1 SUPPLEMENTARY MATERIALS Targeting OGG1 arrests cancer cell proliferation by inducing replication stress Torkild Visnes1,2,*,†, Carlos Benítez-Buelga1,†, Armando Cázares-Körner1, Kumar Sanjiv1, Bishoy M F Hanna1, Oliver Mortusewicz1, Varshni Rajagopal1, Julian J Albers1, Daniel W Hagey3, Tove Bekkhus1, Saeed Eshtad1, Juan Miguel Baquero4, Geoffrey Masuyer5,6, Olov Wallner1, Sarah Müller1, Therese Pham1, Camilla Göktürk1, Azita Rasti1, Sharda Suman1, Raúl Torres-Ruiz7,8, Antonio Sarno9,10,11, Elisée Wiita1, Evert J Homan1, Stella Karsten1, Karthick Marimuthu1, Maurice Michel1, Tobias Koolmeister1, Martin Scobie1, Olga Loseva1, Ingrid Almlöf1, Judith Edda Unterlass1, Aleksandra Pettke1, Johan Boström1, Monica Pandey12, Helge Gad12, Patrick Herr12, Ann-Sofie Jemth1, Samir El Andaloussi3, Christina Kalderén1, Sandra Rodriguez-Perales6, Javier Benítez3,13, Hans E Krokan9,10, Mikael Altun1, Pål Stenmark3,14, Ulrika Warpman Berglund1, Thomas Helleday1,12,* Affiliations 1) Science for Life Laboratory, Department of Oncology-Pathology, Karolinska Institutet, S-171 76 Stockholm, Sweden. 2) Department Biotechnology and Nanomedicine, SINTEF Industry, N-7465 Trondheim, Norway. 3) Department of Laboratory Medicine, Karolinska Institutet, Stockholm, Sweden. 4) Human Genetics Group, Spanish National Cancer Research Centre (CNIO), Madrid, Spain. 5) Department of Biochemistry and Biophysics, Stockholm University, SE-106 91 Stockholm, Sweden 6) Department of Pharmacy and Pharmacology, Centre for Therapeutic Innovation, University of Bath, Bath BA2 7AY, UK 7) Molecular Cytogenetics Group, Human Cancer Genetics Program, Spanish National Cancer Research Centre (CNIO), Madrid, 28029, Spain. 8) Josep Carreras Leukemia Research Institute and Department of Biomedicine, School of Medicine, University of Barcelona, Barcelona 08036, Spain. 9) Department of Clinical and Molecular Medicine, Norwegian University of Science and Technology, Trondheim, Norway. 10) The Liaison Committee for Education, Research and Innovation in Central Norway, Trondheim, Norway. 11) Department of Environment and New Resources, SINTEF Ocean, N-7010 Trondheim, Norway. 12) Weston Park Cancer Centre, Department of Oncology and Metabolism, University of Sheffield, Sheffield S10 2RX, UK. 13) Spanish Network on Rare Diseases (CIBERER), Madrid, Spain. 14) Department of Experimental Medical Science, Lund University, SE-221 00 Lund Sweden * Corresponding authors T.V. torkild.visnes@sintef.no, T.H. t.helleday@sheffield.co.uk † Contributed equally 2 Supplementary Figures Supplementary Fig. S1: Colony size is decreased in OGG1-knockout cells. A. Colour contrasted HEK293T or HEK293T(KO) colonies from scanned 6 well plates. Colonies were grown for 8 days from seeding. B. Colonies (%) relative to parental HEK293T. C. Colony area measured in pixels for OGG1 proficient HEK293T or CRISPR-Cas9 OGG1 knockout (KO). Data are average ±SEM of 4 technical replicates from 2 independent experiments. Statistical significance was determined using Mann Witney test (ns, non-significant; ****, P<0.0001), in all cases comparing against the distribution of the corresponding wild-type cell line. 3 Supplementary Fig. S2: Bioluminescence imaging of A3 xenograft tumors. Ten million A3 cells stably expressing luciferase and the indicated doxycycline-inducible shRNA constructs were injected in mice and added doxycycline in the drinking water. Animals were imaged at the indicated times after doxycycline supplementation. A. Animals injected with a non-targeting shRNA construct. B. Animals injected with a non-targeting shRNA construct and supplemented with doxycycline in the drinking water. C. Animals injected with an OGG1-targeting shRNA construct. D. Animals injected with an OGG1- targeting shRNA constructs supplemented with doxycycline in the drinking water. The colours indicate intensity of bioluminescence, overlaid with a black and white photograph of the mice. 4 Supplementary Fig. S3: 'X-ray crystal structure of hOGG1 (grey) in complex with ligand TH5487 (green). A. Overall structure of human OGG1 in complex with TH5487. B. Close-up on the ligand-binding site. C-terminus, and important residues in the binding site are marked, electron density map around TH5487 shown as a blue mesh (2Fo-Fc map at 2σ level). 5 Supplementary Fig. S4: OGG1 inhibitors selectively inhibt cancer cell line proliferation A. TH5796 and TH6943 inhibit OGG1 activity in vitro. OGG1 enzyme was treated with the indicated concentration inhibitor in technical duplicates. The line connects the average values. TH5796 inhibits OGG1 with an IC50 of 766 nM, whereas the corresponding value for TH6943 is 170 nM.1 nM OGG1 was incubated with the indicated concentrations of TH5796 or TH6943 and 10 nM 8oxoA:C substrate in the presence of 2 nM APE1 as described. B. Chemical structure of TH5487 and the analogues described in this work. C. Correlation between TH5487 EC50 values and TH5796 or TH6943. Cell lines were treated for five days as in D, E, and F, and data are displayed as average EC50 values from 1–5 independent experiments. The lines indicate the best fit linear regression line, and R2 the corresponding coefficient of determination. D. to F. Cancer cell selectivity for TH5487 (D), TH5796 (E) and TH6943 (F). Cell lines were treated as in Fig. 3E, and each point represents the EC50 value determined from 1–5 independent 6 experiments (Supplementary Table S1). G. TH5487 does not affect proliferation of activated PBMCs. PBMCs from two donors were activated using Dynabeads and exposed to 10 µM TH5487 during 72 h to follow cell numbers. H. TH5487 is well tolerated by T-cells. CD3+ T-cells were activated with Dynabeads and treated with DMSO or TH5487 for 6 days, or 25 µM camptothecin for 24 h as a technical control. Survival was assessed by flow cytometry. Data are three technical replicates from one donor, representative of four individuals. Paired, two-sided T-tests were used to assess significance (ns, non- significant, ****, P<0.0001). I. to K. Gating strategy for identification of dead cells. CD3+ cells were stained with Annexin V and Sytox Blue. Double-negative cells were designated as alive. The example plots show activated CD3+ cells treated with camptothecin (I), DMSO (J) and TH5487 (K). 7 Supplementary Fig. S5: Off-target evaluation in A3 cells and HEK293T. A. Effects on proliferation of TH5487 in OGG1 downregulated A3 cells. Cells were treated with doxycycline and/or 10 µM TH5487 for 96 h. Data are average ±SD of two technical replicates and are representative of three independent experiments. B. Effects on viability (living cells (%)) of TH5487 in OGG1 downregulated cells. Data are average ±SD of two technical replicates and are representative of two independent experiments. Statistical significance was determined using unpaired, two-sided T-tests (ns, non-significant, *, P<0.05, **, P<0.01, ***, P<0.001 and ****, P<0.0001). C. Western blot showing OGG1 protein levels in A3 expressing shNT or sh2 and sh3 after doxycycline treatment, TH5487, or combination (doxycycline and TH5487). D. Comparative bar graph with quantification from two independent Western blots. E. Effect of TH5487 on colony formation in HEK293T cells. The number of colonies (%) is relative to that of 8 untreated parental HEK293T. Data are average ±SEM of 4 technical replicates from 2 independent experiments. F. Comparative analysis of the colony area (pixels) for HEK293T or HEK293T(KO) cells exposed for eight days to TH5487 or DMSO. Data are average ±SEM of 4 technical replicates from 2 independent experiments. Statistical significance was determined using Mann Witney test (**, P<0.01, ***, P<0.001 and ****, P<0.0001, ns, non-significant). Supplementary Fig. S6: 8-oxodG levels and cell cycle distribution. A. 8-oxodG accumulation in A3 knockdown cells. The indicated shNT cells were treated with 250 ng/ml doxycycline for 0, 96, or 144 h, and the amount of genomic 8-oxodG was quantified with LC-MS/MS. As positive control, A3 shNT cells were treated with 20 mM KBrO3 for 1 h (yellow bar). Data are average ±SD of five or six replicates from two independent experiments. B. Cell cycle distribution of OGG1 inhibited A3 cells. Cells were treated with 10 µM TH5487 or an equivalent volume DMSO for the indicated times, and the cell cycle distribution was determined by flow cytometry. Data points represent independent experiments (n=3). C. A3 shNT (grey), sh2 (blue), and sh3 (red), were treated with 250 ng/ml doxycycline for 48–120 h, and the cell cycle distribution was determined with flow cytometry. Data points represent technical replicates from two independent experiments. Statistical significance was determined using unpaired, two-sided T-tests (ns, non-signifant, ****, P<0.0001). 9 Supplementary Fig. S7: EdU incorporation in OGG1 perturbed A3 cells. A. Cells harboring the indicated shRNA constructs were treated with doxycycline for 48, 96 and 144 h and pulsed with EdU for 20 minutes before fixation, followed by Alexa-488 conjugation by click chemistry and quantitation by flow cytometry. OGG1 depletion caused a decrease in EdU positive cells 4 days after addition of doxycycline. Data are average ±SD of duplicate cultures, representative of two independent experiments. B. EdU incorporation in A3 cells treated with 10 μM TH5487. C. Gating strategy for identification of EdU positive cells. The dot plots indicate cells treated for 72 h with DMSO (left), and 10 µM TH5487 (right). In A and B, data are average ±SD of duplicate cultures representative of two independent experiments. Statistical significance was determined using unpaired, two-sided T-tests (*, P<0.05, **, P<0.01 and ***, P<0.001). 10 Supplemental Fig S8. Transcriptional changes induced by TH5487 treatment. A. Volcano plot displaying the transcriptional changes induced by 24 h of 10 µM TH5487. Transcripts with p<10e-15 and a log2 fold change of more than 0.75 are displayed in red. P values have been adjusted for multiple testing using the Benjamini-Hochberg method. B. Gene Set Enrichment Analysis (GSEA) results. Gene Ontology Gene Sets were taken from the MSigDB (C5: GO gene sets, v7.1). Upregulated gene sets are colored in red, downregulated ones in blue. Gene sets with a Benjamini-Hochberg adjusted P < 0.05 are displayed. C. Gene Ontology term enrichment map of the results of the GSEA. Nodes represent GO terms. Node size indicates the number of genes attributed to each GO term. Edges thickness indicates the amount of genes shared between two GO terms. Upregulated gene sets are colored in red, downregulated gene sets are colored in blue. Only GO terms with p<0.01 are shown. Clusters of common GO terms are named manually. 11 Supplementary tables Supplementary Table S1: Effect of OGG1 inhibitors on cancer and non-transformed cell lines. Cell lines were incubated with a dilution series of the indicated compounds for 5 days, and viability assessed with resazurin. EC50-values were calculated based on the resulting dose-response curves. The number of independent experiments is indicated for each value. Cell line and Type C=cancer;N=non- transformed Disease TH5487 TH5796 TH6943 EC50 (µM) n= EC50 (µM) n= EC50 (µM) n= 786-0 C Kidney adenocarcinoma 29.7 2 15.2 2 33.0 2 A3 C T-cell acute lymphoblastic leukemia 10.0 12 7.9 7 9.8 5 A498 C Kidney carcinoma 28.5 2 21.2 2 35.1 2 ACHN C Kidney adenocarcinoma 2.3 3 8.5 1 2.8 3 BJ-Ras C RAS-transformed fibroblast 4.8 3 15.1 3 14.1 2 BJ-Tert N Tert-Immortalized fibroblast 33.7 3 24.4 3 30.5 2 CCD841 N Non-transformed fibroblast 43.3 2 39.7 3 54.2 2 CCRF-CEM C T-cell acute lymphoblastic leukemia 13.0 5 10.5 2 7.9 2 Daudi C Burkitt's lymphoma 16.6 3 10.1 2 12.1 2 DU145 C Prostate carcinoma 13.2 3 10.7 2 3.1 2 H460 C Large cell lung carcinoma 10.1 3 14.4 3 16.5 3 HCT116 C Colorectal carcinoma 17.5 3 14.7 3 28.6 2 HCT116+Chr3 C Colorectal carcinoma with WT Chr3 20.6 2 16.7 2 20.3 2 Hec59 C Endometrioid adenocarcinoma 17.0 2 11.5 2 Hec59+Chr2 C Endometrioid adenocarcinoma with WT Chr2 15.7 2 17.3 2 HeLa C Cervix adenomcarcinoma 19.3 3 15.8 2 34.9 2 HL-60 C Acute promyelocytic leukemia 15.9 4 14.4 1 23.9 1 HT-29 C Colorectal adenocarcinoma 24.5 3 22.6 3 22.0 1 Jurkat C T-cell acute lymphoblastic leukemia 10.5 5 13.8 2 15.2 2 K562 C Chronic myelogenous leukemia 16.7 5 21.0 4 KG1a C Acute myelogenous leukemia 14.3 2 18.0 1 18.8 1 LCL#1 N Non-transformed lymphoblastoid cell line 31.1 5 33.5 4 40.0 2 LCL#2 N Non-transformed lymphoblastoid cell line 27.7 5 40.7 4 32.3 3 M059J C Glioblastoma 26.1 3 20.6 3 29.4 3 M059K C Glioblastoma 20.3 4 19.4 4 27.0 4 MCF7 C Breast adenocarcinoma 23.3 2 26.5 3 MEF Ogg1(-/-) N Non-transformed mouse embryonic fibroblast 47.7 4 45.8 3 34.3 3 MOLT4 C T-cell acute lymphoblastic leukemia 13.2 6 12.6 2 17.4 3 MRC5 N Non-transformed lung fibroblast 42.4 2 20.8 2 47.1 2 MV4-11 C Acute monocytic leukemia 7.8 5 6.5 2 9.6 2 NB-4 C Acute promyelocytic leukemia 4.8 5 11.5 3 PC3 C Prostate adenocarcinoma 32.6 4 19.3 2 28.7 3 PL-21 C Acute myeloid leukemia 20.6 6 10.2 3 18.4 3 Raji C Burkitt's lymphoma 19.0 4 20.5 2 23.4 2 Rec1 C B cell non-Hodgkin's lymphoma 13.7 4 12.6 2 14.8 3 Reh C Acute lymphocytic leukemia (non-T, non-B) 18.3 3 14.7 3 17.3 2 RFX393 C Kidney carcinoma 19.6 2 14.2 2 11.7 2 SaOS2 C Osteosarcoma 21.4 3 16.2 3 19.8 3 SW1271 C Small cell lung carcinoma 22.0 2 24.6 2 SW480 C Colorectal adenocarcinoma 33.3 3 20.3 4 29.8 2 T98G C Glioblastoma 14.5 2 18.5 2 16.7 2 THP1 C Acute monocytic leukemia 17.8 4 19.2 2 U2OS C Osteosarcoma 19.5 5 16.1 4 25.1 2 UO31 C Kidney carcinoma 2.9 3 7.1 3 3.2 3 VH10 N Non-transformed fibroblast 32.4 2 20.9 2 47.5 1 12 Supplementary Table S2: List of primers for used in this study (Figure 6F) Gene Sequence MCM7-F ACCGAGACAATGACCTAC MCM7-R GCTATGTAACGCCTCATG MCM6-F ACTGTTCCTGGACTTCTTGG MCM6-R ACGAATCAGTTCCTCTGCTAAT MCM5-F GTTTGACAAGATGCGAGAA MCM5-R CCTTGGCGATAGAGATGG MCM2-F AGGCAGCATCCCCATTAC MCM2-R TCACATAGTCCCGCAGAT FEN1-F GCCAATCCAGGAATTCCACC FEN1-R GATTCGCTCCTCAGAGAACTGCTT MCM3-F GAGTGAATCCAGGTTGAAGG MCM3-R GATTCTGTGAGGCGATTCAT PCNA-F CCATCCTCAAGAAGGTGTTGG PCNA-R ATAAAATTGCGGATATGGGACAC MCM4_F TCACCACTGACATACGGCAC MCM4_R GTGTGCCCCTAACACCACTT 13 Supplementary Table S3: X-ray crystallography – data collection and refinement statistics. a Values in parentheses are for highest-resolution shell. b Values for each molecule of the asymmetric unit. hOGG1:TH5487 Data collection PDB code 6RLW Station DLS-I04 Space group P41212 Cell dimensions a, b, c (Å) 86.4, 86.4, 432.4    () 90.0, 90.0, 90.0 Resolution (Å) 2.00-86.4 (2.00-2.03)a No. total / unique reflections 2,446.343 / 112,319 Rmerge 0.096 (1.22)a Rpim 0.029 (0.39)a CC1/2 1.00 (0.85)a I / I 16.5 (2.7)a Completeness (%) 100.0 (99.9)a Redundancy 21.8 (20.6)a Wilson B factor 32.6 Refinement No. reflections used 106,369 Rwork / Rfree (%) 23.0 / 27.6 B-factors Protein (all atoms)b 38.1 / 40.1 / 47.3 / 53.4 / 45.4 Ligandb 32.1 / 51.4 / 68.0 / 67.7 / 45.3 Water 45.2 R.m.s. deviations Bond lengths (Å) 0.005 Bond angles () 1.29 Ramachandran statistics Favored (%) 95.8 Outliers (%) 0.00