Universidad Autónoma de Madrid 
Departamento de Bioquímica 
Facultad de Medicina 
 
 
 
 
Mitochondrial DNA transfer through exosomes during 
immune synapsis primes antiviral innate immune 
response in dendritic cells. 
 
 
 
 
 
 
 
Doctoral Thesis 
Daniel Torralba Grajales 
Madrid, 2019 
 
Universidad Autónoma de Madrid 
Programa de Doctorado en Biociencias Moleculares 
Facultad de Medicina 
Departamento de Bioquímica 
 
 
 
Mitochondrial DNA transfer through exosomes during 
immune synapsis primes antiviral innate immune 
response in dendritic cells. 
 
 
Memoria presentada por el Licenciado en Bioquímica: 
Daniel Torralba Grajales 
Para optar al título de Doctor por la Universidad Autónoma de Madrid 
 
Director de tesis: Dr. Francisco Sánchez Madrid, Doctor en Ciencias 
Biológicas y Catedrático de Inmunología de la Universidad Autónoma de 
Madrid 
Este trabajo ha sido realizado en el Centro Nacional de Investigaciones 
Cardiovasculares (CNIC) y Servicio de Inmunología del Hospital 
Universitario de la Princesa  
Madrid, 2019 
 

 
A mis padres, a mi hermana 
A mi mujer y mi hijo 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
“Un gran poder conlleva una gran responsabilidad” 
Franklin D. Roosevelt/ Tío Ben 
 

  
Agradecimientos 
Dice el proverbio chino “El leve aleteo de las alas de una mariposa se puede sentir al 
otro lado del mundo”. En un sistema dinámico complejo como es el de la vida, ligeras 
variaciones pueden amplificarse y desembocar en inmensos cambios. Es curioso cómo los 
pequeños actos de nuestra vida cotidiana tiene inmensas repercusiones completamente 
imprevisibles en nuestras vidas futuras. Creo que tener esto en mente puede ayudarnos a 
entender que tenemos un gran poder en todos nuestros actos diarios hacia los que nos 
rodean, pueden cambiar el destino de alguien por muy insignificantes que parezcan. Tenemos 
un gran poder y eso conlleva una gran responsabilidad. 
Así que si hoy estoy aquí, concluyendo un gran hito académico, es gracias a muchas 
personas que a través de pequeños cambios me han hecho convertirme en quien soy hoy. 
Quizás no tenga otra oportunidad de agradecer formalmente a todos los que me rodean o me 
han rodeado en algún momento. Discúlpeme el lector por la extensión, la tesis comienza unas 
hojas más adelante. En primer lugar me gustaría darle las gracias al Dr. Sánchez-Madrid, 
conocido entre todos como Paco. Él fue mi profesor de Inmunología, probablemente la 
asignatura que más me fascinó durante la carrera. Esto definió mi destino en la investigación 
científica y en mi futuro profesional.  Paco me aceptó en su laboratorio hace ya bastantes años 
para realizar mi proyecto de investigación de fin de carrera y finalmente la tesis doctoral. 
Gracias Paco por darme autonomía, espíritu crítico y perseverancia en los proyectos.  
En segundo lugar gracias a todos los profesores que han formado parte de mi 
educación, su labor es fundamental, ellos crean a los ciudadanos del mañana y no podemos 
olvidar su labor. Me gustaría mencionar algunos en concreto. Gracias a José Miguel Serrano, 
mi profesor de Biología de secundaria, él pensó que éramos capaces de saber más de lo que se 
nos exigía y nos enseñó los misterios de la bioquímica y la biología celular. El encendió la llama 
que años más tarde terminaría haciendo que estudiara Bioquímica. Gracias al profesor Mateo, 
él despertó mi pasión por las ciencias formales y la lógica. Consiguió que pasara de odiar las 
matemáticas a amarlas, y lo hizo consiguiendo que las entendiera y no las memorizase. Este 
evento cambió mi perspectiva de la educación y mi desempeño a lo largo de toda la carrera y 
tesis.  
He de hacer una mención a la ayuda de la Fundación La Caixa, su programa de becas 
me ha permitido centrarme en investigar y en estudiar sin preocuparme de la financiación. Sin 
duda esto es indispensable para poder desarrollarse a nivel profesional y personal. Gracias. 
Para ser un buen científico creo que hay que desarrollar una buena imaginación. No 
me corresponde juzgar si soy un buen científico pero sin duda si alguien me ha ayudado a 
desarrollar esta habilidad han sido mis inseparables amigos Mario, Miguel, Ignacio y Jose. Pero 
esto no es el único regalo que he recibido de su parte, en ellos encuentro los mejores valores 
del ser humano y ellos han tenido una tremenda influencia en quien soy yo hoy. Gracias Mario 
por entrenarme en mi incansable empeño por discutir y traer sentido a todo lo que me rodea, 
quizás una de las razones por las que me dediqué a la ciencia. Gracias también por todos los 
buenos consejos que me has dado y por tu paciencia. Gracias Miguel por ser un ejemplo de 
voluntad y perseverancia luchando por un sueño, hay que ser muy valiente para dar un giro 
tan radical a tu vida. Gracias por estar siempre cerca y apoyarme en el camino. Gracias Ignacio 
por ser un ejemplo de lealtad, amistad y bondad. Una persona en la que se puede depositar 
una confianza absoluta porque nunca te fallará. Gracias Jose por tu buen sentido del humor y 
tu asertividad. Me habéis enseñado mucho. Gracias a los cuatro por estar a mi lado siempre. 
En el colegio conocí a mucha gente y ese periodo definió en gran medida la 
personalidad que terminaría moldeando en los años venideros. Gracias a Juan Luis por tantos 
recreos de última hora, y por tan buenos ratos que vivimos y seguimos viviendo. También me 
gustaría agradecerle a Victoria por todas esas explicaciones y tanta ayuda que me dio, gracias 
por las confidencias y tu cariño. Gracias por último a David que ha sido un gran compañero y 
amigo desde el cole hasta hoy.  
De mi etapa universitaria sin duda tengo que agradecer a mis amigos de Biología de la 
UAM, personas que permanecerán siempre cerca y que hicieron que mis años en la 
universidad pasaran como un suspiro y que guardé en mis recuerdos como una de las mejores 
etapas de mi vida. Dicen que un científico debe ser guiado por su curiosidad, y, ¿quién tiene 
más curiosidad que un niño? Sin duda alguna ellos me han hecho mantener a mi niño interior 
activo, de disfrutar de las pequeñas cosas y de valorar cada momento. Muchas gracias Barrio 
por la amistad y el apoyo a lo largo de estos años (a tu manera). Sin duda eres un ejemplo de 
lealtad y fidelidad hacia tus amigos. Él me enseñó que las cosas inolvidables son las que nunca 
se olvidan. Gracias por toda la morralla de YouTube que me ha hecho pasar tantas horas 
haciendo y diciendo tonterías. Si hablamos de niños grandes el premio se lo lleva Petrini, 
gracias por hacernos reír tanto y por todas las aventuras en las que nos has metido. Siempre 
apoyado por Cogollos que nunca defrauda para tener una nueva historia que contar. A veces la 
vida nos trae sorpresas, y cuál fue la mía cuando encontré a mi amigo de la infancia del colegio 
en mi clase de Biología, Miguel ese chico silencioso que siempre era nuevo en el colegio y que 
también fue nuevo en la Universidad logró ganarse nuestros corazones. Muchas gracias por 
compartir conmigo tu humildad y buen corazón. Gracias a David, por retarme y hacerme 
querer llegar más lejos, un poco de competencia sana siempre puede alentarnos a ser mejores 
cada día, aunque probablemente el único que competía era yo… Gracias por ayudarme tan 
desinteresadamente y por resolver mis histéricas dudas de última hora antes del examen. 
Gracias a Hurtado por enseñarme como el esfuerzo y las ganas de conocer pueden llevarte a 
sitios maravillosos. Gracias a Didi, ella fue mi confidente durante los años de Universidad, 
gracias por tantos pequeños momentos y por darle alas a mi sentido del humor en la cafetería. 
Sobre todo muchas gracias por preocuparte tanto por mí y por todo el cariño que me has 
dado. Otro punto de inflexión en mi vida y mi carrera fue cuando Marina me invitó a hacerle 
una visita a su cabaña flotante en el Amazonas, mi forma de tomarme la vida dio un giro de 
360 grados, muchas gracias por haberme dado esa oportunidad y por empujarme a ir a por la 
que a día de hoy es mi mujer. Por último gracias a Marta, Varela y Velilla por hacerme sentir en 
familia y porque gracias a vosotras cada día en la Uni era más divertido. En conjunto todos 
vosotros habéis tenido una tremenda influencia en quien soy hoy y a donde he llegado. No 
podré nunca agradecéroslo lo suficiente.  
En mi época universitaria también entro en mi vida Alma, no lo sabía aun pero 
terminaría siendo parte de mi familia. Gracias por todo el cariño que nos has dado a mí y a 
Mery a lo largo de estos años. Gracias por estar siempre ahí sin importar que pasara y muchas 
gracias por aguantar mis chinches que tanto disfruto y que tanto te desesperan.  
Victor y Fran, dos grandes amigos que me llevo de mi etapa predoctoral. 
Probablemente son de las personas con más capacidad que he conocido y de las que más 
admiro. Fran, creativo y trabajador donde los haya (aun siendo de Graná) y Victor, experto 
networker y proactivo a más no poder. Ambos con un excepcional sentido del humor. Gracias 
por tantas meriendas y por tantas discusiones científicas. Gracias por escuchar mis hipótesis 
por apoyarme en mis momentos de dudas. Sé que llegareis donde os propongáis  
También me gustaría darle las gracias a Charlie, hablar con él es siempre un reto 
intelectual, gracias por esas reuniones para arreglar el mundo que ha permitido que mi 
imaginación volase.  Una persona que sin duda sabe escuchar y siempre aporta sentido y lógica 
a la vida. 
Tengo que hacer un agradecimiento especial a todos laboratorios que me han acogido 
antes de llegar al laboratorio de Paco. Muchas gracias Guada por darme la oportunidad de 
hacer el CICERONE contigo, fue una de las mejores experiencias que tengo de mis veranos en 
la Universidad, de allí me llevo a grandes personas: Lucho, Eli, Edgar y sobretodo Toñi.  
Toñi me ha enseñado a “salir de la caja”, a pensar más allá de lo establecido y a que un 
científico tiene que ser flexible en el pensamiento puesto que debemos estar dispuestos a 
enfrentarnos a lo desconocido sin prejuicios. Que no debemos rechazar una idea por muy loca 
que sea. Probablemente al entrar en el laboratorio mi cabeza era lo contrario a esto, 
dogmático e inflexible, gracias a ella me he acercado un poco más a la ciencia de verdad. 
Gracias por ser mi mentora de esta etapa y por guiarme en este camino que a veces me ha 
resultado tan difícil.  
Otro verano que recuerdo con especial cariño es el que pasé en el laboratorio de 
Mercedes Rincón en Vermont. Fue una experiencia que me ayudó a superar momentos 
complicados y que disfruté a más no poder. Gracias Mercedes por enseñarme lo que significa 
la verdadera vocación y a vivir la ciencia con pasión. 
Durante estos años de laboratorio he tenido la oportunidad de conocer a mucha gente 
fuera del laboratorio. Muchas gracias a los “Sanchos”, en conjunto un ejemplo de dedicación y 
perseverancia. Gracias Salva por tan buenos consejos científicos y por las charlas informales en 
cualquier esquinita. Gracias Mary, Ruth, Sarai y Sofía por compartir esos  ratitos de cultivos 
diciendo tonterías y amenizando esos largos ratos muertos.  
En los 5 años de tesis en el laboratorio de Paco he podido compartir poyata con 
grandes personas. Gracias a los Jurásicos, grandes noches y momentos. Gracias Norman por 
enseñarme a encontrar la felicidad en pequeñas cosas. A Rafa por su sencillez y su capacidad 
de sacar un buen momento de cualquier situación. A Eu por su humor y por todas las 
conversaciones científicas y no tan científicas que hemos sacado. A Álvaro y Javi, gracias a 
vosotros y las conversaciones frikis me habéis hecho sentir siempre como en casa. Lo he 
pasado muy bien. Muchas gracias chicos.  
Gracias a Noe tu simpatía y por montar planes tan divertidos fuera del laboratorio en 
los que he podido conocer a mis compañeros más a fondo. Gracias a Ana, con esa templanza 
que le caracteriza siempre ha conseguido que fuese capaz de verle el lado bueno a todas las 
cosas. Gracias por tus ánimos constantes. Gracias a Irene, que empezó como mi estudiante de 
CICERONE y ahora soy yo quien tiene que consultarle todo a ella. Una persona metódica y 
ordenada de la que tengo mucho que aprender. Gracias por crear tan buen ambiente en el 
laboratorio y por ayudarme cuando lo he necesitado. Gracias a Marta, la que podría ser 
nuestra hermana mayor del lab, ella nos guía y ayuda en todo, siempre tiene unas palabras 
para animarte. Gracias a Laurín, que siempre sacaba una sonrisa e intentaba animarte aunque 
el panorama estuviese negro. Eres una gran persona. Gracias también a Olga por haber 
compartido tantos momentos y poyata, aunque mi desorden te pusiese nerviosilla. Gracias a 
Lola por estar siempre dispuesta a sacar una conversación interesante y por su contagiosa risa. 
Gracias a Raquel por ser un ejemplo de esfuerzo, me habéis enseñado mucho. Gracias a Nieves 
por su simpatía y buen rollo. Para que un laboratorio funcione hacen falta personas como 
vosotras. También es necesario que haya personas que hagan girar los engranajes del lab y ahí 
se encuentra La Secre María Ángeles. Muchas gracias por toda tu ayuda para resolver 
cualquier asuntillo. Gracias Jose María por tus chistes malos y por amenizarme tanto las horas 
de laboratorio. Gracias a Danay por ser un ejemplo de voluntad, vocación y focalización. Para 
mi eres una referencia del esfuerzo que debe hacer un científico para tener éxito. Gracias por 
todas las lecciones que me has enseñado. Gracias a Fran Baixauli, sin el cual claramente esta 
tesis sido tal y como es. Gracias por guiarme por el tortuoso camino de la tesis y por tu 
generosidad.  Gracias a Noa, que sobre todo en esta última etapa me ha ayudado 
sobremanera, consiguió tirar para que el paper pudiera ser publicado. Gracias por tus consejos 
que me has dado. Gracias a Raúl y a Vicky, que me habéis tenido que soportar con diligencia 
en vuestros veranos, gracias por recordarme lo que es la pasión por aprender. También tengo 
que agradecer a todos los integrantes de las unidades de citometría y microscopía en las que 
he pasado tantas horas, gracias a todos los que habéis hecho que mi trabajo fuera un poco 
más sencillo.  
Siempre guardaré en el corazón a todas las personas que he conocido en el 
laboratorio, ha sido una etapa dura y ellos han estado siempre ahí. Mi personalidad y mis 
objetivos en la vida han cambiado mucho desde el primer día que entré en el CNIC, ellos me 
han acompañado en este cambio y me han apoyado cuando me ha hecho falta. Gracias de 
vedad. 
Hace unos años al casarme empecé una nueva familia y extendí la que ya tenía. Ellos 
me han acogido como si fuera un hijo y un hermano desde el principio. Gracias por darme 
tanto cariño y por dejarme formar parte de vuestras vidas. Sois una familia transparente y 
humilde y me encanta formar parte de ella. Gracias Juan padre por transmitirme tu sentido de 
la responsabilidad y por tu empeño y dedicación al trabajo. Gracias por valorarme y hacerme 
sentir parte de tu círculo. No puedo olvidar agradecerte que me invitaras aquel verano al 
barco, hoy no estaría aquí de no ser por eso. Muchas gracias Eleni, porque de verdad me he 
sentido como un hijo. Desprendes genialidad y felicidad, gracias por regalar tanta positividad y 
alegría, eres indispensable. Gracias a la Abuela por todo el cariño que me da y por toda la 
vitalidad y energía que trasmite cada día. Gracias a Juan hijo por hacerme sentir uno más, por 
contar conmigo siempre, por valorarme y por hacérmelo pasar tan bien y conseguir sacarme 
una carcajada a la mínima de cambio.  
Si alguien ha podido influir en mi sin duda alguna ha sido mi familia, ellos me han 
acompañado desde que tengo uso de razón y han forjado mi carácter. Gracias a mi tito Aure, 
posiblemente la persona más buena de corazón que conoceré, él lo daría todo por el resto, un 
ejemplo de amor y devoción por sus padres. Gracias a mi tío Jose, por confiar tanto en mí, él 
siempre dijo que yo sería un gran científico, espero que este logro académico le haga sentir 
que me acerqué un poco a sus predicciones. Gracias a mi abuelita María y a mi abuelo Antonio 
que tanto me han cuidado y querido, que me ha hecho querer ser alguien del que se pudieran 
sentir orgullosos. Siempre han sido pacientes conmigo y me han querido tal y como era. 
Gracias también a mi familia de Colombia, a mi Tia Upi por el amor que irradia al mundo, a mi 
tía Vicky por su carácter afable y cariñoso. Por supuesto a mi abuelo Hoover y a mi abuela 
Estrella, os he sentido muy cerca aunque tanto tiempo hayamos estado tan lejos. Si algo me ha 
enseñado mi abuelo, hombre de muchas virtudes, es el saber estar, la corrección y la 
elegancia. Gracias a mi abuela estrella por enseñarme a contar cuentos y el sentido de la 
actuación, hoy son de gran ayuda en mi vida profesional. 
Dicen que el amor incondicional es el de una madre por su hijo, creo que puede 
extenderse al de unos abuelos por su nieto. Así lo he sentido de todos ellos, sé que a los que 
no pueden estar aquí hoy habrían sido felices viéndome delante del atril defendiendo mi tesis. 
A ellos se lo dedico.   
Para acabar tengo que agradecer especialmente a mis padres y a mi hermana. Gracias 
a mi padre Antonio por ser un rol de vida, por ser un ejemplo de rectitud y bondad. Gracias por 
enseñarme a ser un hombre de bien y por darme los valores y principios morales que a día de 
hoy rigen mi vida. Gracias por enseñarme a llevar los problemas con estoicismo y valentía, 
siempre con una sonrisa y una buena actitud. También te agradezco profundamente haberme 
dado la oportunidad de elegir con total libertad lo que quería hacer en mi vida adulta. Sin duda 
esto es lo que me ha permitido estar hoy escribiendo una tesis doctoral.  
Gracias a mi madre Cristina por enseñarme el valor de la ternura y el cuidado. Por 
escucharme incansablemente, por entenderme y por apoyarme sin condición en todos los 
proyectos que he tomado. Gracias por confiar en mí desde niño y por darme autonomía para 
tomar mis decisiones y equivocarme. Porque es desde el fallo desde donde se crea la 
experiencia y se crece. Gracias por enseñarme a no tener vergüenza y a hacer las cosas 
simplemente porque quiero sin preocuparme por los juicios de otras personas. Gracias por 
inculcarme que para conseguir  un objetivo hay que estar dispuesto a hacer sacrificios y que se 
requiere trabajo duro. Estas enseñanzas que todavía a día de hoy recibo me han ayudado a 
terminar este proyecto. Por último gracias por enseñarme junto a Papi la importancia de la 
familia. Ambos sois un ejemplo a seguir en todos los sentidos y siempre me he sentido muy 
orgulloso de vosotros. No me imagino una familia mejor en la que haber nacido.  
Mencionaba en el inicio como pequeños cambios pueden transformar la vida de las 
personas, el día que mis padres decidieron tener a mi hermana Carol cambió mi mundo, ya 
nunca más iba a estar solo. No me imagino mi vida sin ella, ha estado siempre a mi lado y sé 
que estará hasta el último día, porque la familia es lo que siempre queda. Es difícil enumerar 
todas las razones por las que estoy agradecido, supongo que su mera existencia ya transformó 
para bien mi vida. En primer lugar gracias por ser mi mejor amiga, por todos los buenos 
momentos que hemos pasado juntos. Gracias por despertar mi vena sentimental y artística, 
gracias por enseñarme a no tener miedo a derramar lágrimas, pues más de una vez ha 
ocurrido durante esta tesis.  Por supuesto un agradecimiento especial por haber diseñado la 
portada de la tesis donde como en el Renacimiento ciencia y arte han quedado integradas. 
Como dice Paco, para ser un buen científico hay que ser primero una buena persona. Si 
hoy soy una buena persona es gracias a mis padres y mi hermana. Nunca podré agradecer 
suficiente todo lo que me habéis dado. Espero poder hacerlo tan bien con mis hijos como 
vosotros lo habéis hecho con nosotros. 
En último lugar, no por casualidad, si no siguiendo el orden en las autorías de los 
trabajos científicos, está Mery, mi amiga, mi mujer y compañera de vida, mi mitad, mi aliento 
para seguir adelante y mi bastón cuando tropiezo. Ella es mi roca en medio de la tempestad, la 
única cosa que sé que no me fallará cuando todo el resto falle. Ella me ha levantado cada vez 
que me he caído con un simple: “Tu puedes, confío en ti”. 
Si algo me ha enseñado Mery es que no podemos dejar de hacer cosas por lo que 
pueda ocurrir, a la gente le paraliza el miedo cuando tienen que tomar decisiones y arriesgar. 
Mery es un claro ejemplo de lo contrario.  Ella me ha enseñado que solo cuando vamos más 
allá de nuestros límites del confort es cuando podemos desarrollarnos a nivel personal y 
crecer. Si nosotros no hubiéramos salido de esa zona de confort yo no sería el mismo y ella no 
estaría a mi lado. Como decía al principio son justo esas pequeñas acciones las que pueden 
cambiar por completo el transcurso de una o más vidas.  
Mery me inspira a ser mejor en todos los ámbitos cada día, junto a ella aprendo cosas 
nuevas todos los días, quiero ayudar a los demás y ser mejor persona. Me contagia de felicidad 
y positividad. Me da energía y fuerzas para afrontar lo que sea, no importa que. Siento un 
profundo respeto y admiración por ti Mery. Sin ti no habría podido llegar al final gracias por 
regalarme tus fuerzas.  
Por último ella me ha dado la oportunidad de crear una familia, uno de mis mayores 
deseos en la vida. Hace unos meses mi hijo Lucas, Luke para los amigos, llegó cual terremoto. 
Desde antes de nacer ha sido un gran motor de cambio y de crecimiento personal. El me 
inspira a querer ser mejor persona y padre cada día. Me conformaría con poder aportarle lo 
mismo que mi familia me ha dado a mí. Quizás en unos años lea esta tesis y espero que se 
sienta orgulloso de su padre. Muchas gracias hijo por adelantado por todo lo que me vas a dar.  
 
  
  
Las respuestas inmunitarias específicas frente a patógenos requieren de la interacción inicial 
de una célula T con una célula presentadora de antígeno (CPA), concretamente las células 
dendríticas (CD). El reconocimiento por parte de la célula T de un antígeno unido al complejo 
mayor de histocompatibilidad (CMH) conduce a la formación de una unión intercelular estable 
conocida como sinapsis inmune (SI). En las células T, la SI implica una importante 
redistribución del citoesqueleto y de los receptores asociados a membrana. También conlleva 
una polarización del tráfico intracelular y de los orgánulos secretores. La sinapsis inmune es 
una estructura adecuada para una comunicación intercelular eficiente. Durante este proceso 
las células T y las CD intercambian numerosas moléculas, incluyendo citoquinas, receptores de 
membrana aislados, moléculas de señalización y material genético. Las vesículas extracelulares 
(VE) son uno de los mecanismos que median la transferencia de información entre la célula T y 
las CD. Los cuerpos apoptóticos, los ectosomas y los exosomas son las principales vesículas 
extracelulares. Los exosomas se distinguen por su origen endocítico puesto que se forman por 
la invaginación de la membrana de los cuerpos multivesiculares (CMV) o endosomas tardíos. 
Cuando los CMV fusionan con la membrana liberan estas vesículas al medio. Los exosomas 
están particularmente enriquecidos en material genético; principalmente ARN, como los ARN 
pequeños y los ARN largos no codificantes, también se ha detectado presencia de ADN 
genómico. Esto los hace versátiles mediadores en la comunicación intercelular. No obstante, 
todavía queda mucho por explorar en los mecanismos de cómo el material genético contenido 
en los exosomas induce respuestas específicas en las células receptoras. 
En este trabajo hemos demostrado que las células T secretan VE cargadas de proteínas y ADN 
mitocondrial (ADNmt) que pueden ser transferidas a las CD a través de la sinapsis inmune. 
Evidenciamos que algunas proteínas de origen mitocondrial y el ADNmt se encuentran en los 
cuerpos multivesiculares y que el bloqueo de la secreción de exosomas altera la función y 
morfología mitocondrial, lo que sugiere que la liberación de contenido mitocondrial mediado 
por los exosomas contribuye a la homeostasis mitocondrial. También demostramos que tanto 
las proteínas mitocondriales como el ADNmt se transfieren durante la SI de forma 
unidireccional desde la célula T a la CPA y que esta transferencia pre-activa a las células  
dendríticas protegiéndolas en infecciones virales posteriores. En conclusión, los datos 
resultantes ilustran un nuevo mecanismo por el cual las células T promueven un estado de 
alerta en las células dendríticas promovido por la transferencia exosomal de ADN. Estos 
hallazgos aportan información relevante sobre cómo la comunicación recíproca entre las 
células del sistema inmune innato y del sistema inmune adaptativo facilita respuestas más 
eficaces frente a patógenos. 
   
  
  
The generation of a specific immune response against a pathogen requires the initial 
interaction of an antigen-specific T cell with antigen-presenting cells (APCs), specifically 
dendritic cells (DCs). T cell recognition of major histocompatibility complex (MHC) bound to 
antigens leads to the formation of a stable intercellular junction between the cells, the 
immune synapse (IS). In T cells the IS involves a redistribution of membrane-associated 
receptors, the cytoskeleton, and the polarization of intracellular trafficking and secretory 
organelles. The transfer of bioactive molecules from the T cell to the DC through the IS 
constitutes a main vehicle of intercellular communication. T cells and DCs exchange numerous 
molecules, including cytokines, membrane receptors, membrane patches, signaling molecules 
or genetic material (mainly functional microRNAs) during IS formation. Extracellular vesicles 
are one of the cellular mechanisms mediating information transfer between the T cell and the 
DCs. EVs comprise apoptotic bodies, ectosomes or microvesicles, and exosomes. Exosomes are 
distinguished by their unique endocytic origin. Exosomes form by invagination of the 
multivesicular body (MVB) membrane and are released to the extracellular medium upon the 
fusion of the MVB with the plasma membrane. Exosomes are particularly enriched in genetic 
material, mostly RNA species such as small RNAs and long non-coding RNAs, as well as DNA. 
This makes them attractive candidates to mediate cell-to-cell communication. However, the 
ability of the genetic material contained within exosomes to evoke immune signaling 
responses in recipient cells is largely unexplored. 
Our data show that T cells secrete extracellular vesicles containing mitochondrial DNA 
(mtDNA) and mitochondrial proteins that can be transfer to the APC through cognate 
interactions. We provide evidence that mtDNA and related proteins segregate into MVB 
pathway. Blockage of exosome secretion alters mitochondrial function and morphology which 
suggests that release of mitochondrial content loaded into exosomes contributes to 
mitochondrial homeostasis. In addition, we demonstrate that both mitochondrial proteins and 
mtDNA are transferred during IS in a unidirectional way from the T cell to the APC.  
Finally, our results show that T cells prime DCs through the transfer of exosomal DNA, 
supporting a specific role for antigen-dependent contacts in conferring protection to DCs 
against subsequent viral infections. In conclusion, our data illustrate a way by which T cells 
promote an alert state in DCs that protects them against posterior infection driven by the 
vesicular transfer of DNA. These findings shed new light on how the reciprocal communication 
between innate and adaptive immune cells allow efficacious responses to unknown threats.  
  
 
1 
 
2 
 
  
3 
 
Index 
Introduction ............................................................................................................................... 13 
1. The Immune Synapse .......................................................................................................... 14 
1.1 Organelle polarization in T cell during the Immune Synapse ....................................... 16 
1.2 Polarization of secretory machinery: the Golgi-ER pathway ........................................ 18 
1.3 Polarization of multivesicular bodies and exosomes biogenesis .................................. 20 
1.4 Mitochondria reorganization at the Immune Synapse ................................................. 27 
2. Mitochondria horizontal transfer ........................................................................................ 28 
 
Objectives .................................................................................................................................. 35 
 
Material and Methods .............................................................................................................. 39 
Reagents and antibodies ......................................................................................................... 39 
Cells ......................................................................................................................................... 41 
Human cells ......................................................................................................................... 41 
Mouse strains ...................................................................................................................... 42 
Mouse cell isolation, differentiation and activation ........................................................... 42 
Plasmids, interference RNA and cell transfection ................................................................... 43 
Lentiviral infection ................................................................................................................... 44 
Conjugate formation and assessment of mtDNA transfer ...................................................... 44 
Conjugate formation of cell lines and mitoDsRed transfer ..................................................... 45 
Exosome purification and sucrose-gradient purification ........................................................ 45 
Exosome adsorption to aldehyde-sulfate beads and detection ............................................. 46 
Nanoparticle tracking analysis ................................................................................................ 46 
Deep sequencing analysis ....................................................................................................... 46 
Exosome proteomic analysis ................................................................................................... 47 
Detection of oxidized DNA by chromatin immunoprecipitation ............................................ 48 
Analysis of antiviral response induction by exosomes ............................................................ 48 
Vaccinia infection .................................................................................................................... 48 
Cell viability Assay ................................................................................................................... 49 
Flow cytometry ....................................................................................................................... 49 
Western blot ........................................................................................................................... 50 
Immunofluorescense .............................................................................................................. 50 
4 
 
TIRFm  analysis of isolated exosomal particles ....................................................................... 50 
Electron microscopy ................................................................................................................ 51 
Extracellular Flux Analysis ....................................................................................................... 52 
Quantitative PCR and assessment of mitochondrial DNA by PCR .......................................... 52 
Statistical analysis.................................................................................................................... 54 
Data Availability ...................................................................................................................... 54 
 
Results ........................................................................................................................................ 57 
1. T cells incorporate mitochondrial proteins in exosomes .................................................... 58 
2. T cells incorporate genomic and mitochondrial DNA in exosomes .................................... 60 
3. mtDNA is partially oxidized and present only in a specific exosomal subpopulation ......... 62 
4. mtDNA and related proteins segregate into MVB pathway ............................................... 65 
5. Exosome secretion affects mitochondrial homeostasis ...................................................... 68 
6. DNA and mitochondrial proteins are transferred at cognate immune contacts ................ 73 
7. Antiviral cGAS/STING-IRF3 pathway is activated upon exosome uptake ........................... 77 
8. Antiviral signaling is triggered at least partially by DNA contained in exosomes ............... 80 
9. DCs are primed by synaptic T-exosomes ............................................................................. 82 
10. Primed DCs are more resistant to vaccinia infection ........................................................ 83 
 
Discussion .................................................................................................................................. 89 
1. Mitochondrial material is loaded into a specific population of extracellular vesicles ........ 89 
2. Pathway for mitochondrial content harboring into multivesicular bodies: Mitochondrial 
derived vesicles ....................................................................................................................... 91 
3. Physiological cause for mtDNA release in exosomes .......................................................... 93 
4. Functional mtDNA delivery in antigen presenting cells ...................................................... 95 
5. Antiviral response induction upon exosome uptake in dendritic cells ............................... 97 
6. Physiological purpose of DC priming ................................................................................... 99 
7. Concluding remarks ........................................................................................................... 100 
 
Conclusions .............................................................................................................................. 105 
 
References  .............................................................................................................................. 113 
 
 
5 
 
Annexes .................................................................................................................................... 133 
1. Publications related with this work (included): ................................................................ 133 
2. Reviews related with this work (not included): ................................................................ 133 
3. Other articles not related with this work: ......................................................................... 133 
 
 
 
  
 
  
6 
 
  
 7 
 
Li
st
 o
f 
A
b
b
re
vi
at
io
n
s 
 
 8 
 
Li
st
 o
f 
A
b
b
re
vi
at
io
n
s 
  
 9 
 
Li
st
 o
f 
A
b
b
re
vi
at
io
n
s 
List of Abbreviations 
8-OHdG  8-hydroxy-2' -deoxyguanosine 
ADAP  adhesion and degranulation promoting adapter protein 
APC  Antigen presenting cells  
ATAD3  ATPase family AAA domain-containing protein 3 
BCR  B Cell Receptor  
BMDC  Bone marrow-derived dendritic cells 
ChIP  Chromatin Immunoprecipitation 
COX1  Human Complex IV subunit I 
cSMAC  Central supramolecular activation cluster  
CTVT  Transmissible canine venereal tumor  
Cx43  Connexin 43 
DAG  Diacylglycerol  
DAMPs  Damage-associated molecular pattern 
DC  Dendritic cells 
EE  Early endosome 
ER  Endoplasmic Reticulum  
ESCRT  Endosomal sorting complex  required for transport 
EV  Extracellular Vesicles 
FCCP  carbonilcyanide p-triflouromethoxyphenylhydrazone 
GO  Gene Ontology 
GTPase  guanosine triphosphate hydrolase 
HGT  Horizontal gene transfer 
Hrs  Hepatocyte growth factor-regulated tyrosine kinase substrate 
ICAM-1  Intercellular Adhesion Molecule 1 
IFNγ  Interferon gamma 
ILV  Intraluminal vesicles  
IP3  Inositol trisphosphate  
IRF3  Interferon regulatory factor 3 
IS  Immune Synapse 
ISEV  International Society of Extracellular Vesicles 
ISG  Interferon-stimulated gene 
LBPA  Lysobisphosphatidic Acid 
Lck  lymphocyte-specific protein tyrosine kinase 
LE  Late endosome 
LFA-1  Lymphocyte function-associated antigen 1 
MDV  Mitochondrial derived vesicle 
MERCs  Mitochondria and endoplasmic reticulum contact sites 
MHC  Major histocompatibility complex  
miRNA  micro RNA 
 10 
 
Li
st
 o
f 
A
b
b
re
vi
at
io
n
s 
MSC  Mesenchymal stem cells 
mtDNA  mitochondrial DNA 
mtExo  mitochondrial-containing extracellular vesicles  
MTOC  Microtubule-organizing center 
MVB  Multivesicular Bodies  
NF-κB  nuclear factor κB  
NFPs  N-formyl peptides 
NMII  non-muscle myosin  
nPKC  Protein kinase C isoforms 
nSMase2  neutral sphingomyelinase 2 
OXPHOS  oxidative phosphorylation  
PA  Phosphatidic acid 
PAMPs  Pathogen-associated molecular patterns  
PC   Phosphatidylcholine 
PCR  Polymerase chain reaction  
PIP2  Phosphatidylinositol 4,5 bisphosphate  
PKC- ɛ  Protein kinase C epsilon 
PKC- η  Protein kinase C eta 
PKC- θ  Protein kinase C theta 
PLCγ1  Phospholipase C, gamma 1 
PLD  Phospholipase D 
PLP  Proteolipid  
pMHC  peptide-bound MHC 
pSMAC  Peripheral supramolecular activation cluster 
RLC  Regulatory light chain 
ROS  Reactive oxygen species 
S1P  sphingosine 1-phosphate  
SEE  Staphylococcal enterotoxin superantigen E 
SMS2  Sphingomyelin Synthase 2 
SphK2   sphingosine kinase 2  
SSBP1  Single-stranded DNA-binding protein 
StingGt/Gt  Sting deficient mice 
TCR  T cell surface receptor 
TEM  Tetraspanin-enriched domains 
Tfam  Mitochondrial transcription Factor A 
TIRF  Total internal reflection fluorescence 
TLR  Toll-like receptor  
TNTs  Tunneling nanotubes 
Tsg101  tumor susceptibility gene 
WB  Western Blot 
 
 11 
 
In
tr
o
d
u
ct
io
n
 
 
  
 12 
 
In
tr
o
d
u
ct
io
n
 
  
 13 
 
In
tr
o
d
u
ct
io
n
 
Introduction 
The immune system is a highly specialized compartment that protects individuals 
against pathogens and external threats. Immune responses act through cell-based mechanisms 
to protect the organism against self and non-self menaces. When fighting against pathogens, 
two different branches of immune populations are involved: innate and adaptive. Innate and 
adaptive immunity components are independent and derive from different lineages. Innate 
subset is the first barrier of defense and it is specialized in responding against conserved types 
of molecules that are common to many pathogens, called pathogen-associated molecular 
patterns (PAMPs). The adaptive subset mounts a specific response to a particular antigen of a 
pathogen; by contrast with the innate response, the adaptive is slower and requires activation, 
clonal selection and expansion. Adaptive immunity is responsible for the generation of 
memory cells that will reactivate and respond faster upon reinfection. In order to trigger a 
strong and coordinated response against pathogens, the collaboration between both 
compartments is essential. 
The adaptive compartment is formed mainly of B cells, mediators of the humoral 
immunity and T cells, mediators of the cellular immunity. Both cell types express cell surface 
receptors that allow them to recognize the antigens. B cells express the BCR (B Cell Receptor) 
and T cells express the TCR (T cell surface receptor). The TCR can recognize specific, processed 
peptides on the context of the major histocompatibility complex (pMHC) molecules. All 
nucleated cells express MHC class I (MHC-I) molecules bound to self-antigens on their surfaces 
and T cells are trained to tolerate them. In case of infection, cells present pathogenic antigens 
bound to MHC-I molecules and specialized cyototoxic CD8 T cells recognize with avidity the 
complex and terminate the presenting cell through cytolysis. On the other hand, professional 
antigen presenting cells (APC; such as dendritic cells) from the innate compartment express 
not only MHC-I but also MHC-II, which presents processed antigens from phagocyted proteins. 
CD4 T cells can recognize pathogenic peptides presented on the context of MHC-II and mount 
a specific response against them. Moreover, APCs are able to cross-present phagocyted 
antigens in MHC class I and activate CD8 responses 1.  
In this context, the intercommunication between the adaptive and the innate 
compartments is evident. Adaptive T cells receive input from innate cells, e.g. dendritic cells, 
through well-delineated cell-cell contacts, appropriately known as Immune Synapses (IS).  
 
 14 
 
In
tr
o
d
u
ct
io
n
 
1. The Immune Synapse  
The cognate interaction between lymphocytes and APCs is performed through a highly 
specialized structure called the IS.  The IS acts as a platform for intercellular communication; 
signals coming from this close interaction can modulate the final outcome of cells involved. 
Even though IS only covers around 20% of a T cell surface when stabilized, it involves an 
important rearrangement of proteins and organelles in both cell sides 2. The formation of the 
IS requires the close contact of the T cell membrane and the APC membrane. Recognition of an 
antigenic peptide-bound MHC (pMHC) by the T cell receptor (TCR) induces IS stabilization. 
Other adhesive contacts contribute to the stabilization of the IS, e.g. integrin adhesion 
receptors and co-stimulatory receptors, such as CD2 or CD28 3. 
TCR receptors appear in the microvilli of resting T cells, enabling them to scan the 
surface of the APC in rapidly occurring cell contacts (Figure I1 A) 4,5.  Once the peptide is 
recognized, the area of contact is immediately enlarged, allowing firm adhesion through LFA-1 
and ICAM-1 interaction. ICAM-1 rapidly accumulates at the interface between the T cell and 
the APC upon antigen recognition (Figure I1 B) 6. This interaction and the conformation of LFA-
1 is relevant to organize the actin cytoskeleton underneath the plasma membrane, which 
sustains cell-cell contacts7,8.   
The mechanisms that trigger TCR activation and accumulation at the IS include 
conformational changes in the αβTCR and associated CD3 complex (TCR/CD3); aggregation of 
receptors forming nano- and micro-clusters; and segregation by spatial constrictions through 
binding of partner receptors in cis and trans, cytoskeletal connections or by ectodomain-size 
spatial exclusion 9.  
Receptors have been proposed to move through the T cell surface by passive lateral 
diffusion or directional actin dynamics once the TCR recognizes the pMHC. The ability of the 
actin cytoskeleton to cluster different receptors enables T cell activation upon engagement of 
low affinity TCRs by a few MHC complexes 10. However, the possibility of TCR signaling without 
IS rearrangement makes clear that TCR signaling precedes the formation of the IS 11 (Figure I1 
B).  
 
 
 15 
 
In
tr
o
d
u
ct
io
n
 
 
Figure I1. Establishment of an immune synapse. A) The initial interactions between a T cell 
(left) and an antigen-presenting cell (APC, right) involve the contact of microvilli formed on the 
surface of the T cell with the APC surface. Integrins such as LFA-1 may contact their ligands 
(mainly ICAM-1) on the APC. B) TCR complexes on the microvilli will engage with antigen-MHC 
complexes on the APC upon antigen is recognition; the contact expands through the surface of 
the T-APC. The interaction between LFA-1 and ICAM-1 will be reinforced by TCR signaling, 
apposing together the T cell and the APC. C) Mature immune synapse; receptors will 
reorganize in different regions directed by the cytoskeleton dynamics, which also shows a 
polarized distribution.  
 
TCR/CD3 is translocated into specific lipid rafts where it is activated by Lck 12. TCR in 
lipid rafts engage with pMHC complexes; if these interactions are productive, TCR 
microclusters and their associated molecules migrate from the periphery to the center of the 
IS 13, shaping the so-called central supramolecular activation cluster (cSMAC) where receptors 
are internalized and recycled 14,15. This movement is coupled to the retrograde flow of the F-
actin 15, the contraction of actomyosin-II arcs 16, and the presence of myosin IIA 17.  
 
 16 
 
In
tr
o
d
u
ct
io
n
 
On the other hand, classic adhesion molecules maintain the interaction between cells 
forming the peripheral SMAC (pSMAC), which is highly enriched in integrins such as LFA-1 and 
ICAM-1 on the T cell and APC respectively (Figure I1 C) 3,18. In this regard, the number of pMHC 
needed for TCR activation may be as small as one 19. The formation of clusters of MHC-II and 
ICAM-1 on the APC helps the localization of TCR and LFA-1 at the T cell side of the IS, 
respectively, decreasing by 100-fold the threshold of TCR activation and shaping the IS 
properly 20–22.  
The minimal duration of interactions to elicit a proper T cell response is still under 
debate; however, the establishment of a classical immune synapse does not seem to be 
essential for a durable interaction, as a dynamic kinapse would be sufficient to activate the T 
cell 23. Formation of the SMACs is not specifically needed to observe full T cell activation, but 
the organized shape of the IS improves signaling by positioning properly the different 
components at the IS, such as receptors, cytoskeleton and organelles 24,25. 
 
1.1 Organelle polarization in T cell during the Immune Synapse 
The reorganization of the cytoskeleton is essential to control the dynamic polarity of 
organelles and the cell shape at the IS. Actin and Tubulin cytoskeleton act coordinately in order 
to distribute properly organelles and receptors25. Actin cytoskeleton rearranges sequentially 
underneath the immunological synapse upon TCR activation. It includes the whole cell 
cytoskeleton and not only the cortical actin beneath the membranes 26. F-actin plays a role in 
the distribution of receptors and integrins, and it also controls the proper fusion and secretion 
of the vesicles at the cSMAC 27.  On the other hand, microtubules relocate the required cellular 
compartments to the immune synapse, therefore guiding vesicles and organelle movement. 
Tubulin cytoskeleton rearrangement relies on the polarization of the T cell centrosome, a 
microtubule-organizing center (MTOC) 28. 
The polarization of the MTOC to the immune synapse enables the translocation of 
specific organelles and the directional secretion towards the antigen-presenting cell 29–31. 
 17 
 
In
tr
o
d
u
ct
io
n
 
 
Figure I2. Mechanisms of MTOC reorientation to the IS. A) Upon TCR activation, DAG 
accumulates at the synaptic surface. DAG recruits nPKC which leads to the polarization of the 
MTOC through Myosin and Dynein motors. B) Schematic diagram of MTOC polarization 
towards the IS surface, solid arrows denote direct connections, and dotted arrows denote 
either indirect or multistep connections. Figure from Huse et al. 2015 32. 
CD3 phosphorylation by Lck, activates a downstream cascade33,34 that ends in the 
recruitment of PLCγ1 into the cSMAC 25,35.  PLCγ1 hydrolyzes phosphatidylinositol 4,5 
bisphosphate (PIP2) into inositol trisphosphate (IP3) and diacylglycerol (DAG). DAG 
accumulates preferentially at the center of the immune synapse 36. Centrosomal movement is 
thus guided by a gradient of diacylglycerol at the IS (Figure I2) 37. MTOC translocation by a DAG 
gradient is partially explained by the recruitment of different PKC isoforms containing DAG-
specific C1 domains. Specifically, PKC-ɛ and PKC-η, which have redundant recruitment 
functions, accumulate in a broad area of the membrane. PKC-θ is also required for MTOC 
reorientation and is synergistically recruited with DAG 38. Motor proteins are involved in MTOC 
reorientation. Hence, dynein reorients the MTOC during cognate interaction as it moves along 
the microtubules from the plus end to the minus end. It accumulates at the immune synapse 
together with ADAP, therefore connecting the motor to LFA-1 clusters 39. Impairment of 
dynein-dynactin complex activity inhibits MTOC translocation after TCR antigen priming 28. PKC 
isoenzymes also shape the positioning of non-muscle myosin (NMII) through direct 
phosphorylation of the regulatory light chain (RLC), which forms clusters behind the MTOC and 
probably pushes it from behind while dynein would pull from the center of the synaptic region, 
to move the MTOC 40.  
The secretory machinery orientates towards the immune synapse in the T cell. Two 
main intracellular pathways have been described: the Golgi apparatus-Endoplasmic Reticulum 
(ER) secretory pathway and the endolysosomal system (Figure I3).  
 18 
 
In
tr
o
d
u
ct
io
n
 
1.2 Polarization of secretory machinery: the Golgi-ER pathway 
The Golgi-ER secretory pathway is guided towards the synaptic cleft 28,29,41–44, providing 
directionality to the secretion of some cytokines and signaling mediators. Specifically, IL4 is 
preferentially secreted by CD4 T cells towards the site of activation 45 and it accumulates at the 
site of T-B cell synapse together with IL5, IL2 and Interferon γ (IFNγ) after 24 h (Figure I3-1) 31. 
In the Golgi-ER secretory pathway, the CD3-TCR complexes are synthetized and retained, 
which conforms a TCR reservoir ready to be released and engaged to induce activation. These 
complexes assemble properly and progress through the secretory pathway; the vesicles 
containing these complexes fuse with the plasma membrane and TCR/CD3 complexes form 
microclusters and traffic continuously between plasma membrane and endosomes in rapid 
cycles and can be eventually degraded by lysosomal fusion (Figure I3-2) 46 . 
As previously mentioned the second secretory pathway polarized towards the immune 
synapse is the endolysosomal system; specifically, receptors and proteins from the membrane 
are endocytosed and recycled. TCR signaling and function not only depend on its expression 
but also on its membrane localization and the dynamics of TCR-CD3 complex, including its 
recycling into vesicles. The degradation of the TCR is important for synapse termination and its 
downstream signaling. Upon TCR engagement, endosomal trafficking is redirected towards the 
immune synapse by microtubules and endosomal traffic regulators such as vesicle transport 
proteins, docking proteins, and fusion regulatory molecules 47–51. TCR activation triggers its 
rapid uptake through a clathrin-dependent pathway, and it is then incorporated into a flotillin-
positive endocytic network, which is essential for the correct recycling of the TCR to the 
membrane again 52. A complex framework of endosomal vesicles fine-tunes the T cell response 
beneath the synaptic cleft membrane, by exposing, hiding or degrading receptors and signaling 
molecules (Figure I3-3). 
 
 
 19 
 
In
tr
o
d
u
ct
io
n
 
 
Figure I3. The secretory and recycling pathways at the Immune Synapse. The secretory 
machinery of the T cell is actively polarized towards the T cell-APC contact by the movement of 
the centrosome and the coordinated action of molecular motors. (1) The ER-Golgi dependent 
pathways direct their vesicles towards the immune synapse to deliver newly synthetized 
adhesion and signaling receptors and soluble mediators such as chemokines and cytokines. (2) 
TCR-CD3 complexes (orange) cycle between membrane and endosomes in a steadystate loop. 
Some CD3-TCR complexes are synthetized in excess and retained in the Golgi (3) T Cell 
Receptor molecules (red) are internalized at the central area of the T cell-APC contact; they 
can be degraded or recycled through the endolysosomal pathway. (4) Multivesicular bodies 
(MVB) are formed from the endosomes, through specific sorting of their components. MVB 
can deliver their content into the immune synapse cleft, as extracellular vesicles (i.e.: 
exosomes) or soluble components. Viruses can use this pathway to spread into APCs. (5) 
Ectosomes can be formed, excised and released from the plasma membrane to the IS cleft. 
 20 
 
In
tr
o
d
u
ct
io
n
 
1.3 Polarization of multivesicular bodies and exosomes biogenesis  
Another level of complexity includes the role of late endosomes (LE), also called 
multivesicular bodies (MVB). These organelles are enriched in specific proteins and may form 
part of the cell recycling system by fusing with lysosomes to degrade their content. On the 
other hand, they can also serve as secretory organelles, by fusing with the plasma membrane 
and releasing its content to the extracellular media 53,54. In T cells, MVB reorient towards the 
immune synapse and release there their content 55,56. 
MVB are part of the endolysosomal system. Upon endocytosis early endosomes (EE) 
are formed and these vesicles can be recycled back to the plasma membrane either by direct 
fusion or through the recycling of the endosome compartment. Proteins from EE can also be 
sorted into vesicles that maturate into MVB/LE 57. There is a specific selection of proteins that 
progress through the maturation of the endosomes and protein cargo composition can vary 
along the maturation process. Cytosolic proteins associate with endosomes and define its 
function and destiny. Rab5 associates in the first steps of EE formation58 and it is the main 
regulator of the conversion to LE. A crucial step for endosome maturation is the Rab5/Rab7 
switch; Rab5 recruits Rab7 to the EE and it is replaced by this GTPase which assumes its 
functions of protein recruitment and fusion with other LE59. Absence of Rab7 activity results in 
loss of lysosomal acidification and functionality, dispersal of endosomes and a block in cargo 
trafficking to the lysosomes 60. On the other hand, Rab7 constitutively active mutant 
(Rab7Q67L) expression leads to the fusion of LE and the formation of larger vesicles that are 
not restricted to the perinuclear area 61.  
Endosomes are motile organelles that change their subcellular localization along its 
maturation process and function. The number, size and intracellular position of endosomes are 
not determined randomly but are tightly regulated 62. The flux of maturation is a centripetal 
movement; it goes from the cell periphery to the perinuclear area, where the majority of 
lysosomes are localized (Figure I4). The motor proteins responsible for endosomal trafficking 
along microtubules are dynein and kinesin 63–67. Endosomes can directly interact with motor 
proteins or by its indirect binding mediated by dynactin acting as a scaffold which depends on 
Rab7 activity68,69.  
 
 
 21 
 
In
tr
o
d
u
ct
io
n
 
 
Figure I4. Endolysosomal system. Early endosomes (EE) are formed by the invagination of the 
plasma membrane. Proteins from EE can cycle back directly to the plasma membrane or 
through recycling endosomes. Early endosome maturate into late endosomes (LE)/MVB. These 
vesicles move towards the perinuclear space along microtubules (MT). This compartment 
combines endocytosed cargo with newly synthetized proteins from the Trans Golgi Network 
(TGN). They also load proteins from the cytoplasm through the ESCRT complex. Finally LE/MVB 
can either fuse with lysosomes and degrade their content or fuse back with the plasma 
membrane and release their content to the extracellular media. Figure from Houtari and 
Helenius 2011 57.   
During the process of endosome maturation there is bidirectional traffic between the 
endosomes and the Golgi apparatus, newly synthetized proteins such as hydrolases feeds the 
system and end up in the lysosomes maintaining their activity, function and localization (Figure 
I4) 60,70. In addition, cytoplasmic material can be selectively incorporated into endosomes 
through the invagination of the endosomal membrane, generating intraluminal vesicles (ILV)71. 
ILVs are small vesicles that are confined inside of MVB, that range between 50-100nm of 
diameter and that are enriched in proteins and genetic material. It has been proposed that ILV 
can be formed by different mechanisms, therefore coexisting in the same MVB compartment 
ILV coming from different origins with different protein and lipid composition. There are three 
models proposed for endosomal membrane invagination and ILV constitution: the Endosomal 
Sorting Complex for Transport (ESCRT) proteins machinery, the lipid dependent invagination 
and the tetraspanin mediated mechanism (Figure I5) 72.  
 22 
 
In
tr
o
d
u
ct
io
n
 
 
Figure I5. Proposed mechanisms for endosomal membrane invagination. A) ESCRT proteins 
control the sorting of ubiquitinated proteins into ILV. Syntenin and syndecan are also involved 
in the ESCRT dependent mechanism 73. B) Tetraspanin dependent mechanism; CD81, CD9 and 
CD63 are involved in the formation of ESCRT independent formation of ILV. Lipid-mediated ILV 
synthesis depends on lipid composition (DAG, S1P, PA, PC, LBPA) and lipid-related enzymes 
(nSMase2, S1P receptors, SphK2, SMS2, PLD). Modified from Villarroya et al 2014 72. 
The ESCRT recruit other ubiquitinated partner proteins during this process and 
determine the sorting of different components to ILVs 74. ESCRT machinery consists in four 
different protein complexes; ESCRT-0, ESCRT-I, ESCRT-II, ESCRT-III and the Vps4 AAA-ATPase 
complex 72,75. Early-endosome-associated proteins such as Hrs (ESCRT-0) recruits ESCRT-I 
proteins 76 and ubiquitinated proteins 77 to clathrin-coated microdomains of EE which leads to 
ILV formation. Nevertheless, it is in the late endosome where most of the ILV are formed. 
Tsg101 is an ESCRT-I protein that has a central role in LE endosome structure, maturation and 
ILV generation. ESCRT-0/I proteins recruit ESCRT II which in turn recruits and activates ESCRT-
III together with the adaptor protein Alix which stabilizes the complex. The energy for bud 
abscission is provided by the ATPase Vps4 (Figure I5A) 78,79.  
Membrane-lipid composition is also important for the proper formation of MVB and 
ILV. Proteolipid (PLP)-containing exosomes are enriched in ceramide and their secretion is not 
dependent on Hrs, Alix or Tsg101 expression. Ceramide synthesis is mediated by the 
membrane associated protein neutral sphingomyelinase 2 (nSMase2) which controls exosomes 
secretion in multiple cell models 55,80–82. Ceramide-mediated membrane bending and ILV 
formation is explained by the spontaneous aggregation of lipid microdomains. The coalescence 
of domains induces a negative curvature in the membrane, probably promoted by the cone-
shaped structure of ceramide 80. Lipid composition can also influence the sorting of ILV cargo 
and MVB maturation in an ESCRT-independent manner. Gi-coupled sphingosine 1-phosphate 
 23 
 
In
tr
o
d
u
ct
io
n
 
(S1P) receptor is present on endosomal membranes and its sustained activation controls 
exosomal maturation and cargo sorting through the formation of F-actin networks 83,84. In 
addition, sphingosine kinase 2 (SphK2) absence decreases exosomes secretion and cargo 
loading 83,85 (Figure I5B). 
Tetraspanins are highly enriched in ILV membranes, in contrast with other proteins 
from the MVB such as Lamp1 and Lamp2 86. The differential distribution of membrane proteins 
indicates that it has to be driven by active protein sorting. Tetraspanins form tetraspanin-
enriched domains (TEM) and organized membrane dynamics through its association with other 
transmembrane and cytosolic proteins and lipids87. Therefore, tetraspanins are able to 
influence the cargo sorting; CD9 tetraspanin controls the loading of CD10 metalloproteinase in 
exososomes by the interaction with its cytoplasmic domain. CD63 tetraspanin controls in 
melanosomes the loading of PMEL into ILV in an ESCRT independent manner 88,89 (Figure I5B).  
Some of these mechanisms described as independent, under physiological conditions, 
are likely to interact and cooperate producing a mixed population of ILV 72. For example the 
deficiency in ESCRT proteins Hrs and Tsg101 decreases the secretion of exosomes containing 
CD63 and CD81 90, but still allows MVB to be formed 91. In addition, the secretion of CD63-
positive exosomes from T cells is ceramide-dependent; therefore nSMase2 activity directly 
affects tetraspanin-containing exosome synthesis 55. Finally, blockage of an ILV formation 
pathway usually does not completely abrogate the secretion of exosomes 89. This piece of 
evidence points out the existence of heterogeneous populations of MVB and ILV and the 
complexity of studying these vesicles.  
As mentioned above, MVB can either fuse with lysosomes and degrade their content 
or fuse with the plasma membrane and release its content to the extracellular media; released 
ILV are better known as exosomes. The mechanisms through which MVB take the degradative 
pathway or the secretory pathway are still elusive, however there are some molecules 
described essential for MVB secretion. Rab27 is a small GTPase required for the docking of 
MVB at the plasma membrane. There are two isoforms, Rab27a and Rab27b, that control 
different steps of MVB localization, docking and fusion, which are therefore crucial in the 
exosome secretion pathway 92. ISGylation, an ubiquitin-like modification, has been proposed as 
regulatory signal for MVB´s fate. Tsg101 ISGylation promotes MVB fusion with lysosomes and 
subsequent degradation, impairing exosome secretion 93,94. Likewise, acetylation also impairs 
protein sorting into ILV competing for Lysines with the ubiquitination 95. In B lymphocytes, two 
pools of MVB can be distinguished and only MVB with high cholesterol levels are able to fuse 
 24 
 
In
tr
o
d
u
ct
io
n
 
with the plasma membrane and release exosomes 96. In polarized cells, exosomes secreted 
from the apical and basolateral side contain different cargo and composition implying the 
existence of distinct MVB pools and secretion mechanisms 97–99. Transport of MVB to the 
plasma membrane is dependent on cytoskeleton interactions. Cortactin promotes exosome 
secretion by stabilizing cortical actin-rich MVB docking sites 100. In the context of the IS, upon 
antigen recognition the MTOC relocates close to the interacting area. Dynein/dynactin motor 
proteins move MVB to the minus-end bringing these organelles near to the plasma membrane, 
therefore facilitating their fusion and release of its ILV to the synaptic cleft 55.  
1.3.1 Exosome cargo 
Exosomes contain proteins involved in their biogenesis, vesicle trafficking, lipid 
membrane organization, as well as proteins and adhesion receptors specific of the producing 
cell. ESCRT proteins and tetraspanins such as CD63, CD9 and CD81 are found in exosomal 
fractions 74.  ILV lipids are also different from the limiting membrane of the endosome. ILV 
contain more cholesterol, sphingolipids and BMP/LBPA, therefore, exosomal lipid content 
differs from that of the secreting cell 101. Exosomes are particularly enriched in genetic 
material, mostly RNA species such as small RNAs and long non-coding RNAs, as well as 
genomic DNA (Figure I6) 102–105. In addition, it has been reported that some cell lines, such as 
astrocytes, release exosomes containing mitochondrial DNA 106. This makes them attractive 
candidates to mediate cell-to-cell communication. However, the ability of the genetic material 
contained within exosomes to evoke immune signaling responses in recipient cells is largely 
unexplored. 
 
 
 
 
 
Figure I6. Exosomal components. Lipids present in exosomes include ceramide, cholesterol 
and phosphatidylserine. Heat shock proteins, actin, tubulin, tetraspanins and proteins from 
ESCRT complex are usually found in exosomes. Specific repertoires of miRNA and DNA are also 
loaded in these extracellular vesicles. Figure modified from Mittelbrunn et al 2012 56 
 25 
 
In
tr
o
d
u
ct
io
n
 
The specific repertoire of proteins and genetic content in exosomes and its differences 
in composition with the secreting cell imply the existence of sorting mechanisms that regulate 
the specific transport of selected RNAs and proteins into the exosomes. Posttranslational 
modifications are responsible for part of the specificity in cargo sorting  107. The ESCRT complex 
is the responsible of sorting ubiquitinated proteins to MVB 108, however, de-ubiquitination is 
essential for packaging the cargo into the ILV 109. On the other hand ISGylation tags the 
proteins for lysosomal degradation and prevents them for being sorted into ILV 94. Sumoylation 
also target protein to exosomes 110. In addition, some miRNA can be sorted into ILV when they 
are bound to post-translational modified proteins such as sumoylated hnRNPA2B1, which 
binds specific RNA sequences also called exo-motifs, and transport miRNA to the MVB 111. 
Other sequences also target miRNA to MVB. Hence, it has been described an exo-motif that 
allows the binding of SYNCRIP to the miRNA and sorts it to the MVB in hepatocytes 112. In 
addition, miRNA sorting change depending on the cell state proved by exosomal miRNA 
content variation along cell differentiation and maturation 113. Another mechanism that could 
explain miRNA loading is the association of components of miRNA effector complexes and 
MVB 114, however it is more intriguing the mechanisms of exosomal loading of genomic and 
mitochondrial DNA since those organelles are separated by several membranes from MVB. It 
has been proposed that cytosolic DNA could be loaded due to its interaction with DNA binding 
motifs of connexin43 (Cx43) present in exosomes 115,116. Although some of the mechanisms for 
genetic material sorting into exosomes have been reported, this is still an area boasting many 
outstanding questions to be solved. 
Proteins, RNA and DNA contained in exosomes vary depending on cell status and it can 
provide information about the pathophysiological status of the secreting cell when exosomes 
were released. In addition, exosomes can be isolated from body fluids such as blood, urine, 
saliva, etc. Due to the easiness of exosome purification and the great amount of information 
that researchers can obtain from these extracellular vesicles (EV), exosomes are potentially 
regarded as non-invasive biomarkers for early diagnostics and prognostic of certain diseases 
117–122.   
1.3.2 Extracellular vesicle secretion at the Immune Synapse 
Almost every cell type secretes a heterogeneous population of vesicles to the 
extracellular medium in a constitutive manner although cellular stress or activation signals 
modulate their secretion 72. The size of those vesicles range from 40-1000 nm, thus the 
taxonomy and nomenclature of these extracellular vesicles (EV) is still under debate 123. 
 26 
 
In
tr
o
d
u
ct
io
n
 
Nonetheless, they are classically divided into microvesicles, exosomes and apoptotic bodies, 
depending on their origin, size and molecular composition (Figure I7) 124,125.  
 
 
 
 
 
 
 
Immune cells secrete a variety of EVs to the extracellular milieu that can exert diverse 
immune functions, including antigen presentation, immune activation, induction of tolerance, 
or suppression of immune responses 126.  
At the IS, the MVB external membrane fuses with the plasma membrane to release the 
ILVs into the synaptic cleft, which are then called exosomes (Figure I3-4). TCR activation can 
induce the secretion of TCR-TSG101-containing exosomes 127 and lead to proliferation in 
autologous resting CD8 T cells, acting synergistically with IL2 128. 
These EVs carry proteins and genetic material that are then transferred to recipient 
cells by using the IS as a focal point for polarized secretion. The uptake of these exosomes 
facilitates the release of their content into the recipient cells that may modify their behavior. 
Specifically, the uptake of exosomes loaded with miRNA that are secreted by CD4 T cells in the 
context of a synapse causes the downregulation of SOX4 in B cells 55. Viruses (i.e. HIV) are able 
to hijack the polarized secretory machinery and spread across cells through immune synapses 
129,130. Apart from HIV, other viruses use the exosomal secretory machinery to disseminate 131. 
The secretion of larger vesicles that bud directly from plasma membrane, usually called 
microvesicles or ectosomes has also been described. Upon antigen cognate recognition with 
the APC, membranes from CD4 T cells start to bud from the cSMAC of the synapse 132 (Figure 
I3-5). TSG101, located at the cSMAC 133 is the responsible for the sorting of TCR into those EVs, 
while VPS4, which also belongs to the ESCRT machinery, is the responsible of the scission of 
the microvesicles from the plasma membrane.  
Figure I7. Extracellular vesicle 
populations. Microvesicles bud 
directly from the plasma 
membrane, whereas exosomes 
have an endocytic origin and are 
released by fusion of MVBs with 
the plasma membrane. Figure 
from Raposo et al 2013 124 
 27 
 
In
tr
o
d
u
ct
io
n
 
After activation, T cells secrete microvesicles that are loaded with transmembrane-
CTLA-4 negative regulator 134. However, the functional roles of microvesicles containing CTLA-4 
needs further investigation. 
 
1.4 Mitochondria reorganization at the Immune Synapse 
Mitochondria are dynamic organelles that drive many different functions in cells. They 
are involved in energy production, constituting a metabolic hub that centralizes the synthesis 
of many intermediate metabolites 135. They also play a role in apoptosis, calcium homeostasis 
and in cell signaling, mediated by ROS production and mtDNA release 136,137. In T cells, 
mitochondria are also involved in migration and class differentiation through asymmetric 
division 138. Mitochondria also control lysosomal function during inflammatory T cell responses 
139. During IS mitochondria polarize towards the T cell-APC contact and it happens in the T cell 
140 and the APC side 141. In T cells, mitochondria specifically localize around the MTOC at the 
cSMAC/pSMAC area 41 and once there fuels the IS with local ATP and calcium for proper T cell 
activation. Mitochondrial enrichment at the IS favors local calcium entry and control the Ca2+-
dependent activation of transcription factors 140,142,143. Conceivably, mitochondria move in two 
phases when polarizing towards the IS: in a first step mitochondria get closer to the IS contact 
site and in a second one they get distributed and anchored. Although not experimentally 
proven, mitochondria may follow an initial calcium gradient in a Miro1-dynein dependent 
manner and accumulate around the polarized MTOC 143–145, which would be a plausible 
mechanism for mitochondria transport to the IS. TCR engagement is not absolutely required to 
observe mitochondria accumulation at the T cell-APC area; the initial LFA1-ICAM1 interaction 
underlies this effect, facilitated by microtubule integrity 146. Therefore, the increase of calcium 
flow upon TCR engagement would increase and sustain mitochondria polarization at the IS 
area, as a second step. This can be achieved through proteins like Miro-1, which links the 
tubulin and actin cytoskeletons and fine-tunes the mitochondria movement and docking 147. 
Miro-1 is a scaffold protein for Myo19, which regulates the subcellular distribution of 
mitochondria through regulation of long-walks on microtubules and short-walks and anchoring 
to actin 148. In this sense, the localization of the centrosome at the IS is prior to mitochondria 
recruitment, which requires fragmentation by drp1 41. The de-localization of the centrosome 
from the IS through inhibition of dynein/dynactin tubulin-based molecular motor by p50-
dynamitin over-expression 28, also prevents mitochondria polarization at the IS 41. 
 28 
 
In
tr
o
d
u
ct
io
n
 
2. Mitochondria horizontal transfer  
According to the endosymbiotic theory, mitochondria are derived from eubacteria that 
engaged in a symbiotic relationship with primitive host cells. They have maintained some of 
their ancestral bacterial characteristics, such as a double membrane, a proteome similar to the 
α-proteobacteria, and the ability to generate the majority of ATP from cells in the process of 
aerobic respiration or oxidative phosphorylation (OXPHOS) 135. Mitochondria are endowed 
with their own circular genome, which is 16.6 kb in length in mammalian cells. This 
mitochondrial DNA (mtDNA) encodes 13 subunits that are essential components of the 
electron transport chain, and a translational system made of two ribosomal RNAs and 22 
tRNAs, required for the translation of these proteins 149. A typical mammalian cell contains 
thousands of copies of the mitochondrial genome, which are organized in mtDNA-protein 
complexes. Tfam protein coats and bends mtDNA in a compact structure known as nucleoid 
150. In mammals, mitochondria and its genome are transmitted to subsequent generations 
mainly through the maternal lineage. Specific mechanisms regulate the stability and 
transmission of mitochondria and their genome during germline transmission and somatic cell 
proliferation 151.  
Mitochondria have been recently shown to be horizontally transferred between 
mammalian cells, challenging current concepts of mitochondria and mtDNA segregation and 
inheritance. This transfer promotes the incorporation of mitochondria  into the endogenous 
mitochondrial network of recipient cells, contributing to changes in the bioenergetic profile 
and in other functional properties of recipient cells, not only in vitro but also in vivo. Moreover, 
intercellular transfer of mitochondria involves the horizontal transfer of mitochondrial genes, 
which has important implications in the physiopathology of mitochondrial dysfunction. The 
intercellular transfer of mitochondria or their components may also result in the initiation of 
stem cell differentiation, reprogramming of differentiated cells, or activation of inflammatory 
signaling pathways. The first evidence of functional mitochondrial transfer involved healthy 
mitochondria from human stem cells rescuing mitochondrial respiration in mitochondria-
depleted recipient cells 152. Cells devoid of intrinsic mitochondrial function by mtDNA depletion 
through long-term ethidium bromide treatment, do not survive in standard media. However, 
when these cells were co-cultured with mesenchymal stem cells (MSC) or fibroblasts that 
donated functional mitochondria, they acquired mitochondria and re-established aerobic 
respiration. The careful examination of mitochondrial and nuclear DNA polymorphisms in the 
rescued clones excluded cell fusion as the main mechanism of mitochondrial transfer, also 
confirming the stem cell origin of the transferred mtDNA 152. Transfer did not occur through 
 29 
 
In
tr
o
d
u
ct
io
n
 
the passive uptake of mitochondrial fragments or isolated organelles, but rather involved 
active processes such as the formation of tunneling nanotubes (TNTs) and/or the vesicular 
transfer of mtDNA or mitochondrial fragments.  
Recent evidence strongly supports that mitochondrial transfer does occur in vivo and 
may be involved in diverse pathophysiological situations, such as tissue injury and cancer 
progression 153–157. Mitochondrial transfer from stem cells to lung epithelial cells and 
endothelial cells is an important mechanism by which MSC exert their protective effects in 
several animal models of lung diseases. A study demonstrated that transfer of intact 
mitochondria can contribute to tissue repair in vivo by a mechanism involving connexins 
and/or extracellular vesicles (Figure I8). 155. 
 
 
 
 
 
 
 
 
Figure I8. Mitochondrial transfer in a lung disease model. Bone marrow-derived stem cells 
(BMSC) infused to the trachea of lipopolysaccharides (LPS)-treated mice attached to injured 
alveolar epithelial cells transfer mitochondria and rescue damaged cells by a mechanism 
involving connexins and/or extracellular vesicles. Mitochondria acquisition by the alveolar cells 
triggered the restoration of ATP levels and increased the secretion of pulmonary surfactant. In 
blue damaged mitochondria, in orange healthy mitochondria. 
 Cell stress has been proposed as organelle transfer initiator. Mitochondrial transfer is 
triggered by an almost complete absence of mitochondrial function, such in the case of mtDNA 
depletion or treatment with mitochondrial inhibitors. Severe damage is necessary to trigger 
transfer since it is not detected in cells harboring pathogenic mutations that only partially 
 30 
 
In
tr
o
d
u
ct
io
n
 
affect mitochondrial function 158,159. An intriguing question pertains to the degree of cellular 
damage required to initiate intercellular transfer of functional mitochondria.  
Cells likely possess mechanisms to trigger organelle exchange in response to injury 
signals emanating from the recipient cell. However, the molecular cues that initiate such 
crosstalk are still unidentified. Cellular structures that mediate intercellular mitochondrial 
transfer include TNTs, extracellular vesicles, cell fusion or mitochondrial ejection. Transfer 
through these diverse structures may result in different functional outcomes for the recipient 
cells i.e. functional mitochondrial acquisition, immune activation or transmitophagy. The 
molecular and signaling mechanisms by which cells containing dysfunctional mitochondria 
acquire mitochondria from other cells and how this process is regulated remain unclear.  
Mitochondrial components have been detected in EVs, although the mechanisms by 
which mitochondrial proteins and mtDNA are loaded in the diverse EVs are still unknown. 
Exosomes, with a size ranging 40-150 nm, contain genetic material, mostly small RNAs 72, but 
genomic and mitochondrial DNA have also been detected 103,106,160,161. Larger EVs can contain 
entire mitochondrial particles and mtDNA, as observed in mesenchymal stem cells and 
astrocytes 154,162. These cells produce EVs with regenerative potential in several tissues under 
damaging conditions 163–165. Whether mitochondrial material contained in these vesicles 
participates in the regenerative potential of stem cells is yet to be shown (Figure I9). 
The release of mitochondria or mitochondrial components into the extracellular space 
has important immune consequences. After an episode of acute injury, release of 
mitochondrial components into the extracellular medium and bloodstream may trigger potent 
pro-inflammatory responses. In fact, mitochondrial components can be recognized by cells of 
the immune system as damage-associated molecular patterns (DAMPs) 166–168. Different 
mitochondrial proteins such as TFAM, together with other mitochondrial DAMPs like N-formyl 
peptides, mtDNA, cardiolipin or extracellular ATP, robustly activate the inflammatory response 
169. 
 31 
 
In
tr
o
d
u
ct
io
n
 
 
Figure I9. Loading of mitochondrial components in Extracellular Vesicles. A) Microvesicles 
that shed directly from plasma membrane are very heterogeneous in size and composition. B) 
The inward budding of MVB forms intraluminal vesicles that are released into the extracellular 
environment as exosomes, small vesicles from 50-150nm with an endocytic origin. C) Exosome 
release is achieved through the fusion of the MVB with the plasma membrane. Extracellular 
vesicles can contain mitochondrial components which include mitochondrial proteins and 
mtDNA (depicted in yellow and orange). Bigger particles such as microvesicles can be loaded 
with full functional mitochondria 162.  
 
 32 
 
In
tr
o
d
u
ct
io
n
 
Mitochondrial DNA induces inflammation when found beyond mitochondrial 
membrane boundaries 168. Mitochondrial DNA injected directly into mice joints causes 
inflammation and arthritis 170. Moreover, mitochondrial DNA that escapes autophagy leads to 
Toll-like receptor (TLR) 9-mediated inflammatory responses in a cell-autonomous manner 171. 
When abnormally found in the cytosol, mtDNA triggers NRLP3-inflammasome activation and 
STING-dependent antiviral signaling 167,172, which ultimately leads to cell death. Neutrophils 
release to the extracellular environment oxidized mitochondrial nucleoids that activate the 
interferon response in pathological situations such as human systemic lupus erythematosus 
173, whereas activated platelets release into the bloodstream entire mitochondria or 
mitochondria encapsulated in microparticles to boost the inflammatory response 174. 
Interestingly, mtDNA released by eosinophils or basophils contribute to inflammatory 
responses creating DNA net traps to fight against invading pathogens 175,176. 
Mitochondria-dependent activation of the inflammatory response is relevant to 
understand intercellular mitochondrial transfer. In this regard, innate immune cells target cells 
containing allogenic mtDNA 177. Such recognition mechanism, displayed by natural killer cells 
and dendritic cells, is not yet understood, but it is likely to control the extent of intercellular 
mitochondrial transfer in pathophysiological conditions. As a consequence, careful modulation 
of immune surveillance mechanisms in recipient cells could be a potential strategy to boost 
exogenous mitochondrial donation for therapeutic purposes.  
 
 33 
 
  
 34 
 
 
  
 35 
 
Objectives 
Previous studies have shown that extracellular vesicles, specifically exosomes, are transferred 
during Immune synapse. T cells secrete exosomes that contain genetic material that can be 
transferred to the antigen presenting cell. Both the secretory machinery and mitochondria are 
polarized towards the contact area of the immune synapse upon antigen specific interactions. 
In addition, whole mitochondria or mitochondrial components can be transferred between 
contacting cells. Based on this background knowledge we postulate the following hypothesis: 
Mitochondrial constituents are transferred through extracellular vesicles during cognate 
interactions which induces a response in receptor cells.  
 
In order to challenge our hypothesis, we have addressed 3 main objectives: 
1) Dissect the constituents of CD4 T lymphocyte exosomes transferred to dendritic cells 
during the immune synapse. 
 Analyze the exosomes secreted by CD4 T cells. 
 Study the exosomal proteome of CD4 T lymphocytes. 
 Identification of mitochondrial genome presence in CD4 T cells exosomes. 
 Understand the relation between mitochondrial and endolysosomal 
compartments. 
 
2) Define the transfer of mitochondrial material during cognate interactions. 
 Analyze the mitochondrial protein constituents transfer from the CD4 T cell to 
the antigen presenting cell. 
 Elucidation of unidirectional transfer of mtDNA from T lymphocytes to 
dendritic cells during specific immune interactions. 
 
3) Assess the effect in dendritic cells upon uptake of mitochondrial cargo carried in 
exosomes from T cells during during immune synapse. 
 Identification of the effects induced by T cell exosomes in dendritic cells 
 Determine the signaling pathway responsible for the antigen presenting cell 
response 
 Ascertain the effects of exosomal uptake during specific T-Dendritic cell 
interactions.  
  
 36 
 
 
 
 37 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
  
 38 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
  
 39 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Materials and Methods  
Reagents and antibodies  
Antibodies used are indicated in the table below: 
Antibody Manufacturer Catalog number Application and dilution 
anti-human CD63 Calbiochem OP171 WB (1:1000) 
anti-human CD81 5A6 Santa Cruz sc-23962 WB (1:500) 
anti-human TSG101 Abcam Ab83  WB (1:1000) 
anti-GFP Clontech 632381 WB (1:2000) 
anti-TFAM Abcam ab47517 WB (1:500) 
anti-HRS Abcam  ab72053 WB (1:500) 
anti-COX1 Invitrogen 459600 WB (1:1000) 
anti-VDAC1 Abcam ab14734 WB (1:1000) 
anti-Cyt C Abcam ab110325 WB (1:1000) 
anti-LC3 Cell Signaling 2775S WB (1:1000) 
anti-MnSOD Enzo Life 
Sciences 
ADI-SOD-110 WB (1:1000) 
anti-ATAD3 Abnova H00055210-D01 WB (1:1000) 
anti-Tubulin Sigma T6199 WB (1:2000) 
anti-nSMase2 RD System MAB7184 WB (1:1000) 
anti-Rab27a RD System AF7245 WB (1:1000) 
 
 
 
 
 40 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Secondary antibodies used are indicated in the table below: 
Antibody Manufacturer Catalog number Application and dilution 
anti-mouse 
peroxidase 
Thermo 
Scientific 
31430  WB (1:5000) 
anti-rabbit peroxidase Thermo 
Scientific 
31460 WB (1:5000) 
For immunofluorescence and flow cytometry the following antibodies were used:  
Antibody Manufacturer Catalog number Application and dilution 
anti-CD63 Tea 3/18 Generated in 
the laboratory 
 IF (1µg/ml) 
anti-HRS Abcam  ab72053 IF (1:200) 
anti-EE1A Santa Cruz sc-137130 IF (1:200) 
anti-LBPA Tebu-Bio ML062915-21 IF (1:200) 
anti-Ceramide Sigma C8104-50TST IF (1:200) 
anti-8 
hydroxyguanosine 
Abcam ab62623 IF & Cyt (1:500) 
anti-DNA AC-30-10 Progen 61014 IF & Cyt (1:50) 
anti-Tmem173/Sting Proteintech 19851-1-AP IF (1:100) 
anti-SSBP1 Novus Bio NBP1-80720 IF (1:200) 
anti-CD69 BD Pharmigen 552879 IF & Cyt (1:200) 
Secondary antibodies used are indicated in the table below: 
Antibody Manufacturer Catalog number Application and dilution 
GAM-488/568/647 Invitrogen # A-11001 IF & Cyt (1:500) 
GAR-488/568/647 Invitrogen # A-11034 IF & Cyt (1:500) 
DAG-488/568/647 Invitrogen # A-11055 IF & Cyt (1:500) 
 41 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Cells 
Human cells 
Human T lymphoblasts were isolated from buffy coats obtained from healthy donors by 
separation on a biocoll gradient (Biochrom). After 30 min of adhesion at 37 °C, non-adherent 
cells were cultured in RPMI (Gibco) for 2 days in the presence of 5 μg/ml phytohemagglutinin 
(PHA) to induce lymphocyte proliferation. T lymphoblasts were maintained by addition of IL-2 
(50 U/ml) to the medium every 2 days over 8-10 days. For T lymphoblast restimulation, cells 
were incubated overnight with 50 ng/ml PMA and 750 ng/ml ionomycin.  
Human peripheral blood mononuclear cells (PBMC) were isolated from buffy coats obtained 
from healthy donors by separation on a Lymphoprep gradient (Nycomed, Oslo, Norway) 
according to standard procedures. Buffy coats of healthy donors were received from the Blood 
Transfusion Center of Comunidad de Madrid, and all donors signed their consent for the use of 
samples for research purposes. All the procedures using primary human cells were approved 
by the Ethics Committee of the Hospital Universitario de la Princesa. Monocytes were purified 
from PBMC by a 30 min adherence step at 37°C in RPMI supplemented with 10% fetal calf 
serum. Non-adherent cells were washed off and the adhered monocytes were cultured in 
RPMI, 10% FCS containing IL-4 (10 ng/ml, R&D Systems Inc, Minneapolis, MN USA) and GM-CSF 
(200 ng/ml, Schering-Plough, Madrid, Spain). Cells were cultured for 6 days, with cytokine re-
addition every other day, to obtain a population of immature hDC. 
The human Jurkat-derived T cell line J77 E6.1 (TCR Vαl. 2 Vβ8) (from NIH AIDS reagent 
program) and the lymphoblastoid B cell line Raji (Burkitt lymphoma) (from ATCC, CCL-86™) 
were cultured in RPMI (Gibco) containing 10% FBS. Stable cell line clones overexpressing CD63-
GFP were generated by transfection and selection with G418 (1 mg/ml, Sigma). 
HEK293T cells (from ATCC, CRL-3216™), were cultured in DMEM (Gibco) containing 10% FBS. 
For colocalization experiments HEK293T cells were treated with 1µM FCCP 4 h (low dose), then 
washed and immediately fixed with PFA 6%. HEK923T cells were used as a bona-fide cell 
factory for exogenous protein synthesis and organelle compartmentalization.  
Cells were regularly tested for mycoplasma contamination by PCR. 
 
 
 42 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Mouse strains 
Mice were housed under specific pathogen-free conditions at the Centro Nacional de 
Investigaciones Cardiovasculares Carlos III (CNIC), and experiments were approved by the CNIC 
Ethical Committee for Animal Welfare and by the Spanish Ministry of Agriculture, Food, and 
the Environment. Animal care and animal procedures license were reviewed and approved by 
the local Ethics Committee for Basic research at the CNIC Ethical Committee for Animal 
Welfare and the Organo Encargado del Bienestar Animal (OEBA) del Gabinete Veterinario de la  
Universidad Autonoma de Madrid (UAM). C57BL/6JOlaHsd (or C57BL/6), C57BL/6 OT-II, 
C57BL/6JOlaHsd with NZB mtDNA (or C57BL/6 NZB )  and C57BL/6NZB OT-II mice were bred 
under specific pathogen-free conditions at the CNIC (Madrid, Spain) in accordance with 
European Union recommendations. The C57BL/6JOlaHsd strain does not harbour the 
nicotinamide nucleotide transhydrogenase (NNT) spontaneous mutation that renders the 
encoded enzyme undetectable, and which is characteristic of the C57BL/6J strain provided 
directly by Jackson Laboratories. C57BL/6 NZB OT-II mice were obtained by backcrossing 
C57BL/6 OT-II transgenic males with C57BL/6 NZB females. StingGt/Gt (STING-deficient) mice 
were provided by Dr. Gloria González Aseguinolaza, Gene Therapy and Regulation of Gene 
Expression Program, Center for Applied Medical Research, Health Research Institute of 
Navarra (IdisNA), Pamplona, Spain. These mice have a single nucleotide variant (T596A) which 
is a null mutation resulting in failure to produce STING protein178. Irf3-/- mice were kindly 
provided by Prof. Adolfo García Sastre, Icahn School of Medicine at Mount Sinai, New York, 
USA.  
Mouse cell isolation, differentiation and activation  
CD4+ T cells were obtained from spleen-cell suspensions obtained from C57BL/6 OT-II 
transgenic mice. Splenic cells were incubated for 30 min at 4ºC with a biotinylated anti-CD4 
antibody (BD Pharmingen) followed by extensive washing with PBS, 1% BSA, 5 mM EDTA. Cell 
suspensions were then incubated for 20 min at 4ºC with streptavidin microbeads (MACS; 
Miltenyi Biotec) and washed with PBS, 1% BSA, 5 mM EDTA. CD4+ T cells were obtained by 
positive selection using the auto-MACS Pro Separator (Miltenyi Biotec). 
Bone marrow-derived dendritic cells (BMDCs) were obtained either from C57BL/6, C57BL/6NZB, 
StingGt/Gt or Irf3-/- mice by incubating primary bone marrow cells for 9-10 days in RPMI (Gibco) 
supplemented with 20 ng/ml recombinant GM-CSF (ImmunoTools) and 1% sodium pyruvate, 
50 U/ml penicillin, 50 µg/ml streptomycin, 5 × 10-5 M 2-mercaptoethanol, and 10% FBS (all 
from Invitrogen). 
 43 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
For T cell blasting, naive CD4+ T cells were isolated from spleen and lymph nodes and cultured 
for 48 h with 2 ug ml-1 concanavalin A (Sigma). Cells were then incubated with 50 U/ml human 
recombinant IL-2 (Glaxo) every 2 days for at least 7 days to obtain differentiated T 
lymphoblasts. For antigen-specific restimulation, T lymphoblasts were conjugated with BMDCs 
and stimulated overnight in vitro with 100 ng/ml lipopolysaccharide (LPS) in the presence or 
absence of 10 μg/ml ovalbumin (OVA) peptide. 
Plasmids, interference RNA and cell transfection 
The following plasmids were used: mitoDsRed and mitoYFP, (kindly provided by Prof. L. 
Scorrano, Venetian Institute for Molecular Medicine, Italy), TFAM-GFP and TFAM-DsRED 
(generated by inserting the human TFAM cDNA into the pEGFP and DsRED plasmids), EGFP-
Rab7A Q67L, LC3-GFP and ATG5-GFP (obtained from Addgene: plasmids 28049, 24920 and 
22952, respectively), shRNA pLKO control plasmid, shnSMase2 and shRab27a shRNAs 
(obtained from Open Biosystems), and CD63-GFP 55. 
Construct of DNase II with CD63 intraluminal domain: Following Gibson Assembly Protocol 
(New England Biolabs) hDNaseII (Human DNase II Gene ORF cDNA clone in cloning vector, 
HG16372-G, Sino Biological inc) was inserted in CD63-GFP plasmid in the intraluminal domain. 
CD63-GFP plasmid was cut with EcoRI. The following primers were used to amplify insert: 
Fw_DNaseII-EcoRI: CGAGCTCAAGCTTCGATGATCCCGCTGCTGCT Rv_DNaseII-
EcoRI:TACCGTCGACTGCAGGGATCTTATAAGCTCTGCTGG GC 
T-cell lines and human T lymphoblasts were transfected with a specific double stranded siRNA 
targeting human LC3 (GGUGCCUGUAGGUGAUCAA) or negative control siRNA (Eurogentec), 
using the Gene Pulser II electroporation system (Bio-Rad Laboratories) or the Nucleofector 
system (Amaxa Biosystems). When indicated, at 24 h post transfection, cells were cultured in 
exosome-depleted medium for 20 h and exosomes were isolated from supernatants. 
For transfection, J77 T cells were transfected with the corresponding plasmids by 
electroporation; 20×106 cells were resuspended in Opti-MEM (Gibco; 5×107 cells per ml) with 
20 μg of plasmid DNA and electroporated with a Gene Pulser Xcell electroporator (Bio-Rad) at 
1200 μFa, 240 mV, 30 ms in 4 mm Bio-Rad cuvettes (Bio-Rad). Fluorescence-positive cells were 
FACS sorted, cloned, and cultured in RPMI containing 2 mg/ml G418 (Invitrogen). HEK293T 
cells were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's 
instructions.  
 
 44 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Lentiviral infection 
J77 cells with downregulated nSMase2 and Rab27a expression were generated by infection 
with lentiviral vectors expressing specific shRNAs. HEK293T cells were co-transfected using the 
Lipofectamine2000 system (Invitrogen) with pCMV-ΔR8.91-(Delta 8.9), pMD2.G-VSV-G, and 
plasmids encoding shRNAs targeting nSMase2, Rab27a or the corresponding shRNA pLKO 
control plasmids (Open Biosystems). Supernatants were collected after 48–72 h, filtered (0.45 
μm), and added to J77 or HEK293 cell cultures. Cells were centrifuged (2000 x g, 2 h) and 
incubated for 4 h at 37 °C. Medium was replaced with RPMI containing puromycin (4 μg/ml). 
Conjugate formation and assessment of mtDNA transfer 
To assess mtDNA transfer during immune cognate interactions we used two mice strains 
(C57BL/6 and C57BL/6NZB) that differ by 12 missense mutations in their mitochondrial DNA. 
Differentiated C57BL/6NZB BMDCs were loaded with calcein (37°C, 20 min), extensively washed, 
and then co-cultured in the presence of ovalbumin (OVA) peptide (10 μg/ml) with C57BL/6 
CD4+ OT-II T cells (5:1 T cell/DC ratio; 16 h). To assess mtDNA transfer from CD4+ OT-II cells to 
BMDCs, C57BL/6 OT-II CD4+ T cells and C57BL/6NZB BMDCs were conjugated (1:5 T cell/DC ratio; 
16h). Conjugates were blocked with Fc-block (CD16/CD32, BD Pharmingen), washed in PBS, 1% 
BSA, and incubated with antibodies against MHCII and CD3 (BD Pharmingen) diluted in PBS, 1% 
BSA. Viable cells were identified by propidium iodide exclusion. Singlet cells were discerned 
with a stringent multiparametric gating strategy based on FSC and SSC (pulse width and 
height). CD4+ T cells and BMDCs were distinguished by calcein staining and MHCII and CD3 
fluorescence, and sorted on a FACSAria flow cytometer (BD Biosciences). DNA was extracted, 
and C57BL/6 and NZB mtDNAs were detected by restriction fragment length polymorphism 
(RFLP) analysis as follows. DNA (50 ng) was PCR-amplified using the RED Extract-N-Amp PCR 
Ready Mix Kit (Sigma Aldrich) with the oligonucleotides 5’ AAGCTATCGGGCCCATACCCCG 3’ 
(Fw) and 5’ GTTGAGTAGAGTGAGGGATGGG 3’ (Rv) at a concentration of 250 nM (Tm: 58º). 
After PCR amplification, samples were digested with BamH1 (10 units) for 2 h. Digested 
samples were loaded on a 2% agarose gel. C57C57 haplotype includes a BamHI restriction site; 
enzyme digestion results in two smaller fragments of 414 pb and 250 pb. Digestion of PCR 
products from C57BL/6NZB haplotype results in a single band of 664 pb corresponding to the 
full length PCR product. 
 
 45 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Conjugate formation of cell lines and mitoDsRed transfer 
To distinguish Raji B cells from T cells, Raji cells were loaded with the cell tracer CMAC (7-
amino-4-chloromethylcoumarin, Invitrogen). For antigen stimulation and IS formation, Raji 
cells were pulsed for 30 min with 0.5-1 μg/ml of Staphylococcus enterotoxin superantigen (SEE, 
Toxin Technology) and mixed with Jurkat cells expressing CD63-GFP, TFAM-dsRED, or mitoYFP 
at a ratio of 1:5 for 18-24 h at 37º C. Cell conjugates were analyzed by FACS in a FACS 
LSRFortessa Cell Analyzer (BD Biosciences) and data were analyzed with FACSDiva software 
(BD Biosciences). 
To assess gene expression after IS formation, stable J77 CD63-GFP cells and CMAC-stained Raji 
cells were conjugated as described. After 16 h, cells were sorted according to CMAC staining 
and CD63 green fluorescence. The Raji population was split into 2 groups according to CD63-
GFP uptake: Raji GFP+ Low (cells acquiring low amounts of CD63) and Raji GFP+ High (acquiring 
high amounts of CD63). After sorting, total RNA was isolated and qPCR performed to analyze 
antiviral response genes. 
Exosome purification and sucrose-gradient purification 
Cells were cultured in medium supplemented with 10% exosome-depleted fetal bovine serum 
(FBS, Invitrogen; FBS was depleted of bovine exosomes by overnight centrifugation at 100 000 
x g for at least 16-20 h. Exosomes were obtained by serial centrifugation as described 179. 
Briefly, cells were pelleted (300 x g for 10 min) and the supernatant was centrifuged at 2000 x 
g for 20 min to remove debris and dead cells. The collected supernatant was then 
ultracentrifuged at 10 000 x g for 40 min at 4 ºC (Beckman Coulter Optima L-100 XP, Beckman 
Coulter) to remove debris, apoptotic bodies, and shedding vesicles. Exosomes were pelleted by 
ultracentrifugation at 100 000 x g for 70 min at 4 °C, washed in PBS, and collected by 
ultracentrifugation at 100 000 x g for 70 min. DNase treatment was performed with RQ1 
RNase-Free DNase (Promega) according to the manufacturer's instructions.  
Exosomes were isolated by sucrose density gradient . Briefly, exosomes were obtained by 
serial centrifugation of 200 ml cell culture supernatant. Isolated exosomes were layered on top 
of a discontinuous sucrose gradient, ranging from 2.5 M sucrose at the bottom to 0.4 M 
sucrose at the top, in an SW40 centrifuge tube (14 x 95 mm; Beckman Coulter). Tubes were 
centrifuged overnight (18-20 h) in a SW40 rotor at 192 000 x g at 4 °C. One ml fractions were 
collected from the top of the gradient and were resuspended in an equal volume of acetone 
for protein precipitation and Western blot analysis or were treated as indicated for DNA 
isolation and PCR analysis.  
 46 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Exosome adsorption to aldehyde-sulfate beads and detection  
Exosomes were obtained as described above, resuspended in PBS, and coupled to 4 μm 
aldehyde-sulfate beads (Invitrogen) 15 min in rotation at room temperature. Then, coupled 
beads where incubated in overnight rotation in PBS containing 0.1% BSA and 0.01% sodium 
azide. Beads were washed twice with PBS, 0.1% BSA, 0,01% sodium azide. For surface staining, 
beads were washed and incubated with the indicated primary antibodies for 30-45 min on ice. 
For intraluminal staining, beads were fixed and permeabilized in PBS containing 1% 
Paraformaldehyde and 0.01% Triton X-100 for 20 min on ice, washed, and incubated with 
primary antibodies for 1 hour on ice. Beads were then washed and incubated with the 
appropriate secondary antibodies for 30 min on ice. Beads were analyzed with a FACS 
LSRFortessa Cell Analyzer (BD Biosciences) and data were analyzed with FACSDiva software 
(BD Biosciences). Negative controls were obtained with permeabilized and non-permeabilized 
exosome-coupled beads incubated with the indicated secondary antibodies. 
Nanoparticle tracking analysis  
Exosome numbers and size distribution were measured from the rate of Brownian motion in a 
NanoSight LM10 system, which is equipped with fast video capture and particle-tracking 
software (NanoSight, Amesbury, U.K.). Briefly, 0.5 mL of diluted exosome fraction was loaded 
into the sample chamber of an LM10 unit (Nanosight, Amesbury, UK) and three 30-second 
videos were recorded of each sample. Data were analyzed with NTA 2.1 software (Nanosight). 
Samples were analyzed using manual shutter and gain adjustments, which resulted in shutter 
speeds of 15 or 30 ms, with camera gains between 280 and 560. The detection threshold was 
kept above 4; blur: auto; minimum expected particle size: 50 nm. Samples were diluted before 
analysis to concentrations between 2 x 108 and 20 x 108 particles/ml. 
Deep sequencing analysis 
Total RNA was extracted with the RNeasy kit (Qiagen). Contaminating genomic DNA was 
removed using the specific column from the kit. RNA integrity and quantity were determined 
in an Agilent 2100 Bioanalyzer. Equal RNA amounts from 4 individual samples per group were 
analyzed in the Illumina Genome Analyzer IIx. Sequencing reads were pre-processed by means 
of a pipeline that used FastQC to assess read quality and Cutadapt to trim sequencing reads, 
eliminate Illumina adaptor remains, and discard reads shorter than 30 bp. The resulting reads 
were mapped against the mouse transcriptome (GRCm38, release 76; aug2014 archive) and 
quantified using RSEM v1.17. Data were then processed with a pipeline that used the EdgeR 
Bioconductor package for normalization and differential expression analysis in a paired 
strategy. 
 47 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
The number of reads obtained per sample was in the range of 12 to 17 million. The percentage 
of reads eliminated in the pre-processing step was below 1%. Genes with at least 1 count per 
million in at least 4 samples (11 383 genes) were considered for further analysis. Fold change 
and log(ratio) values were calculated to represent gene expression differences between 
conditions. Sets of genes differentially expressed across conditions were analyzed for 
functional associations using the Ingenuity Knowledge Database (IPA, 
http://www.ingenuity.com). 
Exosome proteomic analysis 
Exosomes from mouse T lymphoblasts were isolated by serial ultracentrifugation, and protein 
extracts (200 µg) were digested using the FASP method as previously described180. After 
digestion, the resulting peptides were desalted onto C18 OMIX tips (Agilent Technologies). 
Peptides were separated into 4 fractions by cation exchange chromatography with MCX 
cartridges (Waters) using graded concentrations of ammonium formate, pH 3.0 in acetonitrile 
(ACN), and desalted again before analysis by liquid chromatography–tandem mass 
spectrometry (LC-MS/MS). 
Analyses were performed using a nano-HPLC Easy nLC 1000 chromatograph coupled to a Q-
Exactive hybrid quadrupole orbitrap mass spectrometer (Thermo Scientific). Peptides were 
loaded in an analytical C18 nano-column (EASY-Spray column PepMap RSLC C18, 75 μm 
internal diameter, 3 μm particle size, and 50 cm length, Thermo Scientific) and separated in a 
continuous gradient consisting of 8-30% B for 60 min and 30-90% B for 2 min (B = 90% ACN, 
0.1% formic acid) at 200 nL/min. The chromatographic run acquired an FT-resolution spectrum 
of 140 000 ions in the mass range of m/z 390–1600 followed by data-dependent MS/MS 
spectra of the 15 most intense parent ions. Normalized HCD collision energy was set to 28% 
and the parent ion mass isolation width was 2-Da. 
Peptides were identified from MS/MS spectra using the SEQUEST HT algorithm integrated in 
Proteome Discoverer 2.1 (Thermo Scientific). MS/MS scans were matched against a mouse 
protein database (UniProt 2016_07 Release) and the parameters were selected as follows: a 
maximum of 2 missed trypsin cleavages, a precursor mass tolerance of 800 ppm, and a 
fragment mass tolerance of 0.02 ppm. Cysteine carbamidomethylation was chosen as the fixed 
modification and methionine oxidation as the dynamic modification. The same MS/MS spectra 
collections were searched against inverted databases constructed from the same target 
databases. SEQUEST results were analyzed by the probability ratio method. False discovery 
 48 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
rate (FDR) was calculated for peptides identified in the inverted database search results using 
the refined method 181. 
Detection of oxidized DNA by chromatin immunoprecipitation 
T lymphoblast exosomes were purified by differential ultracentrifugation and lysed in buffer 
containing 25 mM Tris-HCl, 150 mM NaCl, 2 mM MgCl, 0.5%, NP40, 5 mM DTT. Protein G-
coupled magnetic beads (Protein G Dynabeads, Invitrogen) were washed and incubated for 2-3 
h with 5 µg anti-8 hydroxyguanosine (8-OHdG) antibody [15A3] (Abcam), 5 µg of anti-DNA AC-
30-10 (Progen) or with 5 µg of the isotype control (SantaCruz, sc-2015). Lysates were 
precleared with Protein G Dynabeads and then incubated overnight at 4ºC with antibody-
coupled beads. Samples were washed 5 times with lysis buffer and eluted with 50 mM Tris-HCl 
pH 8.0, 10 mM EDTA, and 1% SDS for 1 hour at 65ºC. DNA was purified with the ChIP DNA 
Clean & Concentration kit (D5205-Zymo Research). qPCR was performed on whole samples 
with technical duplicates.  
Mitochondrial enriched fraction was obtained from T lymphoblasts by resuspending them in 
mitochondrial extraction buffer (1mM EDTA ph8, 1mM DTT, 10mM NaCl, 3mM MgCl2, 5mM 
Tris-HCl ph8) during 15 min at 4ºC (Osmotic Lysis). Then, lysates were subjected to three 
freeze/thaw cycles with 5 min liquid nitrogen exposition and 10 min immersion in a water bath 
at 37ºC. Following lysis the tubes were centrifuged at 500g for 10 min at 4ºC. Supernatants 
were collected and spun down at 12000g for 20 min at 4ºC. The final pellets (mitochondria 
enriched fraction) were resuspended in lysis buffer and treated as exosomal fractions.  
Analysis of antiviral response induction by exosomes 
BMDCs were cultured and differentiated in vitro. After culture for 9-11 days, BMDCs were 
plated in p12 plates at 3×105 per well. Exosomes from T lymphoblasts were isolated by 
differential ultracentrifugation and 10-15 µg added to BMDCs for 6 h. BMDCs were then 
washed and frozen for RNA extraction. 
Vaccinia infection  
The recombinant vaccinia virus VACV-GFP was a gift from J. Yewdell (National Institutes of 
Health, Bethesda, MD). For analysis of exosome-mediated viral protection, BMDCs were 
cultured as previously described. After 9-11 days, cells were plated in p96 plates at 1×105 per 
well. T lymphoblast exosomes were purified by differential ultracentrifugation and 5-10 µg 
were added to BMDCs for 4-6 h. Vaccinia-GFP was added to cells at the indicated BMDC:virus 
ratios. After incubation for 4 h, cells were harvested, fixed for 10 min with BD 
 49 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Cytofix/Cytoperm (BD Biosciences), and analyzed by flow cytometry. Viability was assessed 
with the LIVE/DEAD® Fixable Aqua Dead Cell Stain Kit (Molecular Probes). 
For the analysis of antiviral protection during IS formation, BMDCs were cultured for 9-11 days 
and then plated in p24 plates at 2×105 per well. Receptor BMDCs were primed with 100 ng/ml 
LPS overnight, extensively washed, and co-cultured in the presence of ovalbumin (OVA) 
peptide (5 μg/ml) with C57BL/6 CD4+ OT-II T cells (5:1 T cell/DC ratio). After conjugate 
formation for 4 h, vaccinia-GFP was added at a 1:1 ratio (total number of cells in the well) for 
4h. Cells were harvested, blocked with Fc-block (CD16/CD32, BD Pharmingen), and stained 
with CD4 PE-Cy7 and CD11c PE. Viability was assessed with the LIVE/DEAD® Fixable Aqua Dead 
Cell Stain Kit (Molecular Probes). Cells were fixed for 10 min with BD Cytofix/Cytoperm (BD 
Biosciences) and analyzed by flow cytometry. 
Cell viability Assay  
In order to measure cell viability upon manumycin treatment and activation, CD4+ OTII T 
lymphoblasts were incubated for 24h with increasing amounts of manumycin (0, 1 and 2,5 µM) 
and with anti-CD3 (10 µg/ml) and anti-CD28 (2 µg/ml). Cells were harvested and stained with 
anti-CD4 and DAPI to measure the percentage of DAPI negative (alive) CD4+ cells by flow 
cytometry. 
To ascertain cell viability in the context of immune cognate interactions, CD4+ OTII T 
lymphoblasts were pre-treated for 2h with increasing amounts of manumycin (0, 1 and 2,5 
µM) ,then CD4 T cells were conjugated with OVA-pulsed dendritic cells  (5:1T cell/DC ratio; 4h). 
Cells were harvested and stained with anti-CD4 and DAPI to measure the percentage of DAPI 
negative (alive) CD4+ cells by flow cytometry. 
Flow cytometry 
For cytometry, adherent cells were harvested with 0.25% Trypsin-EDTA (Gibco), blocked with 
Fc-block (CD16/CD32, BD Biosciences), washed in PBS, 1% BSA, and incubated with primary 
antibodies diluted in PBS, 1% BSA. Viable cells were identified by HOECHST 58 exclusion. 
Singlet cells were discerned based on FSC and SSC (pulse width and height). For surface 
labeling, cells were stained with antibodies diluted in PBS, 0.5% BSA on ice. 
For intracellular and surface staining, cells were fixed with 1% formaldehyde and 
permeabilized with 0.01% Triton X-100 (Sigma). After washing, cells were blocked with Fc-
block (CD16/CD32, BD Biosciences), washed in PBS, 1% BSA, and incubated sequentially with 
primary and secondary antibodies (diluted 1:500) in PBS, 1% BSA. Cells were then analyzed by 
 50 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
FACS in a FACS LSRFortessa Cell Analyzer (BD Biosciences). Data were analyzed with FACSDiva 
software (BD Biosciences).  
To detect intracellular ROS, HEK293T cells were incubated with 2’,7’–dichlorofluorescin 
diacetate (DCDFA, Thermofisher), and to detect mitochondrial mass cells were loaded with 
mitotracker green (Invitrogen). Cells were analyzed in a FACS LSRFortessa Cell Analyzer (BD 
Biosciences) and data were analyzed with FACSDiva software (BD Biosciences).  
Western blot 
Cells or exosomes were lysed in RIPA buffer (50 mM Tris-HCl pH 8, 150 mM NaCl, 1% Triton X-
100, 0.1% sodium deoxycholate, and 0.1% SDS) supplemented with a protease inhibitor 
cocktail (Complete, Roche). Proteins were separated on 10-12% acrylamide/bisacrylamide gels 
and transferred to nitrocellulose or methanol-pretreated PVDF membranes. Membranes were 
incubated with primary antibodies (1:1000) and peroxidase-conjugated secondary antibodies 
(1:5000), and proteins were visualized with LAS-3000. 
Immunofluorescense  
For immunofluorescence assays, cells were plated onto slides coated with fibronectin 
(50 μg/ml), incubated overnight, and fixed with 2% paraformaldehyde in PBS. Cells were 
permeabilized with PBS, 0.1% Triton X-100 (Sigma), washed and stained with the 
corresponding primary antibodies (1:100-1:200) followed by secondary antibodies (1:500) (Life 
Technologies). When indicated, cells were previously transfected with the indicated plasmids. 
Cells were fixed and stained with the indicated antibodies at 24 h post transfection. Samples 
were examined with a Leica SP5 confocal microscope fitted with a × 63 objective, and images 
were processed and assembled using Leica software. Quantification of images was done with 
Fiji software (ImageJ) using Manders’ coefficient M2 as a marker for colocalization of 
mitochondrial markers (SSBP1) with endosomal markers (EEA1 and CD63)182. More than one 
hundred cells were quantified for experiment. 
TIRFm  analysis of isolated exosomal particles  
Isolated exosomal particles (8x106 particles per coverslip) generated as described and 
quantified with Nanosight were spun in a sucrose cushion (10% in HBSS; 10000xg, 15 min, 
25ºC. HS-4 rotor, Sorvall) over 13 mm diameter precision coverslips (thickness No. 1.5H; 0.170 
mm ± 0.005 mm, 0117530 Marienfield) coated with 250 µg.ml-1 Poly-L-Lys (P6407 Sigma 
Aldrich) and fixed in 1% paraformaldehyde (HBSS, 5% sucrose; RT15710 Electron Microscopy 
Sciences) for 5 min, R/T. Coverslips were treated with Glycine 200 mM in Tris-HCL (pH 7.4) for 
10 min, R/T and blocked (3% BSA, 20 µg.ml-1 human gamma-globulins  in HBSS) for 1 h R/T. 
 51 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Staining with anti-CD81 (rat anti-mouse clone MT81; 5 µg.ml-1, 4ºC, o/n) was followed by 
highly-cross-adsorbed Alexa-568-conjugated goat anti-rat Antibody (A-11077 Thermofisher 
Scientific 1:1000). Samples were then permeabilized with a 0.2% TX-100 solution (HBSS 
supplemented with 0.5% paraformaldehyde and 1.5% BSA), treated for autofluorescence and 
stained with anti-DNA (0.001 µg.ml-1) or anti-TSG101 (20 µg.ml-1, ab83 Abcam) mouse 
monoclonal antibodies for 3 h at 4ºC, followed by highly-Cross-absorbed Alexa-488-conjugated 
goat anti-mouse Antibody (A-11029 Thermofisher Scientific 1:1000). Samples were mounted 
on Prolong Gold antifade mountant (P36930 Thermofisher Scientifc). Coverslips were 
extensively washed with HBSS and a final wash with deionized water. Antibodies were diluted 
in 1.5% BSA in HBSS. Secondary antibodies were incubated for 1 h at R/T. All the solutions used 
for coverslip preparation and immunofluorescence were previously ultracentrifuged at 
100000xg for 70 min (4ºC) in a swinging bucket rotor (Beckman Coulter) or for 30 min at 
13200xg in a fixed-angle rotor (Eppendorf). Samples were imaged under a Leica AM TIRF MC M 
system mounted on a Leica DMI 6000B microscope fitted with a HCX PL APO 100×1.46 NA oil 
objective and coupled to an Andor-DU8285 VP-4094 camera. Penetration depth was 90 nm 
and 2x zoom was used to obtain an optical magnification of the samples. Equal experimental 
conditions for acquisition were used for the different coverslips. Brightness and Contrast 
adjustments were equal for all images. Processing of images was performed with Image J 
1.51n (Wayne Rasband national Institutes of Health, USA. http://imagej.nih.gov/ij; Java 
1.8.0_66; 64 bit).  
Electron microscopy 
Adherent HEK293 cells stably transfected with control shRNA, shRab27a, or shnMNase2 were 
washed in PBS and fixed for 1 h in 2.5% glutaraldehyde in 0.1 M phosphate buffer at room 
temperature. Cells were pelleted in 15ml Falcon tubes. Pellets were washed with phosphate 
buffer and incubated with 1% OsO4 for 90 min at 4 °C. Samples were then dehydrated, 
embedded in Spurr, and sectioned on a Leica ultramicrotome (Leica Microsystems). Ultrathin 
sections (50–70 nm) were stained with 2% uranyl acetate for 10 min and with a lead-staining 
solution for 5 min and observed under a JEOL JEM-1010 transmission electron microscope 
fitted with a Gatan Orius SC1000 (model 832) digital camera.  
For immunogold staining, cells were fixed in 4% PFA 0.5% glutaraldehyde in PBS at 4ºC. 
Samples were dehydrated, embedded and sectioned. Grids were rehydrated in TBS and 
treated with 0.01 M glycine to deactivate reactive aldehydes. Samples were blocked with goat 
blocking solution (Aurion) for 1h and incubated with primary antibodies; anti-Tfam (1:50) (Cell 
Signalling) and anti-DNA (1:15) (Promega) overnight in blocking solution. Grids were washed in 
 52 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
blocking solution and incubated with secondary antibodies conjugated to 12nm colloidal gold 
(1:75 for TFAM and 1:25 for DNA, Jackson ImmunoResearch) for 2h. Samples were washed in 
blocking solution and distilled water. Grids were air dried for 2h, stained with lead citrate and 
uranyl acetated and carbon coated for viewing under transmission electron microscope. 
Extracellular Flux Analysis 
Oxygen consumption rate was measured in a XF-96 Extracellular Flux Analyzer (Seahorse 
Bioscience) in equal numbers of shControl, shRab27a and shnSMase2 HEK293 cells incubated 
with XF medium. Three measurements were obtained under basal conditions and upon 
addition of oligomycin (1 mM), fluoro-carbonyl cyanide phenylhydrazone (FCCP; 1.5 mM), and 
rotenone (100 nM) + antimycin A (1 mM).  
Quantitative PCR and assessment of mitochondrial DNA by PCR 
Total RNA was isolated using the RNeasy kit (Qiagen). Genomic DNA was removed using the 
specific column from the kit. Reverse transcription was performed using the High Capacity 
cDNA Reverse Transcriptase kit (Applied Biosystems). Quantitative real-time PCR was 
performed in a 7900 HT Fast Real-Time PCR system (Life technologies) using SYBR green qPCR 
Master Mix (Promega). Data were normalized to the expression of beta-actin, beta-2-
microglobulin, and/or ywhaz and analyzed with Biogazelle QBasePlus (Biogazelle). Primer 
sequences are specified below: 
  Sequence gene Organism 
Forward CACCCAAGAACAGGGTTTGT tRNA Leu  Human 
Reverse TGGCCATGGGTATGTTGTTA tRNA Leu Human 
Forward GCCTTCCCCCGTAAATGATA 16S RNA Human 
Reverse TTATGCGATTACCGGGCTCT 16S RNA Human 
Forward TGCTGTCTCCATGTTTGATGTATCT B2 Microglob Human 
Reverse TCTCTGCTCCCCACCTCTAAGT B2 Microglob Human 
Forward TTCGGCGCATGAGCTGGAGTCC hCOX Human 
Reverse TATGCGGGGAAACGCCATATCG hCOX Human 
Forward CTCACGGGAGCTCTCCATGC HVRII Human 
Reverse CTGTTAAAAGTGCATACCGCCA HVRII Human 
Forward ACCCCTTCTCTGTCTACCG SDH Mouse 
Reverse AATGCTCGCTTCTCCTTGTAG SDH Mouse 
Forward CCCAGATATAGCATTCCCACG mtCOXI Mouse 
Reverse ACTGTTCATCCTGTTCCTGC mtCOXI Mouse 
 53 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Forward TGCACCTACCCTATCACTCA mtND1 Mouse 
Reverse GGCTCATCCTGATCATAGAATGG mtND1 Mouse 
Forward TCCCAATCGTTGTAGCCATC mtATP6 Mouse 
Reverse TGTTGGAAAGAATGGAGTCGG mtATP6 Mouse 
  
For the analysis of mitochondrial DNA contained in exosomes, DNA from T lymphoblast-
derived exosomes was isolated with the Cell Lysis Solution and Protein Precipitation Solution 
from Qiagen. After DNA isolation, PCR was performed, primer sequences are specified in the 
table below: 
 Sequence gen Organism 
Forward CCAGTGCTGCCGTCATTTTC CXCL10 Mouse 
Reverse GGCTCGCAGGGATGATTTCAA CXCL10 Mouse 
Forward CTAGAGCTAGAGCCTGCAG ISG15 Mouse 
Reverse AGTTAGTCACGGACACCAG ISG15 Mouse 
Forward GAGAGGACCATGAAGAGGA USP18 Mouse 
Reverse TAAACCAACCAGACCATGAG USP18 Mouse 
Forward TTCCCAGCAGCACAGAAAC IFIT3 Mouse 
Reverse AAATTCCAGGTGAAATGGCA IFIT3 Mouse 
Forward CAAGGCAGGTTTCTGAGGAG IFIT1 Mouse 
Reverse GACCTGGTCACCATCAGCAT IFIT1 Mouse 
Forward CGCGCATGCAACTGGCATATAACT STAT1 Mouse 
Reverse ATGCTTCCGTTCCCACGTAGACTT STAT1 Mouse 
Forward TAGTCCTTCCTACCCCAATTTCC IL6 Mouse 
Reverse TTGGTCCTTAGCCACTCCTTC IL6 Mouse 
Forward AGCAGAGGAACCTCCAGTCT CXCL10 Human 
Reverse ATGCAGGTACAGCGTACAGT CXCL10 Human 
 
 
 
 
 54 
 
M
at
er
ia
l a
n
d
 M
et
h
o
d
s 
Statistical analysis 
All values were expressed as the mean ± S.E.M. or mean with individual values included for 
data distribution. For in vitro experiments, statistical differences were evaluated with 
Student’s t test and between group differences were evaluated with the Mann-Whitney U test 
for unpaired data (GraphPad Prism). Differences were considered significant when *p < 0.05, 
**p < 0.01, ***p < 0.001. 
Data Availability  
The authors declare that the data supporting the findings of this study are available within the 
article and its supplementary information files, or are available in a persistent repository or 
upon reasonable requests to the authors. 
Deep sequencing analysis data supporting the findings of this study are deposited in GEO 
repository with the accession number: GSE110165  
 [https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE110165].  
DNA seq data are deposited in BioSample repository: SRP148571 
[https://www.ncbi.nlm.nih.gov/sra/SRP148571] 
Raw data from RNAseq and DNAseq analysis are under a common umbrella project: Bioproject 
PRJNA472779 [https://www.ncbi.nlm.nih.gov/bioproject/PRJNA472779]:  
PRJNA432987: Mouse RNA-seq data in GEO 
[https://www.ncbi.nlm.nih.gov/bioproject/PRJNA432987] 
PRJNA472354: Human DNASeq data in SRA 
[https://www.ncbi.nlm.nih.gov/bioproject/PRJNA472354] 
The mass spectrometry proteomics data are deposited to the ProteomeXchange Consortium 
via the PRIDE partner repository with the dataset identifier PXD008843 
[http://www.ebi.ac.uk/pride/archive/projects/PXD008843] 
 55 
 
R
es
u
lt
s 
  
 56 
 
R
es
u
lt
s 
  
 57 
 
R
es
u
lt
s 
Results 
Exosomes transferred from the T cell to the APC contain many different types of 
biologically active molecules, including proteins and genetic material 55,132. To investigate the 
possible specific function of the different components of the biologic material transferred from 
the T cell to the DC, the protein and genetic content of EVs isolated from the culture 
supernatant of primary T lymphoblasts were characterized by differential ultracentrifugation 
179 according to the current recommendations of the International Society of Extracellular 
Vesicles (ISEV) 183 (Figure R1).  
 
 
Figure R1. Differential centrifugation protocol for isolating exosomes from cell culture 
supernatants. Supernatants were centrifuged and pellets were consecutively discarded. After 
the 100.000g ultracentrifugation the supernatant was discarded and the pellet resuspended in 
PBS and centrifuged again in order to obtain a purified fraction of exosomes.   
Diameters of exosomes obtained in the 100 000 ×g fraction ranged from 50 to 200 nm 
(Figure R2a, R2b), in agreement with the reported size and shape of exosomes 124.  
 
 
 58 
 
R
es
u
lt
s 
 
Figure R2. Size and shape of exosomes from T cell supernatants. (a) Size distribution analysis 
by Nanoparticle Tracking Analysis (NTA) of purified exosomes from primary human T 
lymphoblasts. (b) Electron microscopy of exosomal fraction from primary human T 
lymphoblasts. Bar 200nm. 
1. T cells incorporate mitochondrial proteins in exosomes 
Proteomic characterization of T cell Exosomes identified abundant peptides derived 
from canonical exosome components, including tetraspanins, endosomal proteins, cytoskeletal 
proteins, Rab-related trafficking proteins, heat-shock proteins and nucleotide-binding proteins. 
Gene Ontology (GO) term enrichment analysis revealed that a major fraction of the total 
number of identified peptides (>3000 peptides in 4 biological replicates) were significantly 
associated with the nuclear and mitochondrial fractions (Figure R3a). Mitochondrial peptides 
constituted 7.5 ± 0.3 % of the total exosome proteome, consistent with proteomic studies on 
exosomes isolated from other cell types, including immune cells 184,185. Exosomes isolated from 
resting T lymphoblasts and cells activated with a polyclonal stimulus barely contained proteins 
of the mitochondrial matrix and the inner or outer mitochondrial membranes (Figure R3b). 
Exosomes from activated T lymphoblasts contained significant amounts of mitochondrial 
transcription factor A (TFAM), a highly abundant mtDNA-binding protein, and the 
mitochondrial nucleoid-forming protein ATPase family AAA-Domain containing protein 3 
(ATAD3) 186 (Figure R3b). The presence of the canonical exosomal proteins CD81 and TSG101 in 
the purified 100.000 ×g fraction suggested an endosomal origin (Figure R3b).  
 
 59 
 
R
es
u
lt
s 
 
Figure R3. Cellular origin of protein content in T cell exosomes. (a) Gene ontology (GO) 
cellular component analysis of peptides identified in T cell exosomes. (b) Western Blot analysis 
of mitochondrial proteins in exosomes obtained from the culture supernatant of primary 
human T lymphoblast upon treatment with phorbol myristate acetate (PMA) together with 
Ionomycin to induce T cell activation.  
TFAM and ATAD3 co-fractionated with the exosomal proteins CD81 and TSG101 in the 
100.000×g EV fraction from sucrose-gradient isolation, (Figure R4b and R4b), localizing 
mtDNA-binding proteins to exosomes. 
 
 
 60 
 
R
es
u
lt
s 
 
Figure R4. Sucrose gradient analysis of T cell exosomes (a) EVs obtained from the culture 
supernatant of human T lymphoblasts were laid on a discontinuous sucrose gradient and 
floated by overnight centrifugation. Gradient fractions were collected and analyzed by 
immunoblot to reveal the distribution of mtDNA-binding proteins and exosomal proteins in the 
sucrose fractions from lower to higher sucrose density (left to right). (b) Western blot analysis 
of ATAD3, TFAM, and the exosome markers CD81 and TSG101 in sucrose fractions. Gels shown 
are representative out of 3 independent experiments. 
2. T cells incorporate genomic and mitochondrial DNA in exosomes 
Among EVs, exosomes are enriched in genetic material, mostly non-coding RNAs 102,187. 
Exosomes from cancer cell lines and patients contain DNA that reflects the mutational status 
of the parental tumor cells 103,105. Deep-sequencing analysis of DNA in the EVs secreted by 
primary T lymphoblasts identified several reads that covered nuclear sequences and the entire 
mitochondrial genome (Figure R5a). These results were confirmed by polymerase chain 
reaction (PCR) amplification of indicated regions of the mitochondrial genome and the B2M 
nuclear gene from the DNA obtained from the 100 000 ×g fraction (Figure R5b).  
 61 
 
R
es
u
lt
s 
 
Figure R5. T cell exosomes shuttle mtDNA and genomic DNA. (a) Representation of the 
number of sequence reads aligned with the mitochondrial genome in EVs (EVs) and 
mitochondrial extracts (mtDNA) isolated from human primary T cells. (b) Left panel, Diagram 
of the mitochondrial genome, indicating the mtDNA regions analyzed by PCR (marked in red: 
HVRII, tRNALeu, COXII, and 16S rRNA). Right panel, Agarose gel showing the amplification 
products of the different mtDNA regions and the genomic DNA (β2-Microglobulin) analyzed in 
EVs purified from primary human T cells. 
The DNA content of the isolated EVs was reduced by DNase treatment whereas a small 
fraction of the DNA remained protected unless vesicles were treated with DNase and a lipid 
destabilizing agent (Figure R6a). Two pools of DNA were present, one accessible (likely on the 
surface of the vesicle) and one inaccessible (likely in the lumen of the vesicle). The presence of 
mtDNA in the 100 000 ×g EV fraction was confirmed by the partial co-fractionation on sucrose 
gradients with the exosomal proteins CD63 and TSG101 (Figure R6b).  
 62 
 
R
es
u
lt
s 
 
 
 
 
 
 
 
 
 
Figure R6. mtDNA is present both inside and outside of exosomes. (a) Agarose gel 
electrophoresis showing the detection of DNA in purified EVs. EVs obtained from the culture 
supernatant of J77 T were treated with DNase or DNase and Tx-100. Levels of mtDNA and 
genomic DNA were assessed by PCR amplification (HVRII and β2-MICROGLOBULIN, 
respectively). Isolated DNA from J77 T cells treated or not with DNase (DNA, DNA+DNase) is 
shown as control for DNase activity. (b) Distribution of mtDNA and TSG101 and CD63 in 
sucrose fractions. EVs from human Jurkat T cells were laid on a discontinuous sucrose gradient 
and floated by overnight centrifugation. DNA from gradient fractions was PCR-amplified for 
the HVRII mtDNA region. Proteins from gradient fractions were analyzed by immunoblot for 
TSG101 and CD63. A representative gel is shown (n=3). 
3. mtDNA is partially oxidized and present only in a specific exosomal 
subpopulation  
Flow cytometry analysis of EVs coupled to aldehyde sulfate beads reveals that the 
majority of beads were positive for both CD81 and DNA (Figure R7a and R7b). Total Internal 
Reflection Fluorescence (TIRF) microscopy-based analysis of the co-localization of exosomal 
marker CD81 with TSG101 or with DNA in isolated EVs showed that CD81 fully co-localized 
with TSG101, but only partly with DNA (Figure R7c), suggesting the presence of DNA in a 
subset of CD81+ exosomes in addition to other different populations of EVs.     
 
 
 63 
 
R
es
u
lt
s 
 
 
Figure R7. Characterization of the mtDNA containing vesicular subpopulation. Legend on the 
next page 
 
 64 
 
R
es
u
lt
s 
Figure R7. Characterization of the mtDNA containing vesicular subpopulation.(a) Exosomes from 
primary mouse T lymphoblasts were purified, coupled to aldehyde sulfate beads, and analyzed by 
flow cytometry by staining with the anti-DNA Ab under permeabilizing and non-permeabilizing 
conditions. Histograms show DNA staining in exosomes. Numbers are mean fluorescence 
intensities of the positive population from a representative experiment (n=3). (b) Exosomes from 
primary mouse T lymphoblasts were purified, coupled to aldehyde sulfate beads and analyzed by 
flow cytometry by staining with the anti-CD81 Ab under non-permeabilizing conditions. Histograms 
show CD81 staining in exosomes coupled to aldehyde sulfate beads. (c) Images from isolated 
exosomal preparations stained for CD81 (red in merged images) and TSG101 or DNA (green in 
merged images). Exosomal preparations were spun on coverslips, fixed, processed for 
immunofluorescence and imaged in parallel. Permeabilization was performed upon CD81 staining. 
Imaging was performed with a TIRFm with a laser penetrance of 90 nm. Individual spots were 
detected. Scale bar, 1 µm. Graphs, Qualitative co-localization of fluorescence (yellow in merged 
images and graphs). The fluorescence intensity is plotted versus xy localization of the merged 
images showed. Scatter plots, correlation between mean fluorescence intensity from CD81:Tsg101 
or CD81:DNA from TIRF images (r, Spearman coefficient for correlation; P<0.001, n=5937). Graphs 
were obtained with the Interactive 3D Surface Plot Plugging from Image J 
(https://imagej.nih.gov/ij/plugins/surface-plot-3d.html). Scatter plots correspond to the data from 
analysis with Image J from 20 different images from two different exosomal preparations from 
mouse T lymphoblasts. Images were normalized and processed in parallel. 
DNA staining in non-permeabilized EVs increased upon permeabilization, confirming 
that DNA is present both outside and inside EVs. To examine the oxidative status of EV DNA, 
the 8-hydroxy deoxyguanosine (8-OHdG) DNA modification was evaluated as a hallmark of 
DNA oxidation. Staining with anti-oxidized-DNA antibody (Ab) is also detected in non-
permeabilized EVs (Figure R8a). In agreement with these results, chromatin 
immunoprecipitation of EV lysates with 8-OHdG Ab followed by DNA isolation and PCR analysis 
revealed the presence of several oxidized mtDNA and genomic DNA regions in EVs when 
compared with the control isotype Ab (Figure R8b). To address the preferential localization of 
oxidized mtDNA, EVs and mitochondrial fractions of the corresponding cells were isolated and 
chromatin immunoprecipitation (ChIP) was performed with the 8-OHdG and total-DNA Abs. 
The enrichment in oxidized mtDNA at the EV fraction was demonstrated by qPCR analysis of 
mitochondrial genes in ChIP and quantification of the ratio between oxidized DNA vs total DNA 
(Figure R8c). These results indicate that T cells release EVs carrying genomic DNA and mtDNA 
and associated mtDNA-binding proteins, and that the released DNA is partially oxidized. 
 65 
 
R
es
u
lt
s 
 
Figure R8. Analysis of oxidized state of mtDNA present in exosomes. (a) Histogram shows 
oxidized DNA staining in exosomes coupled to aldehyde sulfate beads with anti-8 
hydroxydeoxyguanosine (8OHdG)Ab under non-permeabilizing conditions.  (b) PCR analysis of 
the enrichment of the indicated mitochondrial (mtCO1, mtND1, mtATP6) or genomic 
(succinate dehydrogenase, SDH) genes in the DNA obtained from exosomes and 
immunoprecipitated with 8-OHdG Ab relative to isotype control IgG. Mean from quantification 
of 4 independent experiments. (c) qPCR analysis showing the enrichment of the indicated 
mitochondrial genes in the DNA obtained from exosomes and mitochondrial fractions from the 
same exosome-producing cells. DNA from both fractions was immunoprecipitated with 8-
OHdG and total DNA Abs. Graph shows the ratio between oxidized DNA and total DNA in 
exosomes relative to their content in the mitochondrial fractions from the producing cells in 
duplicates from two independent experiments. t-test:*P-value<0.05, ***P-value<0.0001. 
4. mtDNA and related proteins segregate into MVB pathway  
The presence of mitochondrial components in EVs prompted us to investigate the 
molecular mechanisms controlling their extracellular release. We first co-transfected HEK-293 
cells with TFAM-GFP and a mitochondria-targeted red fluorescent protein (mitoDsRed), then 
stained for endosomal markers. Confocal immunofluorescence analysis excluded co-
localization of mitochondria and TFAM with the early endosome antigen 1 (EEA1), an early 
endosomal marker. Mitochondria and TFAM partially co-localized with components of 
maturing endosomal structures: HRS (hepatocyte growth factor regulated tyrosine kinase 
substrate), a component of the ESCRT machinery; lysobisphosphatidic acid (LBPA) and 
ceramide-positive structures, whose are markers of late endosomes and MVBs; and CD63, a 
highly abundant tetraspanin found in MVBs and exosomes (Figure R9).  
 66 
 
R
es
u
lt
s 
Figure R9. Mitochondrial components colocalize with markers from the endosomal pathway. 
Confocal co-localization analysis in HEK293 cells co-transfected with TFAM-GFP (green), nuclei 
with HOECHST 58 (blue) and a mitochondrial targeted fluorescent protein (mitoDsRed, red) 
and immunostained for endolysosomal compartment markers: the early endosome marker 
EEA1 and the ESCRT components HRS, LBPA, CD63, and ceramide (purple). Right images show 
high magnification views of co-localization between TFAM-GFP (green) and the various 
endolysosomal markers (purple). Charts show the fluorescence profiles along the 
corresponding white lines in the inset panels. Bar, 10 mm 
To rule out potential analysis artifacts produced by the exogenous overexpression of 
TFAM-GFP, we measured the co-localization of endogenous mtDNA-binding protein single 
stranded DNA binding protein 1 (SSBP1) with EEA1 and CD63 in HEK-293 cells treated with low 
doses of FCCP, that promotes these events 188. Increased co-localization of SSBP1 with CD63 
indicates preferential localization in late endosomal structures (Figure R10a).  
The segregation of mitochondrial components into maturing endosomal structures 
was confirmed in HEK-293 cells transfected with constitutively active Rab7 (Q67L), which 
enhances endosomal trafficking, resulting in the formation of enlarged late endolysosomal 
structures 189.  
 67 
 
R
es
u
lt
s 
Thus, Rab7 (Q67L) triggered the accumulation of endogenous TFAM within Rab7-
positive endosomal structures, co-localizing with mitoDsRed (Figure R10b). Also, immunogold 
labeling of TFAM and DNA revealed their appearance in canonical multivesicular body 
structures in electron microscopy studies (Figure R10c), overall supporting the involvement of 
the endosomal pathway in the secretion of mitochondrial components in EVs. 
Figure R10. Mitochondrial components segregate into MVBs. (a) Confocal co-localization 
analysis in HEK293 cells treated with FCCP (4 h) and stained with SSBP1 (red), EEA1 and CD63 
(green). Bar, 10 µm. Graph shows means for Mander’s colocalization coefficient for SSBP1 and 
EEA1 or CD63 (n=3). t-test: ***P-value<0.0001. (b) Confocal co-localization analysis in HEK293 
cells co-transfected with Rab7-Q67L-GFP (Rab7mutGFP, green) and mitoDsRed (red), and 
immunostained for TFAM (purple) and nuclei (HOECHST 58, blue). Center and right images 
show high magnification of left images (Rab7-Q67L-GFP and mitoDsRed in upper panels; Rab7-
Q67L-GFP and TFAM in lower panels). Charts, Fluorescence profiles along the corresponding 
white lines. Bar, 10 µm. (c) Representative electron microscopy images showing DNA and 
TFAM immunogold staining in canonical multivesicular bodies from HEK293T cells transfected 
with the active mutant Rab7-Q67L-GFP.  
 
 68 
 
R
es
u
lt
s 
5. Exosome secretion affects mitochondrial homeostasis 
To further elucidate the nature of the vesicles containing mitochondrial components, 
we inhibited exosome biogenesis in T cells by targeting the neutral sphingomyelinase 2 
(nSMase2, SMPD3) (Figure R11a). This enzyme participates in exosome biogenesis by 
triggering the budding of intraluminal vesicles into MVBs 80. These conditions reduced the 
recovery of exosomal proteins as well as mtDNA-binding proteins and mtDNA in the purified 
100.000 ×g fraction (Figure R11b), showing that mtDNA and mtDNA-binding proteins are 
released through canonical exosomal pathway and not in other EVs such as apoptotic bodies. 
The blocking of exosome biogenesis by silencing nSMase2 or MVB fusion with the plasma 
membrane by targeting Rab27a with specific shRNAs (Figure R11a), increased mitochondrial 
mass, intracellular TFAM levels, intracellular ROS, and DNA oxidative damage (Figure R11c).  
The suppression of nSMase2 or Rab27a altered mitochondrial morphology and cristae 
organization, with increased mitochondrial cristae width (Figure R12a). Changes in 
mitochondrial cristae organization relate to changes in mitochondrial electron transport chain 
complex organization that in turn may result in functional changes in the respiration ability of 
cells. Specifically, tight cristae provide more efficient mitochondrial OXPHOS 190, whereas loose 
cristae appear in highly glycolytic cells 191. Consistent with a loose organization of 
mitochondrial cristae, Rab27a and nSMase2 silencing significantly decreased mitochondrial 
respiration (Figure R12b). These findings indicate that mitochondrial function is altered in the 
absence of proper exosome biogenesis and secretion and suggest that the release of 
mitochondrial content in exosomes contributes to mitochondrial homeostasis and mtDNA 
metabolism. 
 
 
 
 
 
 
 
 
 69 
 
R
es
u
lt
s 
 
 
Figure R11. Exosomal secretion impairment affect mitochondrial parameters. (a) Up, 
Western blot analysis of nSMase 2 knockdown in J77 T cells infected with shControl or 
shnSMase2 shRNA. Down, Western blot analysis of Rab27a knockdown in HEK293 cells 
infected with specific shControl or shRab27a RNA. (b) Mitochondrial components in the 
exosome fraction obtained from equal numbers of shControl and shnSMase2 J77 T cells. 
ATAD3, TFAM, and CD63 were detected by immunoblot; mtDNA was detected by PCR for 
HVRII. Graph, Quantification of exosomal proteins and mtDNA in a representative experiment 
(n=3).  (c) Flow cytometry analysis of mitochondrial mass (Mitotracker green), intracellular ROS 
levels (DCFDA staining), oxidized DNA (8-OHdG Ab staining), and endogenous TFAM in HEK293 
cells knocked down for nSMase2 and Rab27a. Graphs, Quantification from 5-8 independent 
experiments (Mean). t-test *P-value<0.05; **P-value<0.001. 
 
 
 
 
 70 
 
R
es
u
lt
s 
 
 
Figure R12. Exosomal secretion impairment affect mitochondrial organization and respiration. (a) 
Electron microscopy images show defects in mitochondrial ultrastructure and cristae organization in 
shnSMase2 and shRab27a HEK293 cells. Graph, Quantification of mitochondrial cristae width (Mean). 
t-test: ***P-value<0.0001 (b) Graph, Basal oxygen consumption rate (OCR) of control, shnSMase2 
and shRab27a HEK293 cells. Dots represent mean from three independent experiments run in 
duplicate or triplicate. t-test, *P-value<0.05, ***P-value<0.0001. Chart, OCR from shControl, 
shnSMase2 and shRab27a HEK293 cells in response to oligomycin (Oligo), fccp, and rotenone plus 
antimycin A (Rot/AA). (n=2; mean ± S.E.M.) 
 
 71 
 
R
es
u
lt
s 
We next investigated the contribution of mitochondrial turnover and degradation 
mechanisms to the secretion of mitochondrial components in EVs. Macroautophagy, from 
here on referred to as autophagy, is a self-degradation process that recycles cellular 
constituents, including misfolded or aggregated proteins and damaged organelles 192. Confocal 
microscopy analysis did not reveal co-localization of autophagy proteins ATG5 and LC3 with 
MVBs or mitochondria (Figure R13).  
Figure R13. Colocalization of exosomal markers and autophagy proteins. Confocal co-
localization analysis in HEK293 cells co-transfected with ATG5-GFP or LC3-GFP (green) and a 
mitochondria-targeted fluorescent protein (mitoDsRed, red) and stained with the 
endolysosomal compartment markers HRS and LBPA (purple) and nuclei with HOECHST 58 
(blue). Right images show high magnification views of co-localization between ATG5/LC3 
(green) and the various endolysosomal markers (purple). Charts show the fluorescence profiles 
along the corresponding white lines in the adjacent panels. Bar, 10 mm. 
Serum deprivation, a reported autophagy stimulus, decreased exosome secretion 
concomitantly with reduced extracellular release of mitochondrial components (Figure R14a), 
consistent with the autophagy-promoted specific degradation of MVBs 193. Moreover, 
inhibition of autophagosome cargo degradation by bafilomycin-A1-mediated blockade of 
autophagosome-lysosome fusion did neither alter the detection of TFAM in the exosomal 
fraction nor the concentration and size of the purified EVs (Figure R14a and R14b). 
 72 
 
R
es
u
lt
s 
 
Figure R14. Autophagy is not responsible for the presence of mitochondrial content in 
exosomes (a) Western blot analysis of exosomes from Jurkat T cells left untreated, serum-
starved overnight or treated with bafilomycin A. Membranes were blotted for TFAM, CD81 and 
CD63. Graph, Nanoparticle concentration in the exosomal fractions (mean, two independent 
experiments). (b) Size distribution analysis by Nanoparticle Tracking Analysis (NTA) of purified 
exosomes obtained from equal numbers of Jurkat T cells left untreated, serum-starved 
overnight, or treated with bafilomycin A. 
This finding indicated that autophagosome secretion or content release upon bafilomycin-A1 
treatment does not account for the presence of mitochondrial components in EVs. 
Additionally, specific siRNA silencing of the late autophagy mediator LC3 in J77 T cells did not 
alter exosome concentration and mitochondrial content (Figure R15a and R15b). Together, 
these findings indicate that the loading and secretion of mitochondrial material in EVs occurs 
independently of general macroautophagy. 
 
 
 
 
 73 
 
R
es
u
lt
s 
 
Figure R15. Autophagy is not related with mitochondrial containing exosomes secretion (a) 
Western blot analysis of exosomes obtained from Jurkat T cells transfected with control or LC3 
siRNA. Graph, nanoparticle concentrations in the exosomal fractions (mean, n=2). Western 
blots are representative out of 3 independent experiments. (b) Size distribution analysis by 
Nanoparticle Tracking Analysis (NTA) of purified exosomes obtained from equal numbers of 
Jurkat T cells transfected with control siRNA or siRNA targeting LC3 from two independent 
experiments. 
6. DNA and mitochondrial proteins are transferred at cognate immune 
contacts 
The presence of mitochondrial constituents in exosomes led us to hypothesize that 
mitochondrial material could be transferred from the T cell to the APC during the formation of 
antigen-dependent contacts. To assess this, we first evaluated whether isolated exosomes 
shuttle mitochondrial components between cells. Purified exosomes from non-transfected J77 
T cells or cells stably transfected with a mitochondria-targeted fluorescent protein, mitoDsRed, 
were added to Raji B lymphoblastoid cells, used as APCs. After incubation with exosomes from 
J77mitoDsRed cells, recipient cells exhibited mitoDsRed fluorescence (Figure R16a).  
We next assessed whether exosomes can mediate intercellular mtDNA transfer. Donor 
and acceptor cell mtDNAs were distinguished by the use of conplastic mice with the same 
nuclear genome (C57BL/6) but different mtDNA haplotypes, from the C57BL/6 mice strain 
(C57C57) or from the NZB strain (C57NZB) 194.  These two mtDNA haplotypes differ in 12 missense 
polymorphisms identifiable by restriction length fragment polymorphism (RFLP) analysis 
(Figure R16b). Incubation of T cell-derived exosomes from C57C57 mice with DCs differentiated 
 74 
 
R
es
u
lt
s 
from the C57NZB mice resulted in uptake of C57C57 mtDNA by recipient C57NZB DCs, as shown by 
the acquisition of the C57C57 haplotype and the presence of C57C57 RFLP fragments in exosome-
treated DCs  (Figure R16c), supporting the transfer of mitochondrial components and mtDNA 
between cells through exosomes.  
 
Figure R16. Mitochondrial proteins and DNA are transferred through exosomes to DC. (a) 
Flow cytometry analysis of Raji B cells incubated overnight with exosomes from J77 T cells 
control or stably expressing mitoDsRed (Representative experiment, n=3). (b) RFLP analysis of 
the mitochondrial genomes of C57C57 and C57NZB mice. Total DNA is from C57C57 T lymphocytes 
and C57NZB BMDCs. C57C57 haplotype results in 2 fragments. Digestion of PCR products from 
C57NZB haplotype results in a single band. (c) RFLP detection of exogenous mtDNA in C57NZB 
DCs incubated overnight with increasing amounts of exosomes from C57C57 CD4+ T 
lymphoblasts. 414 pb and 250 pb fragments appear in C57NZB DCs upon addition of exosomes 
(lanes 1/3, 2/3 and 3/3). Chart, intensity profile of the RFLP analysis; arrows indicate the C57 
mtDNA haplotype. C57C57 CD4+ lane displays a band of 664 pb which corresponds to an 
uncompleted digestion of the PCR product in the RFLP analysis and a high exposure of the 
image. Representative experiment (n= 3). 
 75 
 
R
es
u
lt
s 
The mostly unidirectional nature of exosome transfer from T cells to DCs 55,132  
suggested that the exchange of mitochondrial information between immune cells occurs upon 
antigen-dependent contacts. TCR Vβ8+ J77 T cells expressing a mitochondria-targeted 
fluorescent protein (mitoYFP) or a fluorescent version of TFAM (TFAM-DsRed) were co-
cultured with Raji B cells preloaded with Staphylococcus enterotoxin superantigen-E (SEE), 
which mimics antigen recognition when confronted with TCR Vβ8+ T cells. Flow cytometry 
analysis revealed transfer of mitochondria (mitoYFP) and TFAM (TFAM-DsRED) from T cells to 
APCs during antigen-dependent interactions (Figure R17).  
 
Figure R17. Exosomal and mitochondrial proteins are transferred upon cognate interactions. 
Exosome and mitochondrial transfer to unpulsed or SEE-pulsed Raji B cells (CMAC) from J77 T 
cells expressing the exosomal protein CD63GFP, the mitochondria-targeted mitoYFP or the 
mtDNA-binding protein TFAM-DsRED. Dot plots, cell populations after co-culture. Red boxes 
enclose Raji B cells that have acquired exosomal or mitochondrial fluorescent markers 
(percentage from total Raji cells). Graphs, percentage of Raji B cells acquiring fluorescence 
upon IS formation from 3-5 independent experiments; mean, t-test *P-value<0.05, **P-
value<0.001, ***P-value<0.0001. 
To address this in primary cells, we set up a model of antigenic presentation in which 
bone marrow-derived DC (BMDC) from C57NZB mice presented OVA peptide to CD4+ T cells 
from transgenic OT-II mice (C57C57), which are specific for that antigen (Figure R18a) 194.  
 76 
 
R
es
u
lt
s 
After 16h co-culture in the presence or absence of OVA peptide, we detected CD4+ T 
cell mtDNA only in recipient APCs from co-cultures including OVA peptide antigen (Figure 
R18b), indicating that intercellular mtDNA transfer requires antigenic triggering. Using CD4+ T 
cells from OT-II C57NZB mice and BMDCs from the C57C57 mice, we confirmed that mtDNA 
transfer occurred unidirectionally from T cells to BMDCs (Figure R18c). 
 
Figure R18. mtDNA is transfer during immune synapses. (a) Workflow for mtDNA transfer 
detection by RFLP during immune cognate interactions. (b) Detection of exogenous C57C57 
mtDNA from donor OT-II CD4+ T cells in recipient C57NZB DCs upon antigen stimulation (OVA). 
Gels, RFLP analysis of the mitochondrial genomes (n=2). Chart, intensity profile for RFLP. (c) 
RFLP analysis of the mitochondrial genomes of C57C57 and C57NZB mice. Left gel shows RFLP 
analysis from C57C57 T lymphocytes and C57NZB DCs. Right gel, lack of exogenous C57C57 
mtDNA from donor DCs in recipient C57NZB CD4+ T cells. Chart, intensity profile for RFLP 
analysis. Representative experiment (n=3). 
 77 
 
R
es
u
lt
s 
7. Antiviral cGAS/STING-IRF3 pathway is activated upon exosome uptake 
Mitochondrial components are a major source of danger-associated molecular 
patterns (DAMPs). They can trigger innate immune responses, likely due to their similarities to 
bacterial ancestors 195. We hypothesized that the transfer of mitochondrial content and 
mtDNA during T cell-APC antigen-dependent contacts may represent a mode of cell-to-cell 
transmission of danger-associated messages. To examine this possibility, we interrogated 
which signaling pathways were controlled by T cell exosomes in recipient DCs. This was carried 
out by characterizing the changes to the gene profile of DCs upon incubation with T cell 
exosomes by RNA deep sequencing analysis (Figure R19).  
 
Figure R19. T cell exosomes prime DCs. Scheme explaining workflow for RNAseq analysis of 
DCs upon T cell exosome acquisition. Lower panel, RNAseq heat maps of 4 DC biological 
replicates with or without exosome uptake (DCs+EXO vs DCs). The panel shows upregulated 
(yellow) or downregulated (blue) genes with the highest significant fold changes. 
Gene expression profiling identified more than 1600 significantly altered genes in 
recipient DCs exposed to T cell exosomes (Figure R20a and R20b). Exosomes regulated the 
expression of a major set of genes involved in interferon (IFN) type I responses and antiviral 
activity, including IFN-stimulated genes (ISGs) Ifit1, Ifit2, Ifit3, Isg15, Usp18, and Cxcl10, and 
the antiviral signaling factors Gbp5 and Gbp6 (Figure R19a). We validated the RNA sequencing 
results by quantitative PCR for the genes Cxcl10, Isg15, Ifit1, Ifit3, Usp18, and Stat1 (Figure 
R20c). 
 78 
 
R
es
u
lt
s 
 
Figure R20. Bioinformatics analysis of the exosome-primed DC. (a) Principal Component 
Analysis (PCA) of the RNA samples obtained from 4 biological replicates of DCs and DCs 
incubated with exosomes. (b) Heatmap for the differently regulated genes in 4 biological 
replicates of DCs left untreated or treated with exosomes.  
Analysis of the genes that changed their expression profile in response to T cell 
exosomes by Gene Ontology annotation indicated they were mainly involved in IFN signaling, 
exogenous DNA and RNA sensing, bacteria and viruses recognition, and crosstalk between 
innate and adaptive immune cells (Figure R21a). These findings suggested that T cell exosomes 
prime the antiviral innate immune response in DCs, creating a gene signature that upregulates 
antiviral and antimicrobial responses to control pathogen infection and replication (Figure 
R21b).  
 
 
 
 79 
 
R
es
u
lt
s 
 
 
Figure R21. Pathogen defense pathways are upregulated in primed DC. (a) GO annotation of 
the biological processes differently regulated upon exosome addition; p-values are presented 
for the top-ranking biological processes. (b) Ingenuity analysis predictions of DC pathways 
upregulated or downregulated upon acquisition of T cell exosomes. 
One of the most relevant pathways involved in ISG expression depends on cGAS/STING 
interaction upon cytoplasmic detection of endogenous or exogenous DNA 196. cGAS functions 
as a main sensor of viral and bacterial DNA in the cytoplasm of infected cells. Upon its 
activation by DNA detection, it generates the second messenger cyclic dinucleotide cGAMP, 
which binds to and activates STING. STING in turn activates TANK-binding Kinase 1 (TBK1), 
which phosphorylates interferon regulatory factor 3 (IRF3) to promote its translocation to the 
nucleus, where it induces the expression of IFNγ and ISGs. Triggering of cytoplasmic DNA 
sensors is associated with intracellular clustering of STING 197. Consistent with activation of the 
cGAS/STING DNA sensing pathway, exosomes induced a significant aggregation of STING in 
DCs (Figure R22a). The expression of ISGs in response to exosomes was reduced in STING-
deficient (StingGt/Gt) DCs (Figure R22b), and completely abrogated in Irf3-/- DCs (Figure R22c).  
 80 
 
R
es
u
lt
s 
 
Figure R22. cGAS/STING DNA sensing pathway is partially responsible for the antiviral 
response signaling. (a) Upper panel, Immunofluorescence microscopy images showing STING 
aggregation (green) in DCs upon exosome addition. For clarity, DCs were stained for actin with 
phalloidin (purple) and for nuclei with HOECHST 58 (blue). Bar, 10 µm. Lower panel, 
Quantification of STING aggregate size and number upon exosome addition. Mean, n=26 
(control), n=35 (STING),  t-test ***P-value<0.0001 and ****P-value<0.00001 (b) Quantitative 
real-time PCR (qRT-PCR) of antiviral response genes in wild-type DCs and StingGt/Gt DCs upon 
exosome addition.  (c) qRT-PCR analysis of antiviral response genes in wild-type DCs and Irf3-/- 
DCs upon exosome addition. Data (d,f) show quantification of mRNA levels of a representative 
experiment with four mice per genotype: t-test *P-value<0.05, **P-value<0.001, ***P-
value<0.0001 and ****P-value<0.00001. 
8. Antiviral signaling is triggered at least partially by DNA contained in 
exosomes 
The role of exosomal DNA in triggering these responses was evaluated by treating 
exosomes with DNase. DNase treatment significantly reduced the ability of exosomes to 
trigger the activation of interferon-related genes in recipient WT DCs (Figure R23a), suggesting 
that the DNA located in the outer surface of exosomes is important for full induction of 
antiviral responses in recipient cells.  
 81 
 
R
es
u
lt
s 
To ascertain whether DNA located into the lumen of exosomes may also contribute to 
antiviral responses in recipient DCs, we genetically engineered a plasmid expressing DNase II 
fused to the intraluminal domain of the exosome-enriched protein CD63. qPCR analysis of 
isolated exosomes showed that exosomes from cells stably-expressing CD63-DNase II contain 
less mitochondrial DNA than exosomes from control cells stably-expressing wild-type CD63 
(Figure R23b). Exosomes from cells expressing CD63-DNase II triggered a lower antiviral 
response in recipient cells compared with exosomes obtained from CD63-expressing control 
cells (Figure R23c). Overall, these results support that DNA on the surface and the inside of T 
cell exosomes can act transcellularly, i.e. in recipient DCs, to prime antiviral responses through 
activation of the STING-IRF3 DNA-sensing pathway. 
 
Figure R23. DNA is partially responsible for the antiviral response signaling. (a) qRT-PCR analysis of 
antiviral response genes in wild-type DCs upon addition of exosomes left untreated or pre-treated 
with DNase. Data shows mean from three independent experiments. t-test *P-value<0.05. (b) The 
level of mtDNA assessed by PCR amplification in EVs obtained from the culture supernatant of 
human HEK293 cells overexpressing CD63GFP or CD63 fused to DNase II. Mean. n=3. (c) qRT-PCR 
analysis of Cxcl10 in hDCs upon addition of exosomes from CD63GFP or CD63GFP-DNase II 
overexpressing HEK293 cells. Data show four independent experiments obtained from the culture 
supernatant of human HEK293 cells overexpressing CD63GFP or CD63 fused to DNase II. Mean. n=4. 
 82 
 
R
es
u
lt
s 
9. DCs are primed by synaptic T-exosomes  
We next assessed whether antigen-driven T-APC contacts trigger antiviral responses in 
recipient cells through the transfer of exosomal components. Gene expression analysis 
revealed that DCs upregulated ISGs upon immune cognate interactions with OT-II CD4+T cells 
(Figure R24a). Control or SEE-pulsed Raji B cells were co-cultured with CD63GFP-expressing J77 
T cells and then sorted according to the level of GFP-labeled exosome uptake (Figure R24b). 
Raji B cells with higher acquisition of T cell exosomes showed more potent antiviral responses, 
as measured by their increased expression of Cxcl10 (Figure R24c), supporting that exosome 
transfer during antigen-driven immune contacts primes antiviral responses in DCs. 
 
Figure R24. Cognate interations induce antiviral response in DC. (a) qRT-PCR analysis of the 
DC antiviral response upon antigen-dependent contacts. Gene expression was analyzed in 
sorted DCs after 16h conjugate formation. Data shows mean from five independent 
experiments. t-test *P-value<0.05.  (b) Flow cytometry analysis of exosome uptake after co-
culture of J77 T cells stably expressing CD63GFP with unprimed or SEE-primed Raji B cells. After 
immune interactions, Raji B cells (CMAC) were sorted according to the level of exosome uptake 
(CD63GFP content). Dot plots show the GFP signal in pre-sort and post-sort Raji populations. 
(c) Chart shows qRT-PCR analysis of Cxcl10 in low and high exosome uptake SEE-primed Raji B 
cell populations. Mean. n=3. t-test *P-value<0.05. 
 83 
 
R
es
u
lt
s 
10. Primed DCs are more resistant to vaccinia infection  
To assess the effect of exosome-boosted antiviral responses in recipient cells, we 
incubated DCs with T cell exosomes, infected them with GFP-expressing recombinant vaccinia 
virus, and monitored virus spreading and infection. Pre-incubation of DCs with T cell exosomes 
reduced viral infection, as measured by the number of vaccinia-GFP-positive DCs (Figure R25).  
 
Figure R25. Exosomes protect primed DC against vaccinia. Upper panel, Time flow for the 
analysis of exosome-mediated antiviral protection. DCs were incubated for 4 h with T cell 
exosomes, infected with vaccinia-GFP, and analyzed for the level of infection by flow 
cytometry. Lower Left, Dot plots of DCs infected with vaccinia-GFP with or without exosome 
pre-treatment. Lower Right, Percentage of infected DCs at different viral loads with or without 
exosome pre-treatment. Mean; n=4; t-test *P-value<0.05, **P-value<0.01. 
 
 
 
 
 
 84 
 
R
es
u
lt
s 
Antigen-dependent interactions between DCs and CD4+ T cells increased protection 
against further vaccinia virus infection of the DCs (Figure R26a and R26c). This effect was 
dependent on T cell exosomes, since inhibition of their biogenesis by pretreatment of T cells 
with increasing concentrations of manumycin A, reduced DCs protection against subsequent 
viral infection (Figure R26b), without interfering significantly with T cell viability and activation 
(Figure R26c and R26d). Collectively, these results indicate that T cell exosomes delivered 
during antigen-dependent contacts boost inflammatory responses of DCs, protecting them 
against subsequent viral infection. 
 
Figure R26. Antigen-driven immune interactions prime DCs to pathogen infection. Figure 
legend on the next page 
 85 
 
R
es
u
lt
s 
Figure R26. Antigen-driven immune interactions prime DCs to pathogen infection. (a) Upper 
panel, Time flow for the analysis of exosome-mediated antiviral protection after immune 
cognate interactions. Unloaded or OVA peptide-loaded DCs were incubated for 4 h with 
CD4+OT-II T cells, infected with vaccinia-GFP, and analyzed for the level of infection by flow 
cytometry. Lower Left, Dot plots of DCs (gated on CD11c) infected with vaccinia-GFP in the 
presence or absence of OVA peptide. Lower Right, Percentage of infected DCs at different viral 
loads in the presence or absence of antigen-dependent immune contacts. Mean; n=3-6; t-test 
*P-value<0.05, **P-value<0.01, ***P-value<0.0001 (b) Unloaded or OVA peptide-loaded DCs 
were incubated for 4 h with CD4+OT-II T cells pretreated with increasing amounts of 
manumycin, infected with vaccinia-GFP, and analyzed for the level of infection by flow 
cytometry. Graph shows the ratio of infected DCs. Right graph, (c) Percentage of alive primary 
T lymphoblasts upon pre-treatment with increasing concentrations of manumycin for 2 h 
(vehicle = 0, 1 and 2.5 µM) and activation with OVA-pulsed dendritic cells for an additional 4 h 
period at a 5:1 ratio T cell: DCs. Manumycin was present during activation. Cell survival was 
measured by FACs, based on exclusion of DAPI staining. All values are relative to survival of 
non-treated cells. Mean percentage of T cell death was 13.8 % at maximal manumycin 
concentration. Data represent three independent experiments. (d) T lymphoblasts treated 
with manumycin for 16 h (vehicle = 0, 1 and 2.5 µM) and concomitant activation with anti-CD3 
and anti-CD28 monoclonal Abs were stained with anti-CD69 as a measure of T cell activation. 
Histograms show a representative experiment out of four. No significant changes were 
observed in CD69 levels. 
  
 86 
 
R
es
u
lt
s 
  
 87 
 
D
is
cu
ss
io
n
 
 88 
 
D
is
cu
ss
io
n
 
  
 89 
 
D
is
cu
ss
io
n
 
 Discussion 
Here we present evidence highlighting a new pathway for intercellular communication 
during immune cognate interactions. Exosomes are crucial mediators for cellular 
communication; however, the mechanisms underlying the exchange of information are still 
unclear. In this study, we describe an immune cellular mechanism where mtDNA and 
mitochondrial components are loaded into exosomes that elicit a response in the antigen-
presenting cell. The system for mitochondrial loading into multivesicular bodies is still 
undefined. We have shed light on how those two compartments influence functionally each 
other. In addition, our results show that upon non-related cognate encounters with T cells, 
primed dendritic cells are more resistant to viral infections. Knowledge of basic mechanisms 
that fine tune immune responses is relevant for future diagnostic and therapeutic applications.  
1. Mitochondrial material is loaded into a specific population of extracellular 
vesicles  
T cells secrete a great variety of EV. Depending on its origin they are classified in 
specific categories, i.e. microvesicles and exosomes. As previously mentioned, ILV are a mixed 
population of vesicles; when released by fusion of MVB with the plasma membrane the 
resulting exosomes are most likely a mixed population of vesicles with a common endosomal 
origin but different lipid and cargo composition 89,198.  
Vesicle heterogeneity is evident when exosome synthesis and secretion is induced; for 
example upon activation of CD4 T cell some vesicle subpopulations increase significantly more 
than the other subpopulations, which indicates that T cells differentially regulate the release of 
distinct vesicle subpopulations depending on their activation status 199. Inhibition of exosome 
release pathways does not affect all exosomal markers in the same way; for example Rab27 
silencing decreases the secretion of classical markers such as CD63 or Tsg101, however it does 
barely affect CD9 release 198. Genetic content of exosome subpopulations can vary as well; 
cancer cells secrete several types of exosomes and they differ on size and miRNA composition 
200. Moreover, vesicles secreted by the same polarized cell can vary depending on the 
subcellular localization where they are secreted 97–99,201. For example, vesicles from polarized 
epithelial cells have different densities and co-fractionate with different exosomal markers 
depending on basolateral or apical secretion which are independent mechanisms 97. Together, 
independent regulation of exosomal subpopulations and subcellular directed exosome 
secretion strongly suggests the existence of specialized mechanisms that control the selective 
 90 
 
D
is
cu
ss
io
n
 
sorting of cargo into these vesicles and the transport of specific MVB repertoires to the 
membrane.  
Taking into account that there are at least three mechanisms for ILV formation that act 
independently or coordinately, it is plausible that other mechanisms for vesicle formation exist 
and they are not yet described 80,202.  In Figure R4b and R6b we can observe a mild shift in the 
PCR product amplification and the proteins with mitochondrial origin respect from the classical 
exosomal markers. This may be due to slight differences in lipid composition between the 
mitochondrial-containing extracellular vesicles (mtExo) and vesicles containing classical 
markers which would change their density and thus their fractioning properties. In addition, 
there is only a partial colocalization of DNA and CD81 compared with complete co-localization 
for Tsg101 and CD81. These results suggest that although those populations share physical 
properties and their secretion is likely controlled by the MVB secretory pathway, they might 
differ in composition and probably in biogenesis. mtExo can be a subpopulation released by 
the fusion of MVB with the plasma membrane, but its origin could be different from the ILV 
which with they share space. They could even partially share lipid and protein composition and 
sucrose gradient could be insufficient to distinguish these two different populations.  
At any rate, we frequently term exosomes those vesicles that precipitate upon 
ultracentrifugation at 100.000g. This pellet is enriched in exosomes, but it also may contain 
other EV and protein aggregates 203. The greatest problem when studying EV is the difficulty in 
discriminating singular vesicles and in separating them in specific populations. Even when 
fractioning within a continuous band in the sucrose gradient, high density and low density 
subfractions from the “same” population differ in protein and RNA composition. Therefore, 
cells release distinct exosome subpopulations with unique compositions that elicit differential 
effects on recipient cells 204. New technology is required to study in depth the different 
exosomal populations; only with single vesicle analysis we will be able to dissect the 
heterogeneous mechanisms of exosome biogenesis and secretion. A proof of concept for 
single vesicle microscopy is performed with TIRF microscopy techniques which allow us to 
challenge cells and observe individually fresh obtained vesicles, and then to classify them into 
subpopulations depending on their protein composition. Combined with single vesicle 
cytometry 205 and Omic analysis those techniques give us extra information about vesicles, 
using key markers to sort and analyze these enriched fractions 203.  
 
 91 
 
D
is
cu
ss
io
n
 
We hypothesized that the selective secretion of mtExo is induced during T cell 
activation. This would imply that during cognate interactions an enriched population of 
exosomes containing mitochondrial components is secreted to the synaptic cleft achieving 
high concentration of vesicles in this confined space. This process makes possible a targeted 
delivery of exosomal components and the induction of a response in the antigen-presenting 
cell.   
2. Pathway for mitochondrial content harboring into multivesicular bodies: 
Mitochondrial derived vesicles 
Organelles are integrated into cellular networks regulating many cellular processes 
including metabolic interaction, intracellular signaling, cellular maintenance, regulation of 
programmed cell death/cell survival, and pathogen defense 206. Apart from cytoskeleton, 
membrane contacts organize the position and motility of organelles. Examples of organelle 
interaction are mitochondria and endoplasmic reticulum contact sites (MERCs) 207, 
mitochondria and peroxisomes 208, mitochondria and lysosomes and autophagosomes 209,210. In 
addition, the endosomal system directly interacts with mitochondria 211–214. These contacts are 
dependent on Drp1, a mitochondrial fission protein present in both organelles 209. However, 
there is still much to know about these complex networks.  
We have found that mitochondria and multivesicular bodies are tightly linked, since 
disruption of the endosomal pathway also impairs mitochondrial homeostasis. Specifically, 
there is an increase in mitochondrial mass and in ROS, and a decrease in mitochondrial 
OXPHOS. In addition, when a constitutively active isoform of Rab7 was expressed in cells we 
detect a great accumulation of mitochondrial components inside the enlarged late endosomes. 
Moreover, we observe a preferential co-localization of mitochondrial proteins with 
components of the late stages of endosomal pathway. When cells are challenged with the 
uncoupler FCCP, that causes mitochondrial damage, we detect a higher localization of 
mitochondrial components within late endosome than within early endosomes. Our 
observation that mtDNA and mtDNA-binding proteins load into EVs in an autophagy-
independent manner indicates the existence of an additional targeting mechanism to the MVB. 
The role of mitochondrial component release as a danger indicator to surrounding cells is well 
documented 195.  
 
 
 92 
 
D
is
cu
ss
io
n
 
Our data suggest that the MVB endosomal route can target these components actively 
into exosomes. Although the signals that mediate the loading and incorporation of 
mitochondrial components into late endosomes/MVBs remain unidentified, an attractive 
possibility is that small organelle fragments containing mitochondrial nucleoids might bud 
toward the cytosol depending on their oxidative status, and would be subsequently loaded and 
incorporated into the endolysosomal compartment for their degradation or secretion. 
Cytosolic accumulation of mtDNA has been described following mitochondrial dysfunction and 
inflammatory stimulation 195,215, and a similar process may operate in the release of mtDNA to 
the cytoplasm and its subsequent incorporation into ILVs during MVB maturation.  
Mitochondria is a highly compartmentalized organelle; release of mitochondrial 
components into the cytosol usually involves strong signaling in cells in an autologous manner 
167. Loss of mitochondrial permeability leads to Cytochrome c release and Caspase activation 
that ends in apoptosis; it is likely that mitochondrial loading into ILV is mediated by a highly 
regulated mechanism that protects the secreting cell from signaling of free mitochondrial 
content in cytosol 216.  
Alternatively, we propose that mitochondrial cargo is delivered into MVB through a 
relatively new described mechanism. This system does not require mitochondrial 
depolarization, autophagy signaling or mitochondrial fission 217 and it would be a safe way to 
deliver dangerous material without damaging the secreting cell. It has been recently shown 
that small vesicles, called mitochondrial-derived vesicles (MDV), with a size ranging between 
60-100nm bud out from mitochondria. MDV connect mitochondria with other organelles and 
transport mitochondrial components into lysosomes, peroxisomes and MVBs. MDV are 
essential for the correct homeostasis of mitochondria and help to get rid of unwanted material 
that can damage the organelle 218,219. PINK1 and Parkin are some of the described proteins 
involved in the formation of MDV 220. We postulate that they might participate in the loading 
of mitochondrial components into exosomes by fusion with MVB 217,221 and instead of being 
degraded by lysosomes, MVB could fuse with plasma membrane release a mix of bona fide 
exosomes together with MDV (Figure D1).  
However, we found that the loading of mitochondrial cargo into exosomes is independent 
of autophagy. In the same manner, MDV transport to lysosomes is ATG5 and LC-3 independent 
217, which would support that even silencing autophagy MDV fuse with MVB and mtExo are still 
secreted.  
 93 
 
D
is
cu
ss
io
n
 
This model would also explain why we detect separate vesicles containing DNA or 
exosomal markers such as CD81 by TIRF microscopy. Considering their similarity in size and 
their endosomal pathway dependence, we can be obtaining two different populations of 
vesicles in our samples and mixing them due to the lack of resolution of current available 
techniques.  
 
Figure D1. Proposed model for mitochondrial cargo loading into MVB. Mitochondrial-derived 
vesicles are extruded from mitochondria carrying oxidized cargo (in red) and unfolded 
proteins. After they fuse with late endosomes MDV release their single membrane cargo into 
MVB. After maturation MVB fuse with plasma membrane secreting single-membrane MDV and 
bona fide exosomes to the extracellular media. 
3. Physiological cause for mtDNA release in exosomes 
Exosomes were first described in reticulocytes54,222; initially they were proposed to 
represent cellular waste 223. Nowadays, it is clear that apart from being and alternative way of 
releasing waste product they are essential for maintaining cellular homeostasis and for cell-cell 
communication 56,104. We have addressed the role of mitochondrial-containing extracellular 
vesicles in the T cell-DC interaction; however, there are still several unknown issues in the 
secretion of mitochondrial content at the T cell side.  
In some specific cases, mitochondrial transfer allows the exogenous replacement of 
damaged mitochondria, thereby rescuing mitochondrial defects 154. However the effects of 
mitochondrial release in the secreting cell is not totally understood. The dynamics of 
mitochondrial networks and their selective degradation or biogenesis maintain a healthy 
mitochondria repertoire. Constant cycles of fusion and fission promote the intermixing and 
 94 
 
D
is
cu
ss
io
n
 
homogenization of mitochondrial proteins, lipids and DNA between discrete organelles within 
the same cell 151. The selective depletion of mitochondria through mitophagy eliminates 
deleterious mitochondrial mutations in heteroplasmic cells, restoring ATP levels and 
mitochondrial function 224–226.  Therefore cells need ways to get rid of damaged mitochondrial 
material. Mitophagy requires several cell resources and it is an energy consuming process once 
activated. Even though mtDNA can be degraded by the replication machinery 227 o by 
autophagy 228, there are other mitophagy/autophagy-independent pathways for degrading the 
damaged mtDNA that are still elusive. Moretton and colleagues described that there is a rapid 
loss of mtDNA upon a massive double strand break in mitochondrial genome which is neither 
dependent of exo/endonucleases nor autophagy 229. The mode of mtDNA degradation may be 
determined by the cell type and oxidative stress 230. Releasing damaged or aged mtDNA 
through the endosomal secreting pathway can be an appealing system to release stress or 
mtDNA double strand breaks without the need of starting a mitophagy program. Indeed, 
genomic DNA damage increases exosome secretion in a p53 and TSAP6-dependent manner 231. 
Retention of damaged and oxidized mitochondrial components into the mitochondria is 
extremely harmful for cell homeostasis. Degradation of mitochondria by autophagy represents 
an extreme attempt to maintain cell homeostasis, although there are other mechanisms to 
maintain mitochondrial quality control in steady state or mild damage. Mitochondrial cargo 
release through MDV can be a way for releasing stress and protect cells from entering in 
mitophagy 219. Therefore, exosome secretion could be a pathway for cell stress relieve 232. As a 
matter of fact, there are more exosomes in the plasma of virus-infected individuals, where 
mitochondrial proteins are overrepresented and that contain markers of metabolic and 
mitochondrial stress 233. Our results demonstrating the presence of oxidized DNA in exosomes 
suggest that these EVs may cooperate to manage cellular damage by releasing mitochondrial 
proteins and oxidized-DNA, acting as an “escape valve” to partially expel mitochondrial 
damage outside the cell. Recently, a role for exosomes in the secretion of harmful genomic 
DNA has been documented 104. Damaged mtDNA is loaded in exosomes of epithelial cells and 
released to the extracellular media 234. Supporting this role for exosomes in the preservation of 
cellular homeostasis235, we found that inhibition of exosome biogenesis or secretion impair 
mitochondrial structure and function. A recent study identified that under stress conditions 
Caenorhabditis elegans secretes large vesicles containing protein aggregates and organelles for 
maintaining mitochondrial homeostasis and quality control 236. Upon cell stress, MDV are 
preferentially loaded with oxidized cargo; the presence of oxidized mtDNA in exosomes also 
supports that this subpopulation of vesicles comes from a MDV origin and helps mitochondria 
homeostasis (Figure D1) 237. 
 95 
 
D
is
cu
ss
io
n
 
Our working hypothesis is that mtExo are used as a signal to alert about the status of 
the donor cell to the surrounding cells by playing a dual role; on one hand, protecting the 
donor cell from mitochondrial dysfunction and, on the other hand, alerting receptor cells from 
a potential damage in the local environment. Whereas exosomes facilitate the secretion of 
harmful or damaged mitochondrial components and sustain mitochondrial function is a 
possibility that warrants further investigation. 
4. Functional mtDNA delivery in antigen presenting cells  
The immune synapse only covers the 20% of cell membrane and still it is a platform for 
cellular communication; clear examples are receptor signaling, cytokine secretion and induced 
cytolysis. There is no need for high amounts of messenger secretion to mount a response in 
the receptor cell. The encapsulation of signaling molecules inside the synaptic cleft allows 
reaching relative high concentrations of molecules that can trigger the signaling. Exosomal 
secretion inside the synaptic cleft grants high relative levels of EV per surface, which probably 
makes possible the induction of complete antiviral responses in the APC. However, the 
functional delivery of exosomal cargo into receptor cells is still not fully studied. 
 Exosomes allow functional delivery of genetic material to receptor cells. Specifically, 
miRNAs loaded in exosomes reach acceptor cells and repress target mRNAs 55,113. In addition, 
cells can also secrete genomic DNA that is uptaken by recipient cells and translocated to the 
nucleus where it recruits nuclear factor κB (NF-κB), and is transcribed. In agreement with our 
data, DNA was shown to be within the exosomes rather than exposed outside 238. 
Furthermore, genomic DNA delivery is functional since the exosomal delivery of the mutated 
gene H-Ras stimulates proliferation in recipient cells 239. Finally, mitochondrial genes have 
been reported to be transferred through vesicles 234,240. Although widely observed in 
prokaryotes, horizontal gene transfer (HGT) is in general a rare phenomenon in metazoans. 
However, HGT in eukaryotes might be less rare than previously anticipated 241. HGT between 
species of Saccharomyces has been postulated during the evolution of modern yeast species 
242. Likewise, asexual bdelloid rotifers have experienced extensive HGT from non-metazoan 
genes 243, which might have compensated the lack of genetic heterogeneity due to the absence 
of sexual recombination 244. One interesting example is the horizontal transfer of entire 
genomes via mitochondrial fusion in the angiosperm Amborella. Specifically, Amborella mtDNA 
includes a diverse collection of foreign sequences corresponding to about six genome 
equivalents of mtDNA acquired from mosses, angiosperms and green algae 245. One of the first 
evidence of in vivo horizontal mitochondrial gene transfer was found in a transmissible canine 
venereal tumor (CTVT), which is a highly adapted form of cancer that is transmitted as an 
 96 
 
D
is
cu
ss
io
n
 
allograft during mating of feral dogs. Phylogenetic evidence supports that CTVT cells 
periodically acquire mitochondria from their hosts to support long-term survival. Gene transfer 
events might rescue CTVT mitochondrial function, allowing the tumor to overcome the high 
mutation rate that would promote the accumulation of deleterious mutations in their own 
mitochondria 246. 
Transfer of entire mitochondria between cells or acquisition of mitochondria from the 
environment in a functional and transmissible way has been demonstrated in culture cells 
152,247,248, and in vivo in a cancer context 157,246,249. Recent reports suggest that the intercellular 
transmission in vivo of mitochondria and/or mitochondrial components exerts a beneficial 
effect on the recipient damaged cells 153–155. The benefits in all cases are attributed to the 
assumption that entire healthy functional mitochondria travel and colonize the recipient cells. 
However, the use of interspecies mix for donor cells in some cases and the lack of evidence of 
long lasting colonization of the recipient cells by the foreign mtDNA question this 
interpretation. The role of the intercellular transmission of defined mitochondrial components 
and specifically mtDNA as part of a complex intercellular signaling mechanism, raises the 
possibility that the observed beneficial effects of transmission of mitochondrial components 
would be consequences of activation of survival pathways rather than the transmission of fully 
functional organelles able to colonize the recipient cells. This could, for instance, explain the 
positive effects of interspecies (human/mice) experiments, since the interspecies 
incompatibility between nuclear and mtDNA is well described. In this study, we have shown 
that mtDNA is completely represented in the exosomal fraction, although we have not clarified 
the integrity of this genetic material. Our results indicate that there is a functional delivery of 
mtDNA to recipient cells upon cognate interactions. Interestingly, this transfer occurs in an 
unidirectional manner, from the T cell side to the APC side, as it was previously reported with 
other exosomal markers 55. Nonetheless, we do not address whether whole mitochondria are 
transferred and whether this exchange could restore impaired mitochondrial respiration. Due 
to the size of exosomes and the minimal dimension of a functional mitochondrion it is not 
probable that entire functional units are transferred. However, if complete copies of mtDNA 
integrate in the mitochondria of receptor cells, it could be sufficient to replicate and restore 
respiration and mitochondrial functions. In fact, horizontal transfer of mtDNA occurrs in cancer 
cells, associated with increased self-renewal potential of these cells and tumor-initiating 
efficacy 157. Cancer-stem like cells secrete extracellular vesicles carrying full mitochondrial 
genome, which induces exit from metabolic dormancy of other tumor cells 240. Nevertheless, 
authors did not characterize properly the EV, which are probably are bigger vesicles than 
 97 
 
D
is
cu
ss
io
n
 
exosomes, such as microvesicles. In other study, using an ImageStream imaging flow 
cytometer for single particle analysis, different sized extracellular vesicles from 
bronchoalveolar lavage contained mitochondrial components that were delivered and 
internalized into the mitochondrial network from the receptor cells and changed their pro-
inflammatory function 234,250. Islam and colleagues have described that mitochondria are 
transferred from bone-marrow-derived stromal cells to pulmonary alveoli in a connexin 43-
dependent manner 155. In addition, connexin 43 located in exosomes forming hexameric 
channels, facilitate the delivery of heterologous DNA and the exosomal uptake by target cells 
115. Together, these results reveal a possible mechanism for functional DNA delivery to the 
target cell where DNA could change its metabolic pattern or trigger inflammatory signalling. 
The mechanisms determining whether DNA is degraded, exported to the cytosol or integrated 
in the corresponding organelle are still elusive.  
Finally, we describe a mouse system comprising two different haplotypes that can be 
differentiated by RFLP which is a suitable model for tracking mitochondrial effective transfer 
trace back. This model can be used for many exosomal transfer applications; it would be 
interesting to ascertain whether in a heteroplasmic cell an haplotype is predominantly selected 
and if the other is secreted via exosomes as a way to releas stress 194,251,252. Finally, it would be 
interesting to deep in the transfer of healthy mtDNA to dendritic cells containing damaged 
DNA and study whether a healthy phenotype is recover or not. Thus, a clear understanding on 
the mechanisms mediating mitochondrial transmission will shed light on how mitochondrial 
transfer is regulated and can be exploited for therapeutic purposes. 
5. Antiviral response induction upon exosome uptake in dendritic cells 
Our results show the specificity of the type of cellular response evoked by the DNA packaged 
into EVs: type I IFN response and expression of ISGs. Although nuclear DNA is the main 
endogenous ligand for cGAS, growing evidence indicates a role for mtDNA as a ligand for cGAS 
in certain conditions. Mitochondrial DNA as well as other mitochondrial constituents such as 
N-formyl peptides (NFPs), mitochondrial lipids such as cardiolipin, or nuclear-encoded 
mitochondrial proteins, can elicit a local or systemic innate immune response in conditions of 
massive episodes of cell damage 195. Intriguingly, mtDNA can also be released in a rapid, 
'catapult-like' manner by neutrophils to create ‘extracellular traps’ that exert antibacterial 
activity and activate the release of pro-inflammatory cytokines 176,253. In this regard, secretion 
of interferogenic mtDNA by neutrophils in systemic lupus erythematosus (SLE) patients 
contributes to disease by activating the production of potent IFN type I responses 173,254. 
 98 
 
D
is
cu
ss
io
n
 
Likewise, lymphocytes eject interferogenic mtDNA webs in response to CpG and triggers 
antiviral signaling in monocytes 255 
The Intracellular accumulation of mtDNA molecules in the cytosol upon mtDNA stress 
has been also shown to activate type I IFNs response through the cGAS/STING pathway 167, 
contributing to the acquisition of an antiviral state. Our results demonstrate that in DCs, the 
DNA present in EVs activate type I IFN responses and expression of ISGs. The contribution of 
cytoplasmic sensors, e.g. STING, appears to be only partial, and other DNA receptors localized 
at the endosome or the plasma membrane could also detect the DNA present on the surface 
or the lumen of EVs and activate interferon-response factors, thus contributing to the 
induction of a potent antiviral response. Then, understanding which sensors or receptors 
detect the DNA transported in EVs; and whether the mechanisms (endocytosis, phagocytosis, 
back-fusion of endosomes) by which vesicular content is acquired by recipient cells affect DNA 
responses are questions that deserve further investigation. In this study, we have found that 
the DNA-sensing responses were abrogated in an IRF3-dependent manner. Also, elimination of 
exosomal DNA, either by DNase treatment or overexpression of DNase II fused to the 
intraluminal domain of the exosome-enriched protein CD63, significantly reduced the 
expression of antiviral related genes. However, we cannot rule out the contribution of other 
EVs constituents in triggering innate immune signaling in DCs. For example, Tfam serves as a 
danger signal that augments DNA signaling in plasmacitoid dendritic cells 256. Another 
possibility is that mtDNA present in vesicles signals through different pathways; specifically, 
mtDNA associates with Z-binding protein (ZBP1), which recruits the TANK-binding kinase 1 
(TBK1) and interferon regulatory factor 3 (IRF3). Those factors migrate to the nucleus and 
activate an inflammatory response in a STING independent manner 234. Finally, vesicles 
containing mtDNA can also activate other pathways such as the inflammasome 257. Therefore, 
signaling coming from mtExo are most likely conformed by mixed pathways that overall display 
a combined inflammatory response 
 
 
 
 
 
 99 
 
D
is
cu
ss
io
n
 
6. Physiological purpose of DC priming 
Besides the well-characterized role of IS in instructing T cell activation, it also transmits 
intracellular signals to the DC side 258. Upon IS formation, the DC rapidly increases the 
concentration of MHC class II molecules on the membrane of the synaptic contact to 
strengthen antigen presentation to cognate T cells 259,260. DC cytoskeleton undergoes 
substantial rearrangements during IS formation, allowing the polarization of different 
compartments such as endosomes and mitochondria 141. MTOC relocation also grants 
polarized cytokine secretion 261.  
The establishment of immune cognate interactions between T cells and APC is a key 
element of T cell activation, i.e. the conversion of naive T cells into effector cells, leading to the 
efficient clearance of pathogens through the adaptive arm of the immune response. This study 
demonstrates that this signal displays retrograde feedback, in which the T cell imposes 
additional changes to the activity of the APC, priming those post-synaptic DC (psDC) to 
respond better in the case of subsequent infections by the same pathogen, or a similar one. 
We have also identified EVs as the vessels of the information that triggers these changes in 
DCs, promoting an antiviral response with induction of IFN-related stimulated genes. A key 
observation is that these effects require antigenic stimulation. This is crucial because it ensures 
that the acquisition of inflammatory (or antiviral) traits is limited to situations in which a 
specific stimulus, i.e. the pathogen, is triggering these responses. It also has the potential to 
drastically alter the fate of the DC. DC supposedly die in lymph nodes after cognate 
interactions. This is based on evidence of the onset of autoimmune disease when DC apoptosis 
is inhibited 262. We postulate that, even if DC are eliminated after activating naive T cells in an 
antigen specific-dependent manner, T cell exosomes could salvage the psDC by reverting the 
onset of the apoptotic program. This is consistent with the observation that DCs receive pro-
survival signals after IS formation, reducing the percentages of apoptosis in vitro and in vivo 
263. Hence, the reported disappearance of DC from the lymph nodes after the IS 264 could be 
explained due to their programmed cell death but also due to their migration to other tissues, 
particularly if they have been fine-tuned by T cell exosomes. In fact, DC can live for 15 days in 
the lymph node after an immune challenge, and are able to present antigens ex vivo to CD4+ T 
cells 265. There is scant evidence of this type of priming, but some indirect evidence points to 
the potential importance of this mechanism. For example, tissue-resident memory T cells 
(TRM) have been shown to allow superior protection to homologous infection compared to 
circulating memory T cells. These TRM can become instructors of innate immune system by 
initiating a local anti-viral state after reinfection that depends on the secretion of pro-
 100 
 
D
is
cu
ss
io
n
 
inflammatory cytokines such as TNF, IL-2 or IFN-γ that rapidly initiate an innate immune 
response in the infected tissues 266–268. These experimental observations suggest the existence 
of cross-priming elements that are transferred by the exposure to one pathogen to improve 
the response against other pathogens. Hence, it is tempting to speculate a role for exosomes 
and DNA transfer in this enhanced anti-viral protection exerted by tissue-resident memory T 
cells. 
The mechanism proposed here would function as a mechanism of innate memory, 
adapting the DC response during antigenic challenge. Obviously, DCs do not bear genetic 
mechanisms to modulate their ability to recognize antigens similar to the recombination 
observed in B cells and T cells. However, increasing evidence has demonstrated that DCs and 
macrophages bear long-lasting modifications to their epigenetic status after infection or 
vaccination, leading to enhanced responsiveness upon secondary stimulation by microbial 
pathogens, increased production of inflammatory mediators and enhanced capacity to 
eliminate infection 269. We propose that T cell exosomes are powerful DC reprogramming tools 
that enhance the adaptation of the innate cell against the pathogen. Although this is obviously 
a short-ranged mechanism, the delivery of T cell exosomes to circulating fluids and their 
subsequent capture by distant APC could play a significant role in boosting vaccination and the 
induction of long-distance preparation against infection. 
7. Concluding remarks 
In summary, this study provides a physiological mechanism for the transfer of 
mitochondrial components and genome transfer in the context of immune cognate 
interactions, laying the foundation of a model in which the transfer of DNA between immune 
cells constitutes a signal-dependent mechanism for alerting responses in innate immune cells. 
We postulate that mitochondrial components are loaded into MVB of T cells during activation 
or a stress situation. Those components are released in exosomes-like vesicles to the synaptic 
cleft when MVB fuse with plasma membrane and they are uptaken by the DC. mtDNA 
contained in those vesicles triggers a transcriptomic remodeling through the cGas/STING 
pathway. The main affected genes in primed DC are those from pathogen defense pathways, 
specifically the antiviral response. Consistently, primed DC are more protected against vaccinia 
infection in vitro (Figure D2).  
 
 101 
 
D
is
cu
ss
io
n
 
 
Figure D2. Proposed model for the experimental conclusions. T Lymphocytes load 
mitochondrial components into ILV of the MVB. Vesicles are released during cognate 
interactions and mtDNA is incorporated in DC where it triggers antiviral signaling through the 
cGAS/STING pathway.  Due to this interaction primed DC are more protected against further 
pathogen infections.   
Although there are many aspects of our research where more investigation is needed, 
this study opens a very interesting field. During many years DC were supposed to present 
antigens and once their mission was accomplished they died 262. However data show that upon 
antigen-driven contacts DC induce pro-survival signals, have lower percentages of apoptosis 263 
and they can live for more than 15 days after the interaction in the lymph node 264.  In 
addition, their mitochondria cluster and local autophagy is induced with homeostatic purposes 
141. Finally, our data show that upon cognate interaction psDC acquire an antiviral program and 
they are more protected. Those data are supported by a study where it is shown that this also 
happens in DC in vivo 270. Even if after immune synapse many DC die, some of these  post-
synaptic Dendritic Cells  activate a program that improves their performance 271.  
 102 
 
D
is
cu
ss
io
n
 
This specific repertoire of cells could have a role in subsequent infections and there is 
an exciting new field of study that probably can unveil new modes to improve vaccination and 
fight against infective diseases.  
 
 103 
 
C
o
n
cl
u
si
o
n
s 
 
 
  
 104 
 
C
o
n
cl
u
si
o
n
s 
 
  
 105 
 
C
o
n
cl
u
si
o
n
s 
Conclusions 
The findings presented herein support the following conclusions:  
 
1. Exosomes isolated from T Lymphocytes are loaded with a repertoire of mitochondrial 
proteins where mitochondrial DNA binding proteins are enriched.  
 
2. T Lymphocytes shuttle genomic and mitochondrial DNA in exosomes. DNA in 
exosomes is partially oxidized and it is only present in a specific exosomal 
subpopulations. 
 
3. Mitochondrial proteins and DNA segregate into multivesicular bodies and the 
exosomal secretory pathway to reach exosomes. 
 
4. Biogenesis and Release of exosomes regulate mitochondrial function and homeostasis. 
 
5. Mitochondrial proteins and DNA are transferred from T cells to dendritic cells in a 
unidirectional manner during immune synapsis.  
 
6. DNA contained in exosomes activates the expression of antiviral genes through 
cGAS/STING-IRF3 pathway in dendritic cells due to exosome uptake. 
 
7. Synaptic exosomes secreted by T cells during cognate interactions prime dendritic cells 
and protect them against subsequent viral infections.  
 
 106 
 
C
o
n
cl
u
si
o
n
es
 
 
 
 
 
  
 107 
 
C
o
n
cl
u
si
o
n
es
 
 
  
 108 
 
C
o
n
cl
u
si
o
n
es
 
  
 109 
 
C
o
n
cl
u
si
o
n
es
 
Conclusiones 
Los resultados presentados en esta tesis apoyan las siguientes conclusiones:  
 
1. Los exosomas provenientes de linfocitos T contienen proteínas mitocondriales 
entre las que se encuentran especialmente  enriquecidas las proteínas de unión a 
ADN mitocondrial.  
 
2. Los exosomas secretados por los linfocitos T están cargados de ADN genómico y 
mitocondrial. El ADN de los exosomas está parcialmente oxidado y sólo está 
presente en una subpoblación específica de exosomas. 
 
3. Las proteínas mitocondriales y el ADN se acumulan en cuerpos multivesiculares y 
de esta manera llegan a los exosomas. 
 
4. La biogénesis y liberación de exosomas regulan la homeostasis y la función 
mitocondrial. 
 
5. Las proteínas y El ADN mitocondriales se transfieren de los linfocitos T a las células 
dendríticas de una manera unidireccional durante la sinapsis inmune.  
 
6. El ADN contenido en los exosomas activa la expresión de los genes antivirales a 
través de la vía cGAS/STING-IRF3 en las células dendríticas cuando estas captan e 
incorporan los exosomas de los linfocitos. 
 
7. Los exosomas secretados por las células T durante la sinapsis inmune pre-activan a 
las células dendríticas y las protegen contra infecciones virales posteriores.  
  
 110 
 
C
o
n
cl
u
si
o
n
es
 
 
  
 111 
 
R
ef
er
en
ce
s 
  
 
  
 112 
 
R
ef
er
en
ce
s 
  
 113 
 
R
ef
er
en
ce
s 
References 
1. Abbas, A. K., Lichtman, A. H., Pillai, S. & Preceded by: Abbas, A. K. Cellular and 
molecular immunology. (2017). 
2. Dustin, M. L. & Choudhuri, K. Signaling and Polarized Communication Across the T Cell 
Immunological Synapse. Annu. Rev. Cell Dev. Biol. 32, 303–325 (2016). 
3. Monks, C. R., Freiberg, B. A., Kupfer, H., Sciaky, N. & Kupfer, A. Three-dimensional 
segregation of supramolecular activation clusters in T cells. Nature 395, 82–86 (1998). 
4. Cai, E. et al. Visualizing dynamic microvillar search and stabilization during ligand 
detection by T cells. Science (80-. ). (2017).  
5. Kim, H. R. et al. T cell microvilli constitute immunological synaptosomes that carry 
messages to antigen-presenting cells. Nat. Commun. (2018).  
6. Wülfing, C., Sjaastad, M. D. & Davis, M. M. Visualizing the dynamics of T cell activation: 
intracellular adhesion molecule 1 migrates rapidly to the T cell/B cell interface and acts 
to sustain calcium levels. Proc. Natl. Acad. Sci. U. S. A. 95, 6302–7 (1998). 
7. Robles-Valero, J. et al. Integrin and CD3/TCR activation are regulated by the scaffold 
protein AKAP450. Blood 115, 4174–4184 (2010). 
8. Comrie, W. A., Babich, A. & Burkhardt, J. K. F-actin flow drives affinity maturation and 
spatial organization of LFA-1 at the immunological synapse. J. Cell Biol. (2015).  
9. Van Der Merwe, P. A. & Dushek, O. Mechanisms for T cell receptor triggering. Nature 
Reviews Immunology (2011).  
10. Valitutti, S., Dessing, M., Aktories, K., Gallati, H. & Lanzavecchia, A. Sustained signaling 
leading to T cell activation results from prolonged T cell receptor occupancy. Role of T 
cell actin cytoskeleton. J. Exp. Med. 181, 577–84 (1995). 
11. Lee, K.-H. et al. T Cell Receptor Signaling Precedes Immunological Synapse Formation. 
Science (80-. ). 295, 1539–1542 (2002). 
12. He, H.-T. & Marguet, D. T-cell antigen receptor triggering and lipid rafts: a matter of 
space and time scales. Talking Point on the involvement of lipid rafts in T-cell activation. 
EMBO Rep. 9, 525–530 (2008). 
13. Grakoui, A. et al. The immunological synapse: a molecular machine controlling T cell 
activation. Science 285, 221–7 (1999). 
14. Varma, R., Campi, G., Yokosuka, T., Saito, T. & Dustin, M. L. T cell receptor-proximal 
signals are sustained in peripheral microclusters and terminated in the central 
supramolecular activation cluster. Immunity 25, 117–127 (2006). 
15. DeMond, A. L., Mossman, K. D., Starr, T., Dustin, M. L. & Groves, J. T. T cell receptor 
microcluster transport through molecular mazes reveals mechanism of translocation. 
Biophys J 94, 3286–3292 (2008). 
 
 114 
 
R
ef
er
en
ce
s 
16. Yi, J., Wu, X. S., Crites, T. & Hammer  3rd, J. A. Actin retrograde flow and actomyosin II 
arc contraction drive receptor cluster dynamics at the immunological synapse in Jurkat 
T cells. Mol Biol Cell 23, 834–852 (2012). 
17. Ilani, T., Vasiliver-Shamis, G., Vardhana, S., Bretscher, A. & Dustin, M. L. T cell antigen 
receptor signaling and immunological synapse stability require myosin IIA. Nat Immunol 
10, 531–539 (2009). 
18. Freiberg, B. A. et al. Staging and resetting T cell activation in SMACs. Nat Immunol 3, 
911–917 (2002). 
19. Sykulev, Y., Joo, M., Vturina, I., Tsomides, T. J. & Eisen, H. N. Evidence that a single 
peptide-MHC complex on a target cell can elicit a cytolytic T cell response. Immunity 4, 
565–571 (1996). 
20. Benvenuti, F. et al. Requirement of Rac1 and Rac2 expression by mature dendritic cells 
for T cell priming. Science (80-. ). 305, 1150–1153 (2004). 
21. Al-Alwan, M. M. et al. Cutting edge: dendritic cell actin cytoskeletal polarization during 
immunological synapse formation is highly antigen-dependent. J Immunol 171, 4479–
4483 (2003). 
22. Al-Alwan, M. M., Rowden, G., Lee, T. D. & West, K. A. The dendritic cell cytoskeleton is 
critical for the formation of the immunological synapse. J Immunol 166, 1452–1456 
(2001). 
23. Mayya, V. et al. Durable Interactions of T Cells with T Cell Receptor Stimuli in the 
Absence of a Stable Immunological Synapse. Cell Rep 22, 340–349 (2018). 
24. Martín-cófreces, N. B., Vicente-manzanares, M. & Sanchez-Madrid, F. Adhesive 
Interactions Delineate the Topography of the Immune Synapse. 6, 1–10 (2018). 
25. Martin-Cofreces, N. B. & Sanchez-Madrid, F. Sailing to and Docking at the Immune 
Synapse: Role of Tubulin Dynamics and Molecular Motors. Front Immunol 9, 1174 
(2018). 
26. Fritzsche, M. et al. Cytoskeletal actin dynamics shape a ramifying actin network 
underpinning immunological synapse formation. Sci Adv 3, e1603032 (2017). 
27. Huse, M., Lillemeier, B. F., Kuhns, M. S., Chen, D. S. & Davis, M. M. T cells use two 
directionally distinct pathways for cytokine secretion. Nat Immunol 7, 247–255 (2006). 
28. Martin-Cofreces, N. B. et al. MTOC translocation modulates IS formation and controls 
sustained T cell signaling. J Cell Biol 182, 951–962 (2008). 
29. Kupfer, A. & Dennert, G. Reorientation of the microtubule-organizing center and the 
Golgi apparatus in cloned cytotoxic lymphocytes triggered by binding to lysable target 
cells. J Immunol 133, 2762–2766 (1984). 
30. Kupfer, A., Dennert, G. & Singer, S. J. The reorientation of the Golgi apparatus and the 
microtubule-organizing center in the cytotoxic effector cell is a prerequisite in the lysis 
of bound target cells. J Mol Cell Immunol 2, 37–49 (1985). 
 
 
 115 
 
R
ef
er
en
ce
s 
31. Kupfer, A., Mosmann, T. R. & Kupfer, H. Polarized expression of cytokines in cell 
conjugates of helper T cells and splenic B cells. Proc Natl Acad Sci U S A 88, 775–779 
(1991). 
32. Huse, M., Le Floc’h, A. & Liu, X. From lipid second messengers to molecular motors: 
microtubule-organizing center reorientation in T cells. Immunol Rev 256, 95–106 
(2013). 
33. Kuhne, M. R. et al. Linker for activation of T cells, zeta-associated protein-70, and Src 
homology 2 domain-containing leukocyte protein-76 are required for TCR-induced 
microtubule-organizing center polarization. J Immunol 171, 860–866 (2003). 
34. Lo, W. L. et al. Lck promotes Zap70-dependent LAT phosphorylation by bridging Zap70 
to LAT. Nat Immunol 19, 733–741 (2018). 
35. Babich, A. et al. F-actin polymerization and retrograde flow drive sustained PLCgamma1 
signaling during T cell activation. J Cell Biol 197, 775–787 (2012). 
36. Spitaler, M., Emslie, E., Wood, C. D. & Cantrell, D. Diacylglycerol and protein kinase D 
localization during T lymphocyte activation. Immunity 24, 535–546 (2006). 
37. Quann, E. J., Merino, E., Furuta, T. & Huse, M. Localized diacylglycerol drives the 
polarization of the microtubule-organizing center in T cells. Nat Immunol 10, 627–635 
(2009). 
38. Quann, E. J., Liu, X., Altan-Bonnet, G. & Huse, M. A cascade of protein kinase C isozymes 
promotes cytoskeletal polarization in T cells. Nat Immunol 12, 647–654 (2011). 
39. Combs, J. et al. Recruitment of dynein to the Jurkat immunological synapse. Proc Natl 
Acad Sci U S A 103, 14883–14888 (2006). 
40. Liu, X., Kapoor, T. M., Chen, J. K. & Huse, M. Diacylglycerol promotes centrosome 
polarization in T cells via reciprocal localization of dynein and myosin II. Proc Natl Acad 
Sci U S A 110, 11976–11981 (2013). 
41. Baixauli, F. et al. The mitochondrial fission factor dynamin-related protein 1 modulates 
T-cell receptor signalling at the immune synapse. EMBO J. 30, 1238–50 (2011). 
42. Calabia-Linares, C. et al. Endosomal clathrin drives actin accumulation at the 
immunological synapse. J Cell Sci 124, 820–830 (2011). 
43. Huse, M., Quann, E. J. & Davis, M. M. Shouts, whispers and the kiss of death: directional 
secretion in T cells. Nat. Immunol. 9, 1105–1111 (2008). 
44. Ueda, H., Morphew, M. K., McIntosh, J. R. & Davis, M. M. CD4+ T-cell synapses involve 
multiple distinct stages. Proc Natl Acad Sci U S A 108, 17099–17104 (2011). 
45. Poo, W. J., Conrad, L. & Janeway  Jr., C. A. Receptor-directed focusing of lymphokine 
release by helper T cells. Nature 332, 378–380 (1988). 
46. Alcover, A., Alarcon, B. & Di Bartolo, V. Cell Biology of T Cell Receptor Expression and 
Regulation. Annu Rev Immunol 36, 103–125 (2018). 
47. Finetti, F. et al. The small GTPase Rab8 interacts with VAMP-3 to regulate the delivery 
of recycling T-cell receptors to the immune synapse. J Cell Sci 128, 2541–2552 (2015). 
 116 
 
R
ef
er
en
ce
s 
48. Finetti, F. et al. Intraflagellar transport is required for polarized recycling of the 
TCR/CD3 complex to the immune synapse. Nat Cell Biol 11, 1332–1339 (2009). 
49. Martin-Cofreces, N. B. et al. End-binding protein 1 controls signal propagation from the 
T cell receptor. EMBO J 31, 4140–4152 (2012). 
50. Blas-Rus, N. et al. Aurora A drives early signalling and vesicle dynamics during T-cell 
activation. Nat Commun 7, 11389 (2016). 
51. Das, V. et al. Activation-induced polarized recycling targets T cell antigen receptors to 
the immunological synapse; involvement of SNARE complexes. Immunity 20, 577–588 
(2004). 
52. Compeer, E. B. et al. A mobile endocytic network connects clathrin-independent 
receptor endocytosis to recycling and promotes T cell activation. Nat Commun 9, 1597 
(2018). 
53. Pan, B. T. & Johnstone, R. M. Fate of the transferrin receptor during maturation of 
sheep reticulocytes in vitro: selective externalization of the receptor. Cell 33, 967–78 
(1983). 
54. Harding, C., Heuser, J. & Stahl, P. Receptor-mediated endocytosis of transferrin and 
recycling of the transferrin receptor in rat reticulocytes. J. Cell Biol. 97, 329–339 (1983). 
55. Mittelbrunn, M. et al. Unidirectional transfer of microRNA-loaded exosomes from T 
cells to antigen-presenting cells. Nat. Commun. 2, 282 (2011). 
56. Mittelbrunn, M. & Sánchez-Madrid, F. Intercellular communication: diverse structures 
for exchange of genetic information. Nat. Rev. Mol. Cell Biol. 13, 328–35 (2012). 
57. Huotari, J. & Helenius, A. Endosome maturation. EMBO J. 30, 3481–3500 (2011). 
58. Nielsen, E., Severin, F., Backer, J. M., Hyman, A. A. & Zerial, M. Rab5 regulates motility 
of early endosomes on microtubules. Nat. Cell Biol. 1, 376–382 (1999). 
59. Rink, J., Ghigo, E., Kalaidzidis, Y. & Zerial, M. Rab Conversion as a Mechanism of 
Progression from Early to Late Endosomes. Cell 122, 735–749 (2005). 
60. Bucci, C., Thomsen, P., Nicoziani, P., McCarthy, J. & van Deurs, B. Rab7: A Key to 
Lysosome Biogenesis. Mol. Biol. Cell 11, 467–480 (2000). 
61. Vitelli, R. et al. Role of the Small GTPase RAB7 in the Late Endocytic Pathway. J. Biol. 
Chem. 272, 4391–4397 (1997). 
62. Collinet, C. et al. Systems survey of endocytosis by multiparametric image analysis. 
Nature 464, 243–249 (2010). 
63. Driskell, O. J., Mironov, A., Allan, V. J. & Woodman, P. G. Dynein is required for receptor 
sorting and the morphogenesis of early endosomes. Nat. Cell Biol. 9, 113–120 (2007). 
64. Hoepfner, S. et al. Modulation of Receptor Recycling and Degradation by the 
Endosomal Kinesin KIF16B. Cell 121, 437–450 (2005). 
65. Bananis, E., Murray, J. W., Stockert, R. J., Satir, P. & Wolkoff, A. W. Microtubule and 
Motor-Dependent Endocytic Vesicle Sorting in Vitro. J. Cell Biol. 151, 179–186 (2000). 
 117 
 
R
ef
er
en
ce
s 
66. Aniento, F., Emans, N., Griffiths, G. & Gruenberg, J. Cytoplasmic dynein-dependent 
vesicular transport from early to late endosomes [published erratum appears in J Cell 
Biol 1994 Feb;124(3):397]. J. Cell Biol. 123, 1373–1387 (1993). 
67. Brown, C. L. et al. Kinesin-2 is a Motor for Late Endosomes and Lysosomes. Traffic 6, 
1114–1124 (2005). 
68. Jordens, I. et al. The Rab7 effector protein RILP controls lysosomal transport by inducing 
the recruitment of dynein-dynactin motors. Curr. Biol. 11, 1680–5 (2001). 
69. Johansson, M. et al. Activation of endosomal dynein motors by stepwise assembly of 
Rab7–RILP–p150Glued, ORP1L, and the receptor βlll spectrin. J. Cell Biol. 176, 459 
(2007). 
70. Progida, C. & Bakke, O. Bidirectional traffic between the Golgi and the endosomes – 
machineries and regulation. J. Cell Sci. 129, jcs.185702 (2016). 
71. Hessvik, N. P. & Llorente, A. Current knowledge on exosome biogenesis and release. 
Cell. Mol. Life Sci. 75, 193–208 (2018). 
72. Villarroya-Beltri, C., Baixauli, F., Gutierrez-Vazquez, C., Sanchez-Madrid, F. & 
Mittelbrunn, M. Sorting it out: regulation of exosome loading. Semin Cancer Biol 28, 3–
13 (2014). 
73. Baietti, M. F. et al. Syndecan–syntenin–ALIX regulates the biogenesis of exosomes. Nat. 
Cell Biol. 14, 677–685 (2012). 
74. Colombo, M., Raposo, G. & Théry, C. Biogenesis, Secretion, and Intercellular 
Interactions of Exosomes and Other Extracellular Vesicles. Annu. Rev. Cell Dev. Biol. 30, 
255–289 (2014). 
75. Alonso Y Adell, M., Migliano, S. M. & Teis, D. ESCRT-III and Vps4: a dynamic 
multipurpose tool for membrane budding and scission. FEBS J. 283, 3288–3302 (2016). 
76. Bache, K. G., Brech, A., Mehlum, A. & Stenmark, H. Hrs regulates multivesicular body 
formation via ESCRT recruitment to endosomes. J. Cell Biol. 162, 435–42 (2003). 
77. Raiborg, C. et al. Hrs sorts ubiquitinated proteins into clathrin-coated microdomains of 
early endosomes. Nat. Cell Biol. 4, 394–398 (2002). 
78. Razi, M. & Futter, C. E. Distinct Roles for Tsg101 and Hrs in Multivesicular Body 
Formation and Inward Vesiculation. Mol. Biol. Cell 17, 3469–3483 (2006). 
79. Bache, K. G. et al. The ESCRT-III Subunit hVps24 Is Required for Degradation but Not 
Silencing of the Epidermal Growth Factor Receptor. Mol. Biol. Cell 17, 2513–2523 
(2006). 
80. Trajkovic, K. et al. Ceramide Triggers Budding of Exosome Vesicles into Multivesicular 
Endosomes. Science (80-. ). 319, 1244–1247 (2008). 
81. Yuyama, K., Sun, H., Mitsutake, S. & Igarashi, Y. Sphingolipid-modulated Exosome 
Secretion Promotes Clearance of Amyloid-β by Microglia. J. Biol. Chem. 287, 10977–
10989 (2012). 
 
 118 
 
R
ef
er
en
ce
s 
82. Xu, Y. et al. Macrophages transfer antigens to dendritic cells by releasing exosomes 
containing dead-cell-associated antigens partially through a ceramide-dependent 
pathway to enhance CD4 + T-cell responses. Immunology 149, 157–171 (2016). 
83. Kajimoto, T., Okada, T., Miya, S., Zhang, L. & Nakamura, S. Ongoing activation of 
sphingosine 1-phosphate receptors mediates maturation of exosomal multivesicular 
endosomes. Nat. Commun. 4, 2712 (2013). 
84. Kajimoto, T. et al. Involvement of Gβγ subunits of G i protein coupled with S1P receptor 
on multivesicular endosomes in F-actin formation and cargo sorting into exosomes. J. 
Biol. Chem. 293, 245–253 (2018). 
85. Mohamed, N. N. I., Okada, T., Kajimoto, T. & Nakamura, S.-I. Essential Role of 
Sphingosine Kinase 2 in the Regulation of Cargo Contents in the Exosomes from K562 
Cells. Kobe J. Med. Sci. 63, E123–E129 (2018). 
86. Escola, J.-M. et al. Selective Enrichment of Tetraspan Proteins on the Internal Vesicles 
of Multivesicular Endosomes and on Exosomes Secreted by Human B-lymphocytes. J. 
Biol. Chem. 273, 20121–20127 (1998). 
87. Rocha-Perugini, V., Sánchez-Madrid, F. & Martínez del Hoyo, G. Function and Dynamics 
of Tetraspanins during Antigen Recognition and Immunological Synapse Formation. 
Front. Immunol. 6, 653 (2016). 
88. van Niel, G. et al. The Tetraspanin CD63 Regulates ESCRT-Independent and -Dependent 
Endosomal Sorting during Melanogenesis. Dev. Cell 21, 708–721 (2011). 
89. Edgar, J. R., Eden, E. R. & Futter, C. E. Hrs- and CD63-Dependent Competing 
Mechanisms Make Different Sized Endosomal Intraluminal Vesicles. Traffic 15, 197–211 
(2014). 
90. Tamai, K. et al. Exosome secretion of dendritic cells is regulated by Hrs, an ESCRT-0 
protein. Biochem. Biophys. Res. Commun. 399, 384–390 (2010). 
91. Stuffers, S., Sem Wegner, C., Stenmark, H. & Brech, A. Multivesicular Endosome 
Biogenesis in the Absence of ESCRTs. Traffic 10, 925–937 (2009). 
92. Ostrowski, M. et al. Rab27a and Rab27b control different steps of the exosome 
secretion pathway. Nat. Cell Biol. 12, 19–30 (2010). 
93. Villarroya-Beltri, C. et al. ISGylation controls exosome secretion by promoting lysosomal 
degradation of MVB proteins. Nat. Commun. 7, (2016). 
94. Villarroya-Beltri, C., Guerra, S. & Sanchez-Madrid, F. ISGylation - a key to lock the cell 
gates for preventing the spread of threats. J Cell Sci 130, 2961–2969 (2017). 
95. Li, Z. et al. Acetylation modification regulates GRP78 secretion in colon cancer cells. Sci 
Rep 6, 30406 (2016). 
96. Möbius, W. et al. Immunoelectron Microscopic Localization of Cholesterol Using 
Biotinylated and Non-cytolytic Perfringolysin O. J. Histochem. Cytochem. 50, 43–55 
(2002). 
 
 
 119 
 
R
ef
er
en
ce
s 
97. Chen, Q., Takada, R., Noda, C., Kobayashi, S. & Takada, S. Different populations of Wnt-
containing vesicles are individually released from polarized epithelial cells. Sci. Rep. 6, 
35562 (2016). 
98. Tauro, B. J. et al. Two Distinct Populations of Exosomes Are Released from LIM1863 
Colon Carcinoma Cell-derived Organoids. Mol. Cell. Proteomics 12, 587–598 (2013). 
99. van Niel, G. et al. Intestinal epithelial cells secrete exosome-like vesicles. 
Gastroenterology 121, 337–49 (2001). 
100. Sinha, S. et al. Cortactin promotes exosome secretion by controlling branched actin 
dynamics. J. Cell Biol. 214, 197–213 (2016). 
101. Möbius, W. et al. Recycling compartments and the internal vesicles of multivesicular 
bodies harbor most of the cholesterol found in the endocytic pathway. Traffic 4, 222–
31 (2003). 
102. Valadi, H. et al. Exosome-mediated transfer of mRNAs and microRNAs is a novel 
mechanism of genetic exchange between cells. Nat. Cell Biol. 9, 654–9 (2007). 
103. Thakur, B. K. et al. Double-stranded DNA in exosomes: a novel biomarker in cancer 
detection. Cell Res 24, 766–769 (2014). 
104. Takahashi, A., Okada, R., Nagao, K., Kawamata, Y. & Hanyu, A. Exosomes maintain 
cellular homeostasis by excreting harmful DNA from cells. Nat. Commun. 8, 15287 
(2017). 
105. Kahlert, C. et al. Identification of double-stranded genomic DNA spanning all 
chromosomes with mutated KRAS and p53 DNA in the serum exosomes of patients with 
pancreatic cancer. J Biol Chem 289, 3869–3875 (2014). 
106. Guescini, M., Genedani, S., Stocchi, V. & Agnati, L. F. Astrocytes and Glioblastoma cells 
release exosomes carrying mtDNA. J. Neural Transm. 117, 1–4 (2010). 
107. Moreno-Gonzalo, O., Fernandez-Delgado, I. & Sanchez-Madrid, F. Post-translational 
add-ons mark the path in exosomal protein sorting. Cell Mol Life Sci 75, 1–19 (2018). 
108. Raiborg, C. & Stenmark, H. The ESCRT machinery in endosomal sorting of ubiquitylated 
membrane proteins. Nature 458, 445–452 (2009). 
109. Nikko, E. & Andre, B. Evidence for a direct role of the Doa4 deubiquitinating enzyme in 
protein sorting into the MVB pathway. Traffic 8, 566–581 (2007). 
110. Kunadt, M. et al. Extracellular vesicle sorting of α-Synuclein is regulated by sumoylation. 
Acta Neuropathol. 129, 695–713 (2015). 
111. Villarroya-Beltri, C. et al. Sumoylated hnRNPA2B1 controls the sorting of miRNAs into 
exosomes through binding to specific motifs. Nat. Commun. 4, 2980 (2013). 
112. Santangelo, L. et al. The RNA-Binding Protein SYNCRIP Is a Component of the 
Hepatocyte Exosomal Machinery Controlling MicroRNA Sorting. Cell Rep 17, 799–808 
(2016). 
113. Montecalvo, A. et al. Mechanism of transfer of functional microRNAs between mouse 
dendritic cells via exosomes. Blood 119, 756–766 (2012). 
 120 
 
R
ef
er
en
ce
s 
114. Gibbings, D. J., Ciaudo, C., Erhardt, M. & Voinnet, O. Multivesicular bodies associate 
with components of miRNA effector complexes and modulate miRNA activity. Nat. Cell 
Biol. 11, 1143–9 (2009). 
115. Soares, A. R. et al. Gap junctional protein Cx43 is involved in the communication 
between extracellular vesicles and mammalian cells. Sci. Rep. 5, 13243 (2015). 
116. Varela-Eirin, M. et al. Recruitment of RNA molecules by connexin RNA-binding motifs: 
Implication in RNA and DNA transport through microvesicles and exosomes. Biochim. 
Biophys. Acta - Mol. Cell Res. 1864, 728–736 (2017). 
117. Welton, J. L. et al. Cerebrospinal fluid extracellular vesicle enrichment for protein 
biomarker discovery in neurological disease; multiple sclerosis. J. Extracell. Vesicles 6, 
1369805 (2017). 
118. Cheng, L., Sharples, R. A., Scicluna, B. J. & Hill, A. F. Exosomes provide a protective and 
enriched source of miRNA for biomarker profiling compared to intracellular and cell-
free blood. J. Extracell. vesicles 3, (2014). 
119. Thind, A. & Wilson, C. Exosomal miRNAs as cancer biomarkers and therapeutic targets. 
J. Extracell. Vesicles 5, 31292 (2016). 
120. Quinn, J. F. et al. Extracellular RNAs: development as biomarkers of human disease. J. 
Extracell. Vesicles 4, 27495 (2015). 
121. Boukouris, S. & Mathivanan, S. Exosomes in bodily fluids are a highly stable resource of 
disease biomarkers. Proteomics. Clin. Appl. 9, 358–67 (2015). 
122. Pitt, J. M., Kroemer, G. & Zitvogel, L. Extracellular vesicles: masters of intercellular 
communication and potential clinical interventions. J. Clin. Invest. 126, 1139–1143 
(2016). 
123. van Niel, G., D’Angelo, G. & Raposo, G. Shedding light on the cell biology of extracellular 
vesicles. Nat. Rev. Mol. Cell Biol. 19, 213–228 (2018). 
124. Raposo, G. & Stoorvogel, W. Extracellular vesicles: exosomes, microvesicles, and 
friends. J Cell Biol 200, 373–383 (2013). 
125. Tkach, M. & Thery, C. Communication by Extracellular Vesicles: Where We Are and 
Where We Need to Go. Cell 164, 1226–1232 (2016). 
126. Robbins, P. D. & Morelli, A. E. Regulation of immune responses by extracellular vesicles. 
Nat. Rev. Immunol. 14, 195–208 (2014). 
127. Blanchard, N. et al. TCR activation of human T cells induces the production of exosomes 
bearing the TCR/CD3/zeta complex. J Immunol 168, 3235–3241 (2002). 
128. Wahlgren, J., Karlson Tde, L., Glader, P., Telemo, E. & Valadi, H. Activated human T cells 
secrete exosomes that participate in IL-2 mediated immune response signaling. PLoS 
One 7, e49723 (2012). 
129. Jolly, C., Welsch, S., Michor, S. & Sattentau, Q. J. The regulated secretory pathway in 
CD4(+) T cells contributes to human immunodeficiency virus type-1 cell-to-cell spread 
at the virological synapse. PLoS Pathog 7, e1002226 (2011). 
 
 121 
 
R
ef
er
en
ce
s 
130. Soares, H. HIV-1 Intersection with CD4 T Cell Vesicle Exocytosis: Intercellular 
Communication Goes Viral. Front Immunol 5, 454 (2014). 
131. Bukong, T. N., Momen-Heravi, F., Kodys, K., Bala, S. & Szabo, G. Exosomes from 
hepatitis C infected patients transmit HCV infection and contain replication competent 
viral RNA in complex with Ago2-miR122-HSP90. PLoS Pathog 10, e1004424 (2014). 
132. Choudhuri, K. et al. Polarized release of T-cell-receptor-enriched microvesicles at the 
immunological synapse. Nature 507, 118–23 (2014). 
133. Vardhana, S., Choudhuri, K., Varma, R. & Dustin, M. L. Essential role of ubiquitin and 
TSG101 protein in formation and function of the central supramolecular activation 
cluster. Immunity 32, 531–540 (2010). 
134. Esposito, L. et al. Investigation of soluble and transmembrane CTLA-4 isoforms in serum 
and microvesicles. J Immunol 193, 889–900 (2014). 
135. Friedman, J. R. & Nunnari, J. Mitochondrial form and function. Nature 505, 335–343 
(2014). 
136. Angajala, A. et al. Diverse Roles of Mitochondria in Immune Responses: Novel Insights 
Into Immuno-Metabolism. Front. Immunol. 9, 1605 (2018). 
137. Sena, L. a et al. Mitochondria are required for antigen-specific T cell activation through 
reactive oxygen species signaling. Immunity 38, 225–36 (2013). 
138. Arsenio, J., Metz, P. J. & Chang, J. T. Asymmetric Cell Division in T Lymphocyte Fate 
Diversification. Trends Immunol. 36, 670–683 (2015). 
139. Baixauli, F. et al. Mitochondrial Respiration Controls Lysosomal Function during 
Inflammatory T Cell Responses. Cell Metab 22, 485–498 (2015). 
140. Quintana, A. et al. T cell activation requires mitochondrial translocation to the 
immunological synapse. Proc. Natl. Acad. Sci. 104, 14418–14423 (2007). 
141. Gómez-Cabañas, L. et al. Immunological Synapse Formation Induces Mitochondrial 
Clustering and Mitophagy in Dendritic Cells. J. Immunol. 202, 1715–1723 (2019). 
142. Lewis, R. S. Calcium signaling mechanisms in T lymphocytes. Annu. Rev. Immunol. 19, 
497–521 (2001). 
143. Schwindling, C., Quintana, A., Krause, E. & Hoth, M. Mitochondria positioning controls 
local calcium influx in T cells. J. Immunol. 184, 184–90 (2010). 
144. Morlino, G. et al. Miro-1 Links Mitochondria and Microtubule Dynein Motors To Control 
Lymphocyte Migration and Polarity. Mol. Cell. Biol. 34, 1412–1426 (2014). 
145. MacAskill, A. F. et al. Miro1 Is a Calcium Sensor for Glutamate Receptor-Dependent 
Localization of Mitochondria at Synapses. Neuron 61, 541–555 (2009). 
146. Contento, R. L. et al. Adhesion shapes T cells for prompt and sustained T-cell receptor 
signalling. EMBO J. 29, 4035–4047 (2010). 
147. López‐Doménech, G. et al. Miro proteins coordinate microtubule‐ and actin‐dependent 
mitochondrial transport and distribution. EMBO J. 37, 321–336 (2018). 
 122 
 
R
ef
er
en
ce
s 
148. Quintero, O. A. et al. Human Myo19 Is a Novel Myosin that Associates with 
Mitochondria. Curr. Biol. 19, 2008–2013 (2009). 
149. Gustafsson, C. M., Falkenberg, M. & Larsson, N.-G. Maintenance and Expression of 
Mammalian Mitochondrial DNA. Annu. Rev. Biochem. 85, 133–160 (2016). 
150. Kukat, C. et al. Cross-strand binding of TFAM to a single mtDNA molecule forms the 
mitochondrial nucleoid. Proc. Natl. Acad. Sci. 112, 11288–11293 (2015). 
151. Mishra, P. & Chan, D. C. Mitochondrial dynamics and inheritance during cell division, 
development and disease. Nat. Rev. Mol. Cell Biol. 15, 634–46 (2014). 
152. Spees, J. L., Olson, S. D., Whitney, M. J. & Prockop, D. J. Mitochondrial transfer between 
cells can rescue aerobic respiration. Proc. Natl. Acad. Sci. U. S. A. 103, (2006). 
153. Ahmad, T. et al. Miro 1 regulates intercellular mitochondrial transport & enhances 
mesenchymal stem cell rescue efficacy. EMBO J. 33, (2014). 
154. Hayakawa, K. et al. Transfer of mitochondria from astrocytes to neurons after stroke. 
Nature 535, 551–555 (2016). 
155. Islam, M. N. et al. Mitochondrial transfer from bone-marrow-derived stromal cells to 
pulmonary alveoli protects against acute lung injury. Nat Med 18, 759–765 (2012). 
156. Moschoi, R. et al. Protective mitochondrial transfer from bone marrow stromal cells to 
acute myeloid leukemic cells during chemotherapy. Blood (2016).  
157. Tan, A. S. et al. Mitochondrial Genome Acquisition Restores Respiratory Function and 
Tumorigenic Potential of Cancer Cells without Mitochondrial DNA. Cell Metab. 21, 81–
94 (2015). 
158. Cho, Y. M. et al. Mesenchymal stem cells transfer mitochondria to the cells with 
virtually no mitochondrial function but not with pathogenic mtDNA mutations. PLoS 
One 7, 0–7 (2012). 
159. Wang, X. & Gerdes, H.-H. Transfer of mitochondria via tunneling nanotubes rescues 
apoptotic PC12 cells. Cell Death Differ. 22, 1181–91 (2015). 
160. Guescini, M. et al. C2C12 myoblasts release micro-vesicles containing mtDNA and 
proteins involved in signal transduction. Exp. Cell Res. 316, 1977–84 (2010). 
161. Kahlert, C. et al. Identification of double-stranded genomic DNA spanning all 
chromosomes with mutated KRAS and p53 DNA in the serum exosomes of patients with 
pancreatic cancer. J. Biol. Chem. 289, 3869–75 (2014). 
162. Phinney, D. G. et al. Mesenchymal stem cells use extracellular vesicles to outsource 
mitophagy and shuttle microRNAs. Nat. Commun. 6, 8472 (2015). 
163. Ong, S.-G. & Wu, J. C. Exosomes as potential alternatives to stem cell therapy in 
mediating cardiac regeneration. Circ. Res. 117, 7–9 (2015). 
164. Nakamura, Y. et al. Mesenchymal-stem-cell-derived exosomes accelerate skeletal 
muscle regeneration. FEBS Lett. 589, 1257–1265 (2015). 
 
 123 
 
R
ef
er
en
ce
s 
165. Khan, M. et al. Embryonic Stem Cell-Derived Exosomes Promote Endogenous Repair 
Mechanisms and Enhance Cardiac Function Following Myocardial Infarction. Circ. Res. 
117, 52–64 (2015). 
166. Galluzzi, L., Kepp, O. & Kroemer, G. Mitochondria: master regulators of danger 
signalling. Nat. Rev. Mol. Cell Biol. 13, 780–788 (2012). 
167. West, A. P. et al. Mitochondrial DNA stress primes the antiviral innate immune 
response. Nature 520, 553–557 (2015). 
168. Zhang, Q. et al. Circulating mitochondrial DAMPs cause inflammatory responses to 
injury. Nature 464, 104–7 (2010). 
169. Weinberg, S. E., Sena, L. A. & Chandel, N. S. Mitochondria in the Regulation of Innate 
and Adaptive Immunity. Immunity 42, 406–417 (2015). 
170. Collins, L. V., Hajizadeh, S., Holme, E., Jonsson, I. & Tarkowski, A. Endogenously oxidized 
mitochondrial DNA induces in vivo and in vitro inflammatory responses. J. Leukoc. Biol. 
75, 995–1000 (2004). 
171. Oka, T. et al. Mitochondrial DNA that escapes from autophagy causes inflammation and 
heart failure. Nature 485 VN-, 251–255 (2012). 
172. Shimada, K. et al. Oxidized Mitochondrial DNA Activates the NLRP3 Inflammasome 
during Apoptosis. Immunity 36, 401–414 (2012). 
173. Caielli, S. et al. Oxidized mitochondrial nucleoids released by neutrophils drive type I 
interferon production in human lupus. J. Exp. Med. 213, 697–713 (2016). 
174. Boudreau, L. H. et al. Platelets release mitochondria serving as substrate for bactericidal 
group IIA-secreted phospholipase a to promote inflammation. Blood 124, 2173–2183 
(2014). 
175. Morshed, M. et al. NADPH oxidase-independent formation of extracellular DNA traps 
by basophils. J. Immunol. 192, 5314–23 (2014). 
176. Yousefi, S. et al. Catapult-like release of mitochondrial DNA by eosinophils contributes 
to antibacterial defense. Nat Med 14, 949–953 (2008). 
177. Ishikawa, K. et al. The innate immune system in host mice targets cells with allogenic 
mitochondrial DNA. J. Exp. Med. 207, 2297–305 (2010). 
178. Sauer, J. D. et al. The N-ethyl-N-nitrosourea-induced Goldenticket mouse mutant 
reveals an essential function of Sting in the in vivo interferon response to Listeria 
monocytogenes and cyclic dinucleotides. Infect Immun 79, 688–694 (2011). 
179. Thery, C., Amigorena, S., Raposo, G. & Clayton, A. Isolation and characterization of 
exosomes from cell culture supernatants and biological fluids. Curr Protoc Cell Biol 
Chapter 3, Unit 3 22 (2006). 
180. Wisniewski, J. R., Zougman, A., Nagaraj, N. & Mann, M. Universal sample preparation 
method for proteome analysis. Nat Methods 6, 359–362 (2009). 
181. Bonzon-Kulichenko, E., Garcia-Marques, F., Trevisan-Herraz, M. & Vazquez, J. Revisiting 
peptide identification by high-accuracy mass spectrometry: problems associated with 
the use of narrow mass precursor windows. J Proteome Res 14, 700–710 (2015). 
 124 
 
R
ef
er
en
ce
s 
182. Manders, E. M., Stap, J., Brakenhoff, G. J., van Driel, R. & Aten, J. A. Dynamics of three-
dimensional replication patterns during the S-phase, analysed by double labelling of 
DNA and confocal microscopy. J Cell Sci 103 ( Pt 3, 857–862 (1992). 
183. Théry, C. et al. Minimal information for studies of extracellular vesicles 2018 
(MISEV2018): a position statement of the International Society for Extracellular Vesicles 
and update of the MISEV2014 guidelines. J. Extracell. Vesicles 7, 1535750 (2018). 
184. Zhang, Y. et al. Inflammasome-Derived Exosomes Activate NF-kappaB Signaling in 
Macrophages. J Proteome Res (2016).  
185. Perez-Hernandez, D. et al. The intracellular interactome of tetraspanin-enriched 
microdomains reveals their function as sorting machineries toward exosomes. J Biol 
Chem 288, 11649–11661 (2013). 
186. Gilkerson, R. et al. The mitochondrial nucleoid: integrating mitochondrial DNA into 
cellular homeostasis. Cold Spring Harb Perspect Biol 5, a011080 (2013). 
187. Nolte-’t Hoen, E. N. et al. Deep sequencing of RNA from immune cell-derived vesicles 
uncovers the selective incorporation of small non-coding RNA biotypes with potential 
regulatory functions. Nucleic Acids Res 40, 9272–9285 (2012). 
188. Hammerling, B. C. et al. A Rab5 endosomal pathway mediates Parkin-dependent 
mitochondrial clearance. Nat Commun 8, 14050 (2017). 
189. Vanlandingham, P. A. & Ceresa, B. P. Rab7 regulates late endocytic trafficking 
downstream of multivesicular body biogenesis and cargo sequestration. J Biol Chem 
284, 12110–12124 (2009). 
190. Cogliati, S. et al. Mitochondrial cristae shape determines respiratory chain 
supercomplexes assembly and respiratory efficiency. Cell 155, 160–171 (2013). 
191. Buck, M. D. et al. Mitochondrial Dynamics Controls T Cell Fate through Metabolic 
Programming. Cell 166, 63–76 (2016). 
192. Mizushima, N. & Levine, B. Autophagy in mammalian development and differentiation. 
Nat Cell Biol 12, 823–830 (2010). 
193. Fader, C. M., Sanchez, D., Furlan, M. & Colombo, M. I. Induction of autophagy promotes 
fusion of multivesicular bodies with autophagic vacuoles in k562 cells. Traffic 9, 230–
250 (2008). 
194. Latorre-Pellicer, A. et al. Mitochondrial and nuclear DNA matching shapes metabolism 
and healthy ageing. Nature 535, 561–565 (2016). 
195. West, A. P. & Shadel, G. S. Mitochondrial DNA in innate immune responses and 
inflammatory pathology. Nat Rev Immunol (2017).  
196. Chen, Q., Sun, L. & Chen, Z. J. Regulation and function of the cGAS-STING pathway of 
cytosolic DNA sensing. Nat Immunol 17, 1142–1149 (2016). 
197. Ishikawa, H., Ma, Z. & Barber, G. N. STING regulates intracellular DNA-mediated, type I 
interferon-dependent innate immunity. Nature 461, 788–792 (2009). 
 
 125 
 
R
ef
er
en
ce
s 
198. Bobrie, A., Colombo, M., Krumeich, S., Raposo, G. & Théry, C. Diverse subpopulations of 
vesicles secreted by different intracellular mechanisms are present in exosome 
preparations obtained by differential ultracentrifugation. J. Extracell. Vesicles 1, 18397 
(2012). 
199. van der Vlist, E. J. et al. CD4 + T cell activation promotes the differential release of 
distinct populations of nanosized vesicles. J. Extracell. Vesicles 1, 18364 (2012). 
200. Palma, J. et al. MicroRNAs are exported from malignant cells in customized particles. 
Nucleic Acids Res. 40, 9125–9138 (2012). 
201. Sreekumar, P. G. et al. αB Crystallin Is Apically Secreted within Exosomes by Polarized 
Human Retinal Pigment Epithelium and Provides Neuroprotection to Adjacent Cells. 
PLoS One 5, e12578 (2010). 
202. White, I. J., Bailey, L. M., Aghakhani, M. R., Moss, S. E. & Futter, C. E. EGF stimulates 
annexin 1-dependent inward vesiculation in a multivesicular endosome subpopulation. 
EMBO J. 25, 1–12 (2006). 
203. Kowal, J. et al. Proteomic comparison defines novel markers to characterize 
heterogeneous populations of extracellular vesicle subtypes. Proc. Natl. Acad. Sci. U. S. 
A. (2016).  
204. Willms, E. et al. Cells release subpopulations of exosomes with distinct molecular and 
biological properties. Sci. Rep. 6, 22519 (2016). 
205. Mastoridis, S. et al. Multiparametric Analysis of Circulating Exosomes and Other Small 
Extracellular Vesicles by Advanced Imaging Flow Cytometry. Front. Immunol. 9, 1583 
(2018). 
206. Schrader, M., Godinho, L. F., Costello, J. L. & Islinger, M. The different facets of 
organelle interplay-an overview of organelle interactions. Front. cell Dev. Biol. 3, 56 
(2015). 
207. Martinvalet, D. The role of the mitochondria and the endoplasmic reticulum contact 
sites in the development of the immune responses. Cell Death Dis. 9, 336 (2018). 
208. Sugiura, A., Mattie, S., Prudent, J. & McBride, H. M. Newly born peroxisomes are a 
hybrid of mitochondrial and ER-derived pre-peroxisomes. Nature 542, 251–254 (2017). 
209. Itoh, K. et al. A brain-enriched Drp1 isoform associates with lysosomes, late 
endosomes, and the plasma membrane. J. Biol. Chem. 293, 11809–11822 (2018). 
210. Green, D. R., Galluzzi, L. & Kroemer, G. Mitochondria and the Autophagy-Inflammation-
Cell Death Axis in Organismal Aging. Science (80-. ). 333, 1109–1112 (2011). 
211. Sheftel, A. D., Zhang, A.-S., Brown, C., Shirihai, O. S. & Ponka, P. Direct interorganellar 
transfer of iron from endosome to mitochondrion. Blood 110, 125–132 (2007). 
212. Hamdi, A. et al. Erythroid cell mitochondria receive endosomal iron by a “kiss-and-run” 
mechanism. Biochim. Biophys. Acta - Mol. Cell Res. 1863, 2859–2867 (2016). 
213. Soto-Heredero, G., Baixauli, F. & Mittelbrunn, M. Interorganelle Communication 
between Mitochondria and the Endolysosomal System. Front. Cell Dev. Biol. 5, 95 
(2017). 
 126 
 
R
ef
er
en
ce
s 
214. Cioni, J.-M. et al. Late Endosomes Act as mRNA Translation Platforms and Sustain 
Mitochondria in Axons. Cell 176, 56-72.e15 (2019). 
215. Nakahira, K. et al. Autophagy proteins regulate innate immune responses by inhibiting 
the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol 
12, 222–230 (2011). 
216. Wang, C. & Youle, R. J. The role of mitochondria in apoptosis*. Annu. Rev. Genet. 43, 
95–118 (2009). 
217. Soubannier, V. et al. A vesicular transport pathway shuttles cargo from mitochondria to 
lysosomes. Curr. Biol. 22, 135–41 (2012). 
218. Cadete, V. J. J. et al. Formation of mitochondrial-derived vesicles is an active and 
physiologically relevant mitochondrial quality control process in the cardiac system. J. 
Physiol. 594, 5343–5362 (2016). 
219. Sugiura, A., McLelland, G. L., Fon, E. A. & McBride, H. M. A new pathway for 
mitochondrial quality control: mitochondrial-derived vesicles. EMBO J 33, 2142–2156 
(2014). 
220. Mclelland, G., Soubannier, V., Chen, C. X., Mcbride, H. M. & Fon, E. A. Parkin and PINK 1 
function in a vesicular trafficking pathway regulating mitochondrial quality control. 33, 
282–296 (2014). 
221. McLelland, G.-L., Lee, S. A., McBride, H. M. & Fon, E. A. Syntaxin-17 delivers 
PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system. J. Cell 
Biol. 214, 275–291 (2016). 
222. Pan, B. T., Teng, K., Wu, C., Adam, M. & Johnstone, R. M. Electron microscopic evidence 
for externalization of the transferrin receptor in vesicular form in sheep reticulocytes. J. 
Cell Biol. 101, 942–948 (1985). 
223. Johnstone, R. M., Adam, M., Hammond, J. R., Orr, L. & Turbide, C. Vesicle formation 
during reticulocyte maturation. Association of plasma membrane activities with 
released vesicles (exosomes). J. Biol. Chem. 262, 9412–20 (1987). 
224. Dai, Y. et al. Rapamycin drives selection against a pathogenic heteroplasmic 
mitochondrial DNA mutation. Hum. Mol. Genet. 23, 637–47 (2014). 
225. Suen, D.-F., Narendra, D. P., Tanaka, A., Manfredi, G. & Youle, R. J. Parkin 
overexpression selects against a deleterious mtDNA mutation in heteroplasmic cybrid 
cells. Proc. Natl. Acad. Sci. 107, 11835–11840 (2010). 
226. Valenci, I., Yonai, L., Bar-Yaacov, D., Mishmar, D. & Ben-Zvi, A. Parkin modulates 
heteroplasmy of truncated mtDNA in Caenorhabditis elegans. Mitochondrion 20, 64–70 
(2015). 
227. Peeva, V. et al. Linear mitochondrial DNA is rapidly degraded by components of the 
replication machinery. Nat. Commun. 9, 1727 (2018). 
228. Medeiros, T. C., Thomas, R. L., Ghillebert, R. & Graef, M. Autophagy balances mtDNA 
synthesis and degradation by DNA polymerase POLG during starvation. J. Cell Biol. 217, 
1601–1611 (2018). 
 127 
 
R
ef
er
en
ce
s 
229. Moretton, A. et al. Selective mitochondrial DNA degradation following double-strand 
breaks. PLoS One 12, e0176795 (2017). 
230. Shokolenko, I. N., Wilson, G. L. & Alexeyev, M. F. The “fast” and the “slow” modes of 
mitochondrial DNA degradation. Mitochondrial DNA 27, 490–498 (2016). 
231. Lespagnol, A. et al. Exosome secretion, including the DNA damage-induced p53-
dependent secretory pathway, is severely compromised in TSAP6/Steap3-null mice. Cell 
Death Differ. 15, 1723–1733 (2008). 
232. Hessvik, N. P. et al. PIKfyve inhibition increases exosome release and induces secretory 
autophagy. Cell. Mol. Life Sci. 73, 4717–4737 (2016). 
233. Jeannin, P. et al. Proteomic analysis of plasma extracellular vesicles reveals 
mitochondrial stress upon HTLV-1 infection. Sci. Rep. 8, 5170 (2018). 
234. Szczesny, B. et al. Mitochondrial DNA damage and subsequent activation of Z-DNA 
binding protein 1 links oxidative stress to inflammation in epithelial cells. Sci. Rep. 8, 
914 (2018). 
235. Kalluri, R. & LeBleu, V. S. Discovery of Double-Stranded Genomic DNA in Circulating 
Exosomes. Cold Spring Harb. Symp. Quant. Biol. 81, 275–280 (2016). 
236. Melentijevic, I. et al. C. elegans neurons jettison protein aggregates and mitochondria 
under neurotoxic stress. Nature 542, 367–371 (2017). 
237. Soubannier, V., Rippstein, P., Kaufman, B. a, Shoubridge, E. a & McBride, H. M. 
Reconstitution of mitochondria derived vesicle formation demonstrates selective 
enrichment of oxidized cargo. PLoS One 7, e52830 (2012). 
238. Cai, J. et al. Extracellular vesicle-mediated transfer of donor genomic DNA to recipient 
cells is a novel mechanism for genetic influence between cells. J. Mol. Cell Biol. 5, 227–
238 (2013). 
239. Lee, T. H. et al. Oncogenic ras-driven cancer cell vesiculation leads to emission of 
double-stranded DNA capable of interacting with target cells. Biochem. Biophys. Res. 
Commun. 451, 295–301 (2014). 
240. Sansone, P. et al. Packaging and transfer of mitochondrial DNA via exosomes regulate 
escape from dormancy in hormonal therapy-resistant breast cancer. Proc. Natl. Acad. 
Sci. 114, E9066–E9075 (2017). 
241. Crisp, A., Boschetti, C., Perry, M., Tunnacliffe, A. & Micklem, G. Expression of multiple 
horizontally acquired genes is a hallmark of both vertebrate and invertebrate genomes. 
Genome Biol. 16, 50 (2015). 
242. Marinoni, G. et al. Horizontal transfer of genetic material among Saccharomyces yeasts. 
J. Bacteriol. 181, 6488–96 (1999). 
243. Gladyshev, E. A., Meselson, M. & Arkhipova, I. R. Massive Horizontal Gene Transfer in 
Bdelloid Rotifers. Science (80-. ). 320, 1210–1213 (2008). 
244. Eyres, I. et al. Horizontal gene transfer in bdelloid rotifers is ancient, ongoing and more 
frequent in species from desiccating habitats. BMC Biol. 13, 90 (2015). 
 
 128 
 
R
ef
er
en
ce
s 
245. Rice, D. W. et al. Horizontal Transfer of Entire Genomes via Mitochondrial Fusion in the 
Angiosperm Amborella. Science (80-. ). 342, 1468–1473 (2013). 
246. Rebbeck, C. A., Leroi, A. M. & Burt, A. Mitochondrial capture by a transmissible cancer. 
Science (80-. ). 331, 303 (2011). 
247. Clark, M. A. & Shay, J. W. Mitochondrial transformation of mammalian cells. Nature 
295, 605–607 (1982). 
248. Manfredi, G., Thyagarajan, D., Papadopoulou, L. C., Pallotti, F. & Schon, E. A. The fate of 
human sperm-derived mtDNA in somatic cells. Am J Hum Genet 61, 953–960 (1997). 
249. Dong, L. F. et al. Horizontal transfer of whole mitochondria restores tumorigenic 
potential in mitochondrial DNA-deficient cancer cells. Elife 6, (2017). 
250. Hough, K. P. et al. Exosomal transfer of mitochondria from airway myeloid-derived 
regulatory cells to T cells. Redox Biol. 18, 54–64 (2018). 
251. Li, M., Schröder, R., Ni, S., Madea, B. & Stoneking, M. Extensive tissue-related and 
allele-related mtDNA heteroplasmy suggests positive selection for somatic mutations. 
Proc. Natl. Acad. Sci. U. S. A. 112, 2491–6 (2015). 
252. Sharpley, M. S. et al. Heteroplasmy of Mouse mtDNA Is Genetically Unstable and 
Results in Altered Behavior and Cognition. Cell 151, 333–343 (2012). 
253. Branzk, N. et al. Neutrophils sense microbe size and selectively release neutrophil 
extracellular traps in response to large pathogens. Nat Immunol 15, 1017–1025 (2014). 
254. Lood, C. et al. Neutrophil extracellular traps enriched in oxidized mitochondrial DNA are 
interferogenic and contribute to lupus-like disease. Nat Med 22, 146–153 (2016). 
255. Ingelsson, B. et al. Lymphocytes eject interferogenic mitochondrial DNA webs in 
response to CpG and non-CpG oligodeoxynucleotides of class C. Proc. Natl. Acad. Sci. U. 
S. A. 115, E478–E487 (2018). 
256. Julian, M. W. et al. Mitochondrial transcription factor A serves as a danger signal by 
augmenting plasmacytoid dendritic cell responses to DNA. J. Immunol. (Baltimore, Md. 
1950) 189, 433–443 (2012). 
257. Tsilioni, I. & Theoharides, T. C. Extracellular vesicles are increased in the serum of 
children with autism spectrum disorder, contain mitochondrial DNA, and stimulate 
human microglia to secrete IL-1β. J. Neuroinflammation 15, 239 (2018). 
258. Verboogen, D. R. J. et al. The dendritic cell side of the immunological synapse. Biomol. 
Concepts 7, 17–28 (2016). 
259. Boes, M. et al. T-cell engagement of dendritic cells rapidly rearranges MHC class II 
transport. Nature 418, 983–988 (2002). 
260. Boes, M. et al. T Cells Induce Extended Class II MHC Compartments in Dendritic Cells in 
a Toll-Like Receptor-Dependent Manner. J. Immunol. 171, 4081–4088 (2003). 
261. Pulecio, J. et al. Cdc42-mediated MTOC polarization in dendritic cells controls targeted 
delivery of cytokines at the immune synapse. J. Exp. Med. 207, 2719–2732 (2010). 
 
 129 
 
R
ef
er
en
ce
s 
262. Chen, M. & Wang, J. Programmed cell death of dendritic cells in immune regulation. 
Immunol Rev 236, 11–27 (2010). 
263. Riol-Blanco, L. et al. Immunological synapse formation inhibits, via NF-kappaB and 
FOXO1, the apoptosis of dendritic cells. Nat Immunol 10, 753–760 (2009). 
264. Ingulli, E., Mondino, A., Khoruts, A. & Jenkins, M. K. In vivo detection of dendritic cell 
antigen presentation to CD4(+) T cells. J Exp Med 185, 2133–2141 (1997). 
265. Garg, S. et al. Genetic tagging shows increased frequency and longevity of antigen-
presenting, skin-derived dendritic cells in vivo. Nat Immunol 4, 907–912 (2003). 
266. Ariotti, S. et al. T cell memory. Skin-resident memory CD8(+) T cells trigger a state of 
tissue-wide pathogen alert. Science (80-. ). 346, 101–105 (2014). 
267. Iijima, N. & Iwasaki, A. T cell memory. A local macrophage chemokine network sustains 
protective tissue-resident memory CD4 T cells. Science (80-. ). 346, 93–98 (2014). 
268. Schenkel, J. M. et al. T cell memory. Resident memory CD8 T cells trigger protective 
innate and adaptive immune responses. Science (80-. ). 346, 98–101 (2014). 
269. Netea, M. G. et al. Trained immunity: A program of innate immune memory in health 
and disease. Science (80-. ). 352, aaf1098 (2016). 
270. Curato, C. et al. DC Respond to Cognate T Cell Interaction in the Antigen-Challenged 
Lymph Node. Front. Immunol. 10, 863 (2019). 
271. Rodriguez-Fernandez, J. L., Riol-Blanco, L. & Delgado-Martin, C. What Is the Function of 
the Dendritic Cell Side of the Immunological Synapse? Sci. Signal. 3, re2–re2 (2010). 
 
 130 
 
R
ef
er
en
ce
s 
  
 131 
 
R
ef
er
en
ce
s 
 
 
 132 
 
A
n
n
ex
es
 
  
 133 
 
A
n
n
ex
es
 
Annexes 
1. Publications related with this work (included): 
 
I. Torralba D, Baixauli F, Villarroya-Beltri C, Fernández-Delgado I, Latorre-Pellicer A, Acín-
Pérez R, Martín-Cófreces NB, Jaso-Tamame ÁL, Iborra S, Jorge I, González-Aseguinolaza 
G, Garaude J, Vicente-Manzanares M, Enríquez JA, Mittelbrunn M, Sánchez-Madrid F. 
Priming of dendritic cells by DNA-containing extracellular vesicles from activated T 
cells through antigen-driven contacts. Nat Commun. 2018 Jul 9;9(1):2658. doi: 
10.1038/s41467-018-05077-9. 
 
II. Villarroya-Beltri C, Baixauli F, Mittelbrunn M, Fernández-Delgado I, Torralba D, 
Moreno-Gonzalo O, Baldanta S, Enrich C, Guerra S, Sánchez-Madrid F. ISGylation 
controls exosome secretion by promoting lysosomal degradation of MVB proteins. Nat 
Commun. 2016 Nov 24;7:13588. doi: 10.1038/ncomms13588. 
2. Reviews related with this work (not included): 
 
I. Torralba D, Baixauli F, Sánchez-Madrid F. Mitochondria Know No Boundaries: 
Mechanisms and Functions of Intercellular Mitochondrial Transfer. Front Cell Dev Biol. 
2016 Sep 28;4:107. eCollection 2016. Review. 
 
II. Torralba D, Martín-Cófreces NB, Sanchez-Madrid F. Mechanisms of polarized cell-cell 
communication of T lymphocytes. Immunol Lett. 2019 May;209:11-20. doi: 
10.1016/j.imlet.2019.03.009. Epub 2019 Apr 5. Review. 
 
3. Other articles not related with this work: 
 
I. Saiz ML, Cibrian D, Ramírez-Huesca M, Torralba D, Moreno-Gonzalo O, Sánchez-
Madrid F. Tetraspanin CD9 Limits Mucosal Healing in Experimental Colitis. Front 
Immunol. 2017 Dec 19;8:1854. doi: 10.3389/fimmu.2017.01854. eCollection 2017. 
  
 134 
 
A
n
n
ex
es