Baleares.ESP/23.12/ Type 5 ThroatSwab 2012 74 MVs/Baleares.ESP/25.12/ MVs/Madrid.ESP/46.10/ MVs/Baleares.ESP/25.12/ Type 2 ThroatSwab 2012 75 MVs/Baleares.ESP/25.12/2 MVs/Madrid.ESP/46.10/ MVs/Baleares.ESP/25.12/2 Type 7 ThroatSwab 2012 aNamed strains available in MeaNS are shown in bold. bTypes according to the characteristics of the indel region. https://doi.org/10.1371/journal.pone.0199975.t001 Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 5 / 12 Kimura 2P for the N-450 target and Tamura-Nei with gamma distribution for the M-F NCR target were the most suitable evolutionary models identified by MEGA v.6 and so were chosen for use in the analysis. The reliability of the phylogenetic analysis at each branch node was esti- mated by the bootstrap method using 1000 replications. GenBank accession numbers The sequences obtained in this study have been deposited in GenBank with the accession numbers KX518607-KX518619 and KX499400 for N-450, and KX525239-KX525321 for M-F NCR. Results Analysis of the N-450 sequences identified 17 different sets of identical sequences, all of which belonged to the D4 genotype. Three of these had already been defined as named strains in the MeaNS database and belonged to the same genetic lineage, according to the topology of the phylogenetic tree (Fig 1, Panel A), named here as D4-Enfield lineage: MVs/Enfield.GBR/ Fig 1. Phylogenetic analysis of the N-450 and M-F NCR. Panel A: N-450 dendrogram. The Kimura 2P nucleotide substitution model was used to build the tree. The MeV genotype D8 and D4 references (black diamonds) and D4 named strains accepted in MeaNS (black squares) were included in the analysis. The tree was rooted with respect to the genotype D8 WHO reference sequence. The number (n) of sequences of each set of identical sequences or named strain is shown in brackets. Panel B: M-F NCR dendrogram. The TN93 nucleotide substitution model with gamma distribution was used to build the tree. Genotype D4 M-F NCR sequences from GenBank were included in the analysis. A genotype D8 M-F NCR sequence from GenBank was used to root the tree. The number (n) of identical sequences of each set of identical sequences or variant is shown. https://doi.org/10.1371/journal.pone.0199975.g001 Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 6 / 12 14.07/, MVs/Manchester.GBR/10.09/, and Marmande.FRA/43.11/2. The most frequent set of identical sequences (37 samples) was the MVs/Madrid.ESP/46.10/ (Table 2). This set of identi- cal sequences belonging to the D4-Enfield lineage was circulating in Spain from 2010 to 2012 and was accepted as a named strain in MeaNS database. The MVs/Madrid.ESP/46.10/ has two characteristic mutations on the N-450 sequence compared to the MVs/Enfield.GBR/14.07/ N- 450 sequence (C260T and, T441A), sharing one of them with the N-450 sequence of the MVs/ Manchester.GBR/10.09/ named strain (C260T). Five sets of identical N-450 sequences cluster to a phylogenetical clade with the MVs/Madrid.ESP/46.10/ named strain (Fig 1, Panel A) and presented the two characteristic mutations. The other set of identical sequences of years 2008 to 2012 identified in this study also clustered within the D4-Enfield lineage (Fig 1, Panel A). The four samples collected before 2008 clustered in the previously described D4-Bucharest lineage [1]. Analysis of the M-F NCR target identified 30 different sets of identical sequences (Fig 1, Panel B). Twelve of them were found in samples with the MVs/Madrid.ESP/46.10/ variant or associated sets of identical N-450 sequences (Table 2, Fig 1, Panel A). All cases except one belonged to epidemiologically linked outbreaks of MVs/Madrid.ESP/46.10/ sub-lineage [3, 4]. The associated sets of identical sequences arose in the context of the outbreaks. All of them dis- played either the MF NCR sequence MVs/Sevilla.ESP/1.11/ or associated sequences (Table 2). Sequences from patients obtained before 2008 clustered in a different clade from the more recent ones (Fig 1, Panel B), at a similar location to that observed in the N-450 dendrogram. Interestingly, indels similar to those described in MeV strains with non-standard length M-F NCR imported to the USA from Europe and India [12] were observed in all the studied sam- ples (Fig 2, type 1–7), except those from the four patients infected before 2008 (Fig 2, type 8), who had a standard length M-F NCR. All Spanish samples analyzed in this study containing non-standard length M-F NCR fea- tured a 1-nt deletion in the F 5’UTR (Fig 2), which was located on the recently described 28 nt-long homopolymeric region [positions 5051–5078 referenced to the Edmonston strain (GenBank Accession No. AY486083)] [13]. Moreover, there was an insertion of 6 cytosines Table 2. Number of sequences on each set of identical N450 and M-F NCR sequences associated to the MVs/Madrid.ESP/46.10/ sub-lineage. Set of identical N-450 Set of identical M-F NCR MVs/Madrid.ESP/ 46.10/ MVs/Alicante. ESP/5.12/ MVs/Baleares.ESP/ 13.12/5 MVs/Baleares.ESP/ 14.12/ MVs/Baleares. ESP/ 14.12/2 MVs/Baleares. ESP/ 22.12/4 Total MVs/Madrid.ESP/46.10/ 1 1 MVs/Sevilla.ESP/1.11/ 27 3 1 1 2 1 35 MVs/Valencia.ESP/16.11/ 1 1 MVi/Sevilla.ESP/25.11/ 1 1 MVs/SantaCruzTenerife. ESP/27.11/ 1 1 MVs/Valencia.ESP/45.11/ 1 1 MVs/Baleares.ESP/14.12/2 1 1 MVs/Baleares.ESP/17.12/2 1 1 MVs/Baleares.ESP/21.12/ 1 1 MVs/Baleares.ESP/23.12/ 1 1 MVs/Baleares.ESP/25.12/ 1 1 MVs/Baleares.ESP/25.12/2 1 1 Total number of sequences 37 3 1 1 3 1 46 Sets of identical sequences belonged to epidemiologically linked outbreaks are shown in bold. https://doi.org/10.1371/journal.pone.0199975.t002 Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 7 / 12 (C) in the M 3’ UTR located in a C-rich homopolymeric region of 18 nt (positions 4750–4767 referenced to the Edmonston strain; GenBank Accession No. AY486083) that were flanked by two conserved guanidines (G) and two conserved adenines (A) at the 5’ and 3’ locations, respectively (Fig 2). A C insertion was also identified in the same homopolymeric region (posi- tion 4764), and there was a T insertion in one type (Fig 2, type 4). These insertions ensured that the rule of six is obeyed [5]. In the case of the M-F NCR sequences of the MeV strains belonging to the N-450 named strain MVs/Marmande.FRA/43.11/2, this insertion was located in the M 3’ UTR outside the homopolymeric region, with an A at position 4524 (Fig 2, type 6). This M 3’ UTR homopolymeric region of the MeV strains with non-standard length M-F NCR was quite variable amongst the various sets of identical M-F NCR sequences identified in this study, showing up to 7 different types of nucleotide sequences (Fig 2). In addition, 27 M-F NCRs of MeV genotype D4 strains were identified in GenBank; 23 had non-standard length M-F NCR sequences, including one isolate from Italy, one from Croatia, five from UK, and 16 isolates from the USA (Fig 3), of which 15 were cases imported from Europe and one was from India [12]. All non-standard length M-F NCRs obtained from Gen- Bank belonged to type 1, with the exception of the five sequences from the UK, which belonged to type 2. The remaining four strains had a standard length M-F NCR sequence, one of them having been isolated in Europe in 2003 (MVi/Zagreb.CRO/48.03/) and three in USA, although these were cases imported from India (Fig 3). Discussion After several years with a low incidence of measles cases, large outbreaks occurred in Europe between 2010 and 2012 after the introduction of the D4-Enfield lineage at the end of 2007, which replaced the previously circulating D4-Bucharest lineage viruses [1,2]. We have also observed this replacement in Spain, whereby all viruses from samples collected after 2008 belonged to the D4-Enfield lineage, whilst the older ones were of the D4-Bucharest lineage. The reasons for the successful spread of the D4-Enfield lineage MeV in Western Europe [2] are not well understood. The development of major measles outbreaks is related to the pres- ence of susceptible population groups in which the virus can spread easily. However, vaccina- tion coverage in Western Europe and Spain was already high before 2010–2012, when these large outbreaks occurred [3,4]. Among the factors that might have contributed to this wide- spread MeV dissemination could be the special features of the viruses themselves. Recently, MeV strains with non-standard length M-F NCR sequences, belonging to genotype D4, were discovered in USA in cases imported from Europe and India [12]. Similarly, we have identified Fig 2. M-F NCR types. Eight types of nucleotide sequences were identified in this study. Type 8 corresponds to the sequences of the D4-Bucharest lineage, which did not show the atypical M-F NCR structure. Numbers under the alignment indicate nucleotide positions in the full-length genome of the MeV Edmonston strain (GenBank Accession No. AY486083). https://doi.org/10.1371/journal.pone.0199975.g002 Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 8 / 12 non-standard length M-F NCR sequences in all the samples analyzed containing MeV from the D4-Enfield lineage, including four named strains. Since the characterization had been done directly from clinical samples, these atypical M-F NCRs could not have been the conse- quence of selection bias during virus isolation. All of the non-standard length M-F NCR sequences identified in this study had a net gain of 6 nt, thus obeying the rule of six [5]. All of them have a 1-nt deletion located at the recently described homopolymeric region of the F 5’ UTR [13]. In addition, the non-standard length M-F NCR sequences presented an insertion of 6C in a C-rich homopolymeric region at the M 3’ UTR and a 1-nt insertion in the 5’ upstream fragment of the same homopolymeric region, resulting in the previously described 7-nt insertion [12]. The exceptions were the sequences belonging to the N-450 named strain MVs/Marmande.FRA/43.11/2, whose 1-nt insertion lies outside the M homopolymeric region in order to fulfill the rule of six. Other MeVs of this latter named strain should be analyzed to establish whether they have the same genetic structure in the M-F NCR. These genetic features were not present in the MeVs belonging to the D4-Bucharest lineage that circulated previously in Spain. We obtained information only from four samples. Unfor- tunately, attempts to amplify the M-F NCR from more clinical samples obtained before 2008 were unsuccessful, probably due to the long time the available samples had been in storage. The analysis of the M-F NCR of MeV D4 strains obtained from GenBank produced similar results. All the MeV D4 strains of European origin deposited in GenBank since the end of 2007 presented these atypical M-F NCR sequences. In addition, only one M-F NCR from a Fig 3. M-F NCR in the MeV D4 genotype strains obtained from GenBank. 27 M-F NCRs of MeV genotype D4 strains were identified in GenBank; 23 had non-standard length M-F NCR sequences, 22 were of European origin, and 1 was from India.  indicates that the M-F NCR was extracted from the complete genome sequence.  indicates MeV cases imported from India. https://doi.org/10.1371/journal.pone.0199975.g003 Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 9 / 12 European MeV D4 strain obtained before the expansion of the D4-Enfield lineage was found in GenBank (MVi/Zagreb.CRO/48.03), and this did not contain any atypical indels. These findings suggest that non-standard length M-F NCR sequences is a specific genetic feature associated with members of the D4-Enfield lineage. The origin of the D4-Enfield lineage is unclear. It was named after a strain detected in the UK in 2007 (MVs/Enfield.GBR/14.07). However, the oldest known sequence of the MeV D4-Enfield lineage is from India (MVs/Raichur.IND/38.06/, No. EU812270), suggesting that this lineage was present there. This explains how a MeV D4 genotype strain with non-standard length M-F NCR was imported from India into the USA in 2009 [12]. The effect of these atypical genomes on the pathogenesis of MeV is unknown, although the M-F NCR has been implicated in the regulation of the viral replication and cytopathogenicity [9]. The functional significance of the 6C insertions needs further exploration, but a longer M 3’UTR would promote virus replication by increasing M protein expression [9]. To date, the biological characteristics have only been examined in two non-standard genome length iso- lates, in two different cell lines showing no differences in plaque size or replication efficiency [12]. However, further functional studies using several viral isolates from different named strains of the D4-Enfield lineage and showing different types of homopolymeric regions at the M 3’ UTR are needed to evaluate the biological significance of this these atypical M-F NCR sequences. In addition, whole-genome sequencing of these MeV isolates may provide informa- tion about other specific genetic features of these atypical strains. Recently, the use of new sequencing windows, including the M-F NCR, has been recom- mended for improving measles surveillance [13, 16]. The results of the phylogenetic analysis of Spanish M-F NCRs suggest higher resolution in discriminating strains than did the N-450 analysis, since more sets of identical sequences were identified with the first. In addition the results of the phylogenetic analysis of the MF-NCR sequences belonging to the named strain MVs/Madrid.ESP/46.10/ and associated sets of identical sequences are consistent with the rela- tionships among the different outbreaks established according to the epidemiological data. It agrees with that previously described in the measles outbreak investigation in Sweden (2013– 2014) using the phylogenetic analysis of the M-F NCR [11]. These results suggest a potential use of this region as a complementary tool to epidemiological investigation. According to the higher variability of this region, it could provide better discrimination of chains of transmis- sion than other regions of the MeV genome. Further studies should be made on cases with the same N-450 sequence without an epidemiological link, such as those detected in the context of outbreaks with different geographical and temporal origin. The analysis of the M-F NCR region for exploring MeV transmission and for the surveil- lance of potentially emerging strains with non-standard length M-F NCR is strongly recom- mended as part of future strategies for measles elimination. Acknowledgments We would like to thank Androulla Efstratiou from Public Health England for reviewing this manuscript, and the Genomic Unit of CNM-ISCIII, for technical assistance with sequencing. This work was supported by the Fondo de Investigacio´n Sanitaria y el Instituto de Salud Carlos III (FIS PI12/02006 and PI15CIII/00023). Aurora Ferna´ndez-Garcı´a was funded by CIBER de Epidemiologı´a y Salud Pu´blica (CIBERESP), ISCIII. Author Contributions Conceptualization: Aurora Ferna´ndez-Garcı´a, Fernando de Ory, Juan E. Echevarrı´a. Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 10 / 12 Data curation: Horacio Gil, Aurora Ferna´ndez-Garcı´a, Marı´a Mar Mosquera, Judith M. Hu¨bschen, Ana M. Castellanos, Josefa Masa-Calles. Formal analysis: Horacio Gil, Aurora Ferna´ndez-Garcı´a, Josefa Masa-Calles. Funding acquisition: Aurora Ferna´ndez-Garcı´a, Fernando de Ory. Investigation: Horacio Gil, Aurora Ferna´ndez-Garcı´a. Methodology: Aurora Ferna´ndez-Garcı´a, Marı´a Mar Mosquera, Ana M. Castellanos, Juan E. Echevarrı´a. Supervision: Aurora Ferna´ndez-Garcı´a, Juan E. Echevarrı´a. Writing – original draft: Horacio Gil. Writing – review & editing: Aurora Ferna´ndez-Garcı´a, Judith M. Hu¨bschen, Fernando de Ory, Josefa Masa-Calles, Juan E. Echevarrı´a. References 1. Mankertz A, Mihneva Z, Gold H, Baumgarte S, Baillot A, Helble R, et al. Spread of measles virus D4- Hamburg, Europe, 2008–2011. Emerg Infect Dis. 2011; 17: 1396–401. https://doi.org/10.3201/eid1708. 101994 PMID: 21801615 2. Santibanez S, Hu¨bschen JM, Muller CP, Freymuth F, Mosquera MM, Mamou MB et al. Long-term trans- mission of measles virus in Central and continental Western Europe. Virus Genes. 2015; 50: 2–11. https://doi.org/10.1007/s11262-015-1173-1 PMID: 25663095 3. Centro Nacional de Epidemiologı´a. Plan nacional de eliminacio´n del sarampio´n y de la rube´ola. Informe anual 2011. Available from http://www.isciii.es/ISCIII/es/contenidos/fd-servicios-cientifico-tecnicos/fd- vigilancias-alertas/fd-enfermedades/fd-enfermedades-prevenibles-vacunacion/plan-eliminacion- sarampion-rubeola-espana.shtml. 4. Centro Nacional de Epidemiologı´a. Plan nacional de eliminacio´n del sarampio´n y de la rube´ola. Informe anual 2012. Available from http://www.isciii.es/ISCIII/es/contenidos/fd-servicios-cientifico-tecnicos/fd- vigilancias-alertas/fd-enfermedades/fd-enfermedades-prevenibles-vacunacion/plan-eliminacion- sarampion-rubeola-espana.shtml. 5. Rima BK, Duprex WP. The measles virus replication cycle. Curr Top Microbiol Immunol. 2009; 329: 77– 102. PMID: 19198563 6. Heider A, Santibanez S, Tischer A, Gerike E, Tikhonova N, Ignatyev G, et al. Comparative investigation of the long non-coding M-F genome region of wild-type and vaccine measles viruses. Arch Virol. 1997; 142: 2521–8. PMID: 9672611 7. Liermann H, Harder TC, Lochelt M, von Messling V, Baumgartner W, Moennig V, et al. Genetic analysis of the central untranslated genome region and the proximal coding part of the F gene of wild-type and vaccine canine distemper morbilliviruses. Virus Genes. 1998; 17: 259–270. PMID: 9926401 8. Wong TC, Wipf G, Hirano A. The measles virus matrix gene and gene product defined by in vitro and in vivo expression. Virology. 1987; 157: 497–508. PMID: 3824908 9. Takeda M, Ohno S, Seki F, Nakatsu Y, Tahara M, Yanagi Y. Long untranslated regions of the measles virus M and F genes control virus replication and cytopathogenicity. J Virol. 2005; 79: 14346–54. https:// doi.org/10.1128/JVI.79.22.14346-14354.2005 PMID: 16254369 10. Penedos AR, Myers R, Hadef B, Aladin F, Brown KE. Assessment of the utility of whole genome sequencing of measles virus in the characterisation of outbreaks. PLoS One. 2015; 10(11): e0143081. https://doi.org/10.1371/journal.pone.0143081 PMID: 26569100 11. Harvala H, Wiman Å, Wallensten A, Zakikhany K, Englund H, Brytting M. Role of sequencing the mea- sles virus hemagglutinin gene and hypervariable region in the measles outbreak investigations in Swe- den during 2013–2014. J Infect Dis. 2016; 213:592–9. https://doi.org/10.1093/infdis/jiv434 PMID: 26347574 12. Bankamp B, Liu C, Rivailler P, Bera J, Shrivastava S, Kirkness EF et al. Wild-type measles viruses with non-standard genome lengths. PLoS One. 2014; 9: e95470. https://doi.org/10.1371/journal.pone. 0095470 PMID: 24748123 13. Ivancic-Jelecki J, Slovic A, Sˇ antak M, TesˇovićG, Forcic D. Common position of indels that cause devia- tions from canonical genome organization in different measles virus strains. Virol J. 2016; 13: 134. https://doi.org/10.1186/s12985-016-0587-2 PMID: 27473517 Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 11 / 12 14. Mosquera MM, Ory F, Echevarria JE. Measles virus genotype circulation in Spain after implementation of the national measles elimination plan 2001–2003. J Med Virol. 2005; 75: 137–46. https://doi.org/10. 1002/jmv.20248 PMID: 15543577 15. Rota PA, Brown K, Mankertz A, Santibanez S, Shulga S, Muller CP, et al. Global distribution of measles genotypes and measles molecular epidemiology. J Infect Dis. 2011; 204: S514–23. https://doi.org/10. 1093/infdis/jir118 PMID: 21666208 16. World Health Organization. Genetic diversity of wild-type measles viruses and the global measles nucleotide surveillance database (MeaNS). Wkly Epidemiol Rec. 2015; 90: 373–80. PMID: 26211016 17. Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in per- formance and usability. Mol Biol Evol. 2013; 30: 772–80. https://doi.org/10.1093/molbev/mst010 PMID: 23329690 18. Hall, T.A. BioEdit: a user-friendly biological sequence alignment editor and analysis 19. 19. Librado P1, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009; 25(11): 1451–2. https://doi.org/10.1093/bioinformatics/btp187 PMID: 19346325 20. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Anal- ysis version 6.0. Mol Biol Evol. 2013; 30: 2725–9. https://doi.org/10.1093/molbev/mst197 PMID: 24132122 Atypical measles strains in Spain PLOS ONE | https://doi.org/10.1371/journal.pone.0199975 July 16, 2018 12 / 12