GWAS and meta-analysis identifies 49 genetic variants underlying critical COVID-19 In the format provided by the authors and unedited Nature | www.nature.com/nature Supplementary information https://doi.org/10.1038/s41586-023-06034-3 GWAS and meta-analysis identifies 49 genetic variants underlying critical COVID-19 In the format provided by the authors and unedited Nature | www.nature.com/nature Supplementary information https://doi.org/10.1038/s41586-023-06034-3 Supplementary material - GWAS and meta-analysis identifies 49 genetic variants underlying critical Covid-19. Contents 1 Comorbidity 2 2 Gene level analysis 2 3 Sex Stratified GWAS 5 4 TWAS 6 5 Drugs in consideration by UK-CTAP 8 6 Description of cohorts 9 6.1 Critical and hospitalisation meta-analysis cohorts . . . . . . . . . . . . . . . . . . . . . . . 9 7 Full GWAS results tables 11 7.1 Forest plots . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16 8 Mendelian randomisation for Protein expression (INTERVAL) 25 9 Mendelian randomisation for RNA expression (eQTLgen) 25 10 Fine mapping 42 11 Change in allele frequency over time 60 12 Contributing Studies 65 12.1 Ethical approval . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65 12.2 GenOMICC and ISARIC4C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65 12.3 SCOURGE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69 12.4 HGI release 6 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69 12.5 23andMe . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71 13 Contributors 71 13.1 GenOMICC Investigators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71 13.2 SCOURGE Consortium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89 13.3 23andMe Investigators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95 13.4 ISARIC4C Investigators . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95 References 98 1 1 Comorbidity Supplementary Table 7: Comorbities in a subset of GenOMICC cases who were also recruited to the ISARIC4C study in the UK providing electronic health care record linkage. Name Cases N Percentage Chronic Cardiac Disease 1009 7573 13 Hypertension 2962 6933 43 Chronic Pulmonary Disease (not Asthma) 655 7579 9 Asthma (physician diagnosed) 1443 7641 18 Chronic Kidney Disease 582 7585 8 Chronic Neurological Disease 322 7583 4 Malignent Neoplasm 346 7572 5 Chronic Hematological Disease 184 7569 2 AIDS/HIV 48 7406 <1 Obesity 2377 7105 33 Diabetes 988 7163 14 Rheumatologic Disorder 633 7572 8 Dementia 30 7604 <1 Malnutrition 49 7356 <1 Supplementary Table 8: Comorbities in 3533 hospitaized cases in the GenOMICC Brazil cohort. This information has been previously presented.1 Comorbidity N % Not Available 1514 43 Hypertension 1937 55 Cardiovascular D 996 30 ACEi users 395 14 Asthma 172 4.9 Tabagism 833 24 COPD 213 6.1 Diabetes mellitus type 2 1238 35 HIV 33 0.9 CKD 441 13 BMI status: Obese (BMI of 30kg/m2or greater) 735 36 Overweight (BMI of 25–29.9kg/m2) 683 34 Normal (BMI of 20–24.9kg/m2) 489 24 BMI of 20kg/m2or lower 113 5.6 Oncologic 170 4.9 Autoimmune diseases 101 2.9 Supplementary Table 9: Comorbidities in 9371 individuals in the SCOURGE cohort. This information has been previously presented.2 Comorbidity N % Vascular/endocrinological 4099 44 Cardiac 1057 11 Nervous 773 8.3 Digestive 264 2.8 Onco-hematological 647 6.9 Respiratory 905 9.7 2 Gene level analysis 2 Supplementary Table 10: Gene level association results, showing genes with significant association after Bonferroni correction, with full results in Supplementary Material (Supplementary Table 6). Chr:pos𝑠𝑡𝑎𝑟𝑡 (b38): chromosome and start BP position on human genome build 38; P𝑔𝑒𝑛𝑒: mBAT-combo gene level association P value; N𝑠𝑛𝑝𝑠: number of SNPs used in association test for gene; Lead SNP: lead variant amongst variants used in test for gene level association; P𝐿𝑒𝑎𝑑𝑆𝑁𝑃 : association P value for lead variant. Gene Symbol Chr:pos𝑠𝑡𝑎𝑟𝑡 (b38) P𝑔𝑒𝑛𝑒 N𝑠𝑛𝑝𝑠 Lead SNP P𝐿𝑒𝑎𝑑𝑆𝑁𝑃 PMVK 1:154924740 1.3×10-14 212 1:154945075:C:T 1×10-8 PBXIP1 1:154944076 7.3×10-16 207 1:155003661:G:T 1.1×10-10 PYGO2 1:154957026 4.3×10-19 191 1:155003661:G:T 1.1×10-10 SHC1 1:154962298 1.7×10-19 203 1:155003661:G:T 1.1×10-10 CKS1B 1:154974653 1×10-19 188 1:155003661:G:T 1.1×10-10 FLAD1 1:154983338 2.6×10-23 198 1:155003661:G:T 1.1×10-10 LENEP 1:154993586 4.3×10-23 165 1:155003661:G:T 1.1×10-10 ZBTB7B 1:155002630 2.2×10-29 185 1:155068178:C:T 2×10-13 DCST2 1:155018520 1.7×10-29 199 1:155068178:C:T 2×10-13 DCST1 1:155033824 4.6×10-40 219 1:155090454:C:G 5.1×10-14 ADAM15 1:155050566 4.9×10-45 216 1:155090454:C:G 5.1×10-14 EFNA4 1:155063737 4.9×10-47 226 1:155090454:C:G 5.1×10-14 ENSG00000251246 1:155063748 1.1×10-48 271 1:155090454:C:G 5.1×10-14 EFNA3 1:155078837 1.9×10-49 237 1:155090454:C:G 5.1×10-14 EFNA1 1:155127876 5.4×10-39 254 1:155175305:G:A 1.6×10-15 SLC50A1 1:155135344 2.3×10-37 246 1:155175305:G:A 1.6×10-15 DPM3 1:155139891 8.7×10-36 235 1:155175305:G:A 1.6×10-15 KRTCAP2 1:155169408 2.1×10-38 201 1:155197995:A:G 6.6×10-24 ENSG00000273088 1:155169409 5.5×10-37 229 1:155197995:A:G 6.6×10-24 TRIM46 1:155173787 3.1×10-36 207 1:155197995:A:G 6.6×10-24 MUC1 1:155185824 2.7×10-32 196 1:155197995:A:G 6.6×10-24 THBS3 1:155195588 1×10-33 219 1:155197995:A:G 6.6×10-24 MTX1 1:155208695 1.4×10-33 194 1:155197995:A:G 6.6×10-24 GBA 1:155234452 4.2×10-30 196 1:155197995:A:G 6.6×10-24 FAM189B 1:155247205 3×10-29 202 1:155197995:A:G 6.6×10-24 SCAMP3 1:155255979 1.2×10-18 196 1:155212198:G:A 3.6×10-14 CLK2 1:155262868 9.2×10-17 206 1:155237942:C:T 1.7×10-13 HCN3 1:155277463 3.3×10-18 208 1:155237942:C:T 1.7×10-13 PKLR 1:155289293 4.4×10-18 203 1:155296105:G:A 2×10-8 FDPS 1:155308748 3.4×10-15 186 1:155355915:G:GT 2×10-9 RUSC1 1:155320894 9.1×10-15 171 1:155355915:G:GT 2×10-9 ASH1L 1:155335268 1.1×10-21 419 1:155419726:T:C 7.3×10-10 MSTO1 1:155610205 5.4×10-17 120 1:155623087:G:A 1.5×10-10 YY1AP1 1:155659443 2.6×10-23 164 1:155706701:A:G 9.3×10-12 DAP3 1:155687960 1.3×10-19 226 1:155706701:A:G 9.3×10-12 GON4L 1:155749659 3.2×10-17 379 1:155863616:T:C 1.7×10-12 SYT11 1:155859567 3.5×10-18 236 1:155863616:T:C 1.7×10-12 RIT1 1:155897808 4.1×10-17 214 1:155863616:T:C 1.7×10-12 KHDC4 1:155913045 3×10-16 208 1:155863616:T:C 1.7×10-12 RXFP4 1:155941638 3.5×10-8 171 1:155927586:C:G 8.4×10-8 ARHGEF2 1:155946851 1.3×10-15 292 1:156014716:A:G 2.3×10-11 SSR2 1:156009048 2.3×10-13 199 1:156014716:A:G 2.3×10-11 UBQLN4 1:156035299 6.2×10-13 221 1:156014716:A:G 2.3×10-11 LAMTOR2 1:156054782 1.7×10-11 184 1:156014716:A:G 2.3×10-11 RAB25 1:156061160 1×10-8 206 1:156014716:A:G 2.3×10-11 MEX3A 1:156072013 5.1×10-8 248 1:156075211:G:T 1.8×10-9 LMNA 1:156082573 5.5×10-7 372 1:156075211:G:T 1.8×10-9 SEMA4A 1:156147366 3.1×10-7 367 1:156107888:C:T 1.8×10-8 SLC25A44 1:156193932 2×10-7 307 1:156155844:A:G 7×10-6 PMF1-BGLAP 1:156212982 1.6×10-6 357 1:156225891:G:A 4×10-5 PMF1 1:156212993 9.4×10-7 347 1:156225891:G:A 4×10-5 BCL11A 2:60450520 5.8×10-7 537 2:60480453:A:G 9.2×10-15 LARS2 3:45388561 2.6×10-15 854 3:45587795:G:A 1×10-32 LIMD1 3:45555394 2.4×10-32 896 3:45632867:A:G 4.8×10-38 SACM1L 3:45689056 1.5×10-69 611 3:45756734:C:T 1.4×10-42 SLC6A20 3:45755449 3.5×10-217 412 3:45818159:G:A 4.4×10-254 LZTFL1 3:45823316 1.8×10-209 544 3:45818159:G:A 4.4×10-254 CCR9 3:45886509 7.3×10-197 341 3:45847198:A:G 1.3×10-252 FYCO1 3:45917903 3.2×10-112 629 3:45868152:C:A 1.9×10-181 CXCR6 3:45940933 3.1×10-114 355 3:45912847:C:T 1.9×10-139 XCR1 3:46016990 4×10-96 758 3:45981341:G:A 1.2×10-136 CCR3 3:46130890 5.9×10-92 974 3:46081551:A:G 1.2×10-124 CCR1 3:46201711 2.5×10-44 416 3:46237659:C:T 5.3×10-66 CCR2 3:46353864 2.7×10-46 411 3:46347209:C:T 1.5×10-61 CCR5 3:46370946 5.3×10-45 422 3:46347209:C:T 1.5×10-61 CCRL2 3:46407166 7.5×10-43 477 3:46366689:C:A 1.7×10-46 LTF 3:46435645 9×10-27 586 3:46422383:G:A 7.1×10-34 RTP3 3:46494611 1.7×10-13 367 3:46444801:G:A 2.1×10-25 LRRC2 3:46515385 9.3×10-12 792 3:46522300:A:G 5.3×10-25 TDGF1 3:46574534 2.3×10-12 548 3:46532185:A:G 1.7×10-20 ENSG00000283877 3:46581150 1.1×10-10 644 3:46532185:A:G 1.7×10-20 FAM240A 3:46612525 2×10-7 530 3:46610496:A:G 2.1×10-19 MECOM 3:169083499 8.3×10-9 2630 3:169079990:C:T 5.8×10-8 P4HA2 5:132190147 5.2×10-7 684 5:132282906:C:T 2.4×10-6 SLC22A4 5:132294394 1.3×10-6 591 5:132282906:C:T 2.4×10-6 SLC22A5 5:132369710 2.8×10-7 465 5:132422622:A:G 2.7×10-10 C6orf15 6:31111223 4.8×10-10 1342 6:31153604:G:C 9.8×10-27 PSORS1C1 6:31114750 2.1×10-11 1681 6:31153604:G:C 9.8×10-27 CDSN 6:31115087 2.3×10-10 1379 6:31153604:G:C 9.8×10-27 3 Gene Symbol Chr:pos𝑠𝑡𝑎𝑟𝑡 (b38) P𝑔𝑒𝑛𝑒 N𝑠𝑛𝑝𝑠 Lead SNP P𝐿𝑒𝑎𝑑𝑆𝑁𝑃 PSORS1C2 6:31137534 2×10-12 1419 6:31153604:G:C 9.8×10-27 CCHCR1 6:31142439 4×10-12 1713 6:31153604:G:C 9.8×10-27 TCF19 6:31158547 5.4×10-12 1636 6:31153604:G:C 9.8×10-27 POU5F1 6:31164337 2.4×10-11 1759 6:31153604:G:C 9.8×10-27 HLA-C 6:31268749 6.5×10-9 2593 6:31276554:C:T 6×10-15 HLA-B 6:31353872 1.8×10-8 2952 6:31306250:C:T 2.3×10-13 MICA 6:31399784 9.8×10-10 2400 6:31461190:G:A 1.7×10-14 MICB 6:31494881 2×10-10 1314 6:31461190:G:A 1.7×10-14 MCCD1 6:31528962 7.7×10-9 955 6:31539985:CCT:C 1.2×10-12 DDX39B 6:31530219 3.4×10-9 1000 6:31539985:CCT:C 1.2×10-12 ATP6V1G2- DDX39B 6:31530219 2.5×10-9 1032 6:31539985:CCT:C 1.2×10-12 ATP6V1G2 6:31544444 2×10-10 852 6:31539985:CCT:C 1.2×10-12 NFKBIL1 6:31546870 1.6×10-10 860 6:31539985:CCT:C 1.2×10-12 LTA 6:31572054 1.8×10-10 628 6:31539985:CCT:C 1.2×10-12 TNF 6:31575565 2.1×10-10 610 6:31539985:CCT:C 1.2×10-12 LTB 6:31580525 4.9×10-11 592 6:31539985:CCT:C 1.2×10-12 LST1 6:31586124 3.8×10-11 600 6:31539985:CCT:C 1.2×10-12 NCR3 6:31588895 7.5×10-11 593 6:31539985:CCT:C 1.2×10-12 AIF1 6:31615217 1.3×10-9 514 6:31571991:A:G 3.1×10-10 PRRC2A 6:31620715 1×10-9 559 6:31571991:A:G 3.1×10-10 ENSG00000289282 6:31623874 5.9×10-9 508 6:31587353:A:G 3.6×10-9 BAG6 6:31639028 1.6×10-8 524 6:31593434:T:C 8.3×10-9 APOM 6:31652416 8×10-8 450 6:31638615:G:A 1.9×10-7 C6orf47 6:31658298 1.2×10-6 427 6:31638615:G:A 1.9×10-7 GPANK1 6:31661228 1×10-6 437 6:31638615:G:A 1.9×10-7 CSNK2B 6:31665227 1.7×10-6 437 6:31638615:G:A 1.9×10-7 ENSG00000263020 6:31666102 1.1×10-6 439 6:31638615:G:A 1.9×10-7 LY6G5B 6:31670167 5.4×10-7 417 6:31638615:G:A 1.9×10-7 LY6G5C 6:31676684 3.2×10-8 416 6:31638615:G:A 1.9×10-7 ENSG00000204422 6:31686962 1.7×10-6 474 6:31638615:G:A 1.9×10-7 LY6G6F 6:31706866 4.7×10-7 378 6:31720741:T:A 2.7×10-6 LY6G6F- LY6G6D 6:31706904 5.3×10-7 407 6:31720741:T:A 2.7×10-6 MSH5 6:31739677 9.9×10-7 433 6:31720741:T:A 2.7×10-6 MSH5-SAPCD1 6:31740020 7.1×10-7 438 6:31720741:T:A 2.7×10-6 SAPCD1 6:31762996 3.5×10-7 366 6:31720741:T:A 2.7×10-6 VWA7 6:31765590 8×10-7 387 6:31720741:T:A 2.7×10-6 VARS1 6:31777518 1.4×10-6 434 6:31842089:T:G 9.8×10-6 LSM2 6:31797396 1.9×10-6 405 6:31842089:T:G 9.8×10-6 NEU1 6:31857659 1.1×10-6 420 6:31872678:A:G 3.4×10-6 SLC44A4 6:31863192 1.2×10-6 449 6:31872678:A:G 3.4×10-6 EHMT2 6:31879759 2.6×10-7 465 6:31872678:A:G 3.4×10-6 C2 6:31897785 5.3×10-7 515 6:31872678:A:G 3.4×10-6 ZBTB12 6:31899613 3.1×10-7 392 6:31872678:A:G 3.4×10-6 ENSG00000244255 6:31927698 2.9×10-7 385 6:31926167:G:A 5.1×10-6 CFB 6:31945650 1.9×10-6 309 6:31926167:G:A 5.1×10-6 NELFE 6:31952087 2.1×10-6 288 6:31926167:G:A 5.1×10-6 SKIV2L 6:31959117 1.4×10-6 266 6:31926167:G:A 5.1×10-6 DXO 6:31969810 1.8×10-6 224 6:31926167:G:A 5.1×10-6 ZKSCAN1 7:100015572 2.4×10-6 267 7:100032719:C:T 8.2×10-11 ABO 9:133233278 1×10-6 968 9:133271182:T:C 1.2×10-16 ABTB2 11:34150987 1.4×10-6 1159 11:34396323:T:C 2.4×10-12 CAT 11:34438934 1.9×10-12 684 11:34482745:G:A 6.9×10-23 ELF5 11:34478791 5.3×10-12 530 11:34482745:G:A 6.9×10-23 OAS1 12:112905856 2.2×10-7 423 12:112919637:G:A 2.2×10-15 OAS3 12:112938051 2.8×10-7 537 12:112919637:G:A 2.2×10-15 FBRSL1 12:132489551 8.7×10-9 1006 12:132481571:G:A 2.2×10-16 ATP11A 13:112690038 3.2×10-7 1191 13:112881427:C:T 7.8×10-22 ACSF3 16:89088375 1.8×10-9 935 16:89196249:G:A 3×10-16 CDH15 16:89171748 6.3×10-9 663 16:89196249:G:A 3×10-16 SLC22A31 16:89195761 1.3×10-7 579 16:89196249:G:A 3×10-16 ZNF778 16:89217703 1.5×10-7 588 16:89196249:G:A 3×10-16 LRRC3C 17:39927732 9.8×10-7 439 17:39989575:A:G 1.5×10-9 GSDMA 17:39953263 3.2×10-7 521 17:40003082:T:C 1.1×10-9 PSMD3 17:39980807 4.4×10-7 477 17:40003082:T:C 1.1×10-9 CSF3 17:40015361 5.5×10-7 370 17:40003082:T:C 1.1×10-9 MED24 17:40019097 1.5×10-6 442 17:40003082:T:C 1.1×10-9 ARHGAP27 17:45393902 2.4×10-6 422 17:45473955:G:C 1.5×10-11 PLEKHM1 17:45435900 1.1×10-6 339 17:45495053:C:T 8.8×10-15 LINC02210- CRHR1 17:45620344 1.2×10-10 1573 17:45826476:C:T 2.1×10-15 CRHR1 17:45784280 6×10-11 928 17:45826476:C:T 2.1×10-15 SPPL2C 17:45844881 9.4×10-12 665 17:45826476:C:T 2.1×10-15 MAPT 17:45894527 5×10-11 1497 17:46048999:C:T 2.6×10-16 STH 17:45999250 5.3×10-10 605 17:46048999:C:T 2.6×10-16 KANSL1 17:46029916 7.8×10-8 1398 17:46085231:C:A 1.8×10-16 NSF 17:46590669 9.4×10-8 219 17:46748690:C:G 1×10-14 WNT3 17:46762506 2.2×10-6 406 17:46748690:C:G 1×10-14 KAT7 17:49788648 2.4×10-8 266 17:49863303:C:T 8.6×10-16 TAC4 17:49838300 8.1×10-7 261 17:49863303:C:T 8.6×10-16 SEMA6B 19:4542593 4.5×10-7 582 19:4617960:C:T 4×10-12 TNFAIP8L1 19:4639516 8.2×10-12 480 19:4686976:G:T 8×10-24 MYDGF 19:4641374 1.9×10-21 522 19:4717660:A:G 8.9×10-51 DPP9 19:4675224 1.8×10-24 574 19:4717660:A:G 8.9×10-51 DNMT1 19:10133342 1.9×10-6 526 19:10271861:G:A 7.2×10-7 MRPL4 19:10251901 8.3×10-16 322 19:10305768:G:A 8×10-17 4 Gene Symbol Chr:pos𝑠𝑡𝑎𝑟𝑡 (b38) P𝑔𝑒𝑛𝑒 N𝑠𝑛𝑝𝑠 Lead SNP P𝐿𝑒𝑎𝑑𝑆𝑁𝑃 ICAM1 19:10271093 1.3×10-18 363 19:10305768:G:A 8×10-17 ICAM4 19:10286955 3.1×10-20 339 19:10305768:G:A 8×10-17 ICAM5 19:10289952 4.7×10-19 361 19:10305768:G:A 8×10-17 ZGLP1 19:10304803 6.2×10-24 355 19:10352442:G:C 2.1×10-28 ENSG00000167807 19:10305427 1.6×10-24 373 19:10352442:G:C 2.1×10-28 FDX2 19:10310045 3.6×10-25 359 19:10352442:G:C 2.1×10-28 ENSG00000267303 19:10315471 2.4×10-26 363 19:10352442:G:C 2.1×10-28 RAVER1 19:10316212 4×10-27 407 19:10352442:G:C 2.1×10-28 ICAM3 19:10333776 1.2×10-27 369 19:10352442:G:C 2.1×10-28 TYK2 19:10350529 4.8×10-30 392 19:10352442:G:C 2.1×10-28 CDC37 19:10391133 2.6×10-32 331 19:10352442:G:C 2.1×10-28 PDE4A 19:10416773 1.1×10-24 414 19:10381598:C:T 4.4×10-28 KEAP1 19:10486125 1.9×10-15 370 19:10486312:C:A 3.7×10-20 S1PR5 19:10512742 6.6×10-10 371 19:10486312:C:A 3.7×10-20 ATG4D 19:10543895 8.5×10-7 435 19:10523588:C:T 1.9×10-9 KRI1 19:10553085 4.7×10-7 457 19:10523588:C:T 1.9×10-9 CDKN2D 19:10566460 2.9×10-7 423 19:10523588:C:T 1.9×10-9 SLC44A2 19:10602457 9.3×10-7 474 19:10583892:G:A 3.6×10-9 NTN5 19:48661407 2.8×10-8 319 19:48702915:C:T 1.2×10-15 FUT2 19:48695971 1.5×10-9 339 19:48702915:C:T 1.2×10-15 MAMSTR 19:48712725 6.4×10-9 361 19:48702915:C:T 1.2×10-15 RASIP1 19:48720585 5.1×10-9 411 19:48702915:C:T 1.2×10-15 IZUMO1 19:48740852 6.4×10-9 385 19:48702915:C:T 1.2×10-15 FUT1 19:48748011 4.9×10-9 402 19:48702915:C:T 1.2×10-15 FGF21 19:48755524 3.8×10-8 368 19:48705608:G:A 6×10-15 BCAT2 19:48795062 1.9×10-6 460 19:48745473:G:A 9×10-12 IFNAR2 21:33205282 1.8×10-31 711 21:33237639:A:G 6.2×10-48 ENSG00000249624 21:33229892 3.1×10-34 721 21:33237639:A:G 6.2×10-48 IL10RB 21:33266367 7.8×10-34 517 21:33237639:A:G 6.2×10-48 IFNAR1 21:33324429 1.7×10-8 459 21:33287378:C:T 7.2×10-15 ENSG00000249209 21:33584687 2.1×10-7 1067 21:33949755:C:T 6.4×10-17 ITSN1 21:33642400 9.5×10-7 872 21:33949755:C:T 6.4×10-17 ATP5PO 21:33903453 1.2×10-7 425 21:33949755:C:T 6.4×10-17 3 Sex Stratified GWAS 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Genomic Position 0 1 2 3 4 5 6 -lo g 1 0 P Supplementary Figure 1: Manhattan plot for tests for differences in effects between sexes at each genetic variant. We tested for differences between effects of meta analyses of sex specific GWAS from GenOMICC and SCOURGE. 5 4 TWAS Supplementary Table 11: Selected TWAS results for lung, whole blood, monocytes, and metaTWAS with 𝑃𝑚𝑒𝑡𝑎 < 1×10−5 (See Supplementary Table 2 for full results). Gene: Gene symbol; 𝑍𝑙𝑢𝑛𝑔: TWAS Z-score in lung; 𝑍𝑏𝑙𝑜𝑜𝑑: TWAS Z-score in blood; 𝑍𝑚𝑜𝑛𝑜: TWAS Z-score in monocytes; 𝑍𝑚𝑒𝑡𝑎: metaTWAS mean Z-score; 𝑍𝑆𝐷: metaTWAS Z-score standard deviation, 𝑛𝑚𝑒𝑡𝑎: number of SNPs included in metaTWAS; 𝑃𝑚𝑒𝑡𝑎: metaTWAS P-value. Gene 𝑍𝑙𝑢𝑛𝑔 𝑍𝑏𝑙𝑜𝑜𝑑 𝑍𝑚𝑜𝑛𝑜 𝑍𝑚𝑒𝑡𝑎 𝑍𝑆𝐷 𝑛𝑚𝑒𝑡𝑎 𝑃𝑚𝑒𝑡𝑎 FYCO1 8.9 3.9 4.2 4.2 47 9.5×10-46 IL10RB 8.9 -3.1 7.4 4 46 2.3×10-34 FOXP4 8.7 0.12 2 28 1×10-15 ATP5O 7 2.8 3.7 1.7 47 3.2×10-13 FUT2 6.6 0.37 5.4 28 4.7×10-13 TCF19 6.1 4.8 4.7 2.9 49 1.5×10-12 GSDMA 5.9 0.22 5.8 3.8 2.2 38 1.7×10-6 TYK2 5.8 7.7 2.7 3.8 45 9.5×10-18 ELF5 5.8 3.7 1.7 9 2.5×10-8 SLC6A20 5.7 9.3 6.3 33 3.4×10-229 MUC1 5.5 7.1 5 2.9 42 2.2×10-25 ABO 5.1 -1.5 -6.7 3.7 1.9 48 4.7×10-7 RAB2A 5 3.7 4.9 4.7 0.84 45 1.3×10-6 TOMM7 4.7 3.4 4.6 4.2 0.85 49 2.3×10-6 HLA-C 4.5 6.3 2.8 2.6 48 2.6×10-15 RP11-387H17.6 4.4 2.6 3.1 5 5.3×10-6 CAT 4.2 2.9 2.9 2.2 49 9.1×10-14 ZNF778 4.1 0.19 0.76 2.2 49 6.4×10-7 CDH15 4.1 1.9 2.9 34 2.2×10-7 HIP1 4.1 -5.8 0.94 1.7 42 1.8×10-7 ACSF3 3.8 1.1 4.7 1.8 2 48 1.4×10-9 CCHCR1 3.7 3.9 3.3 2.3 49 9.7×10-14 FBRSL1 3.4 1.9 0.87 3.5 45 5.8×10-10 ACSL6 3 4.6 -0.38 3.6 44 4.8×10-7 CCR1 3 -1.5 3.4 7.6 47 3.9×10-53 HLA-DPA1 3 1.1 -0.81 1.5 37 1.1×10-6 RP11-11C20.3 3 3.2 0.51 32 9.6×10-6 MTX1 3 -0.85 1.1 3.9 36 2.9×10-30 IRF7 2.7 0.075 -1.7 1.9 44 9.6×10-7 HLA-A 2.7 -0.96 1.4 2.3 46 8.4×10-6 FAM215B 2.7 -1.2 4 7 5.7×10-11 HLA-F 2.6 2.8 1.1 1.9 45 6.7×10-6 FUT1 2.1 2.8 2.5 27 2.6×10-7 SLC50A1 2.1 1.6 0.7 1.8 49 3×10-15 FAM83H 2.1 -0.89 0.99 1.4 48 2.3×10-7 DDX39B 1.8 3.3 0.25 2.4 41 7.1×10-13 FDX2 1.8 -1.2 -2.8 2.4 48 1.3×10-12 CCR2 1.7 0.88 -10 6 7.8 35 4.6×10-44 HLA-DRA 1.5 0.89 1.9 31 2.6×10-6 SACM1L 1.4 1 1.9 2.7 44 5.7×10-10 SEMA6B 0.7 2.1 0.23 2 26 6.7×10-6 PSMD3 0.47 0.48 4.7 0.23 2.1 40 2.3×10-8 OAS3 0.24 4 0.32 4.2 37 4.2×10-9 SFTPD 0.17 3 1.9 47 1.5×10-6 BTNL2 0.1 -0.5 2.4 21 2.4×10-7 LZTFL1 -0.071 -2.6 -2.6 8 45 2.5×10-119 MCM6 -0.094 0.79 2.3 44 3.9×10-6 PSORS1C1 -0.28 -0.61 2.3 48 1.2×10-9 SLC5A3 -0.3 0.22 2.1 21 3.7×10-7 SLC35B1 -0.31 -0.31 1.4 3 46 3.5×10-11 NAPSA -0.56 -6.8 -6.2 1.9 39 7.1×10-11 LRRC37A2 -0.59 -5.9 -0.15 3.6 6 3.4×10-13 KCNC3 -0.73 -6.2 2.1 1.9 45 4.1×10-6 C5orf56 -0.92 -2.5 -1.7 1.9 38 1.6×10-10 MED24 -0.95 5 5.3 2.4 3.4 46 1.3×10-7 MICB -1 -1.8 -0.86 1.5 49 2.4×10-10 LTF -1.1 -0.93 2.2 37 2.9×10-16 RIT1 -1.2 -4.2 -2.3 1.4 48 3.7×10-7 DCST2 -1.2 -3.3 -0.88 1.6 49 7.2×10-11 DPP9 -1.2 -5.5 -3.8 4 45 9.9×10-41 ATP11A -1.2 -3.5 -1.7 3.2 42 2.8×10-11 PMVK -1.5 -0.9 -1.4 2.4 48 8.9×10-6 MAMSTR -1.7 5.7 -1.9 3.6 45 4×10-9 ZKSCAN1 -1.9 -1.9 -1.1 2.1 43 1.6×10-6 DDAH2 -2.1 2.7 -0.25 2.4 44 1.9×10-6 TNFAIP8L1 -2.2 -1.5 -1 2.1 36 1.7×10-8 XCR1 -2.4 5.8 7.7 -0.49 6.1 23 9.9×10-117 XXbac- BPG181B23.7 -2.5 -4.2 -1.1 1.6 38 1.8×10-8 EFNA1 -2.5 -6.6 0.044 2.6 48 2.3×10-7 IZUMO1 -2.6 -2.2 2.1 43 2.8×10-7 CCRL2 -2.9 2.8 6 30 2.8×10-33 PDE4A -3.2 -0.49 4.6 -2.7 3 47 1×10-9 ICAM3 -3.2 -2 -1.5 1.7 34 3.3×10-9 RAVER1 -3.4 6.1 -0.53 2.2 45 9.1×10-9 NXPE3 -3.5 -4.4 -2.3 2 47 9.6×10-7 6 Gene 𝑍𝑙𝑢𝑛𝑔 𝑍𝑏𝑙𝑜𝑜𝑑 𝑍𝑚𝑜𝑛𝑜 𝑍𝑚𝑒𝑡𝑎 𝑍𝑆𝐷 𝑛𝑚𝑒𝑡𝑎 𝑃𝑚𝑒𝑡𝑎 NPNT -3.9 -0.48 1.6 2.6 48 1.5×10-8 ZGLP1 -4 4 -4 2.6 45 6.3×10-14 ICAM5 -4.1 1.7 -6.4 -3.6 3.5 47 4.2×10-10 PSORS1C2 -4.2 -2.5 1.9 39 1.6×10-12 IFNAR1 -4.4 -2.4 -2.4 2.4 49 3.9×10-6 OAS1 -4.7 -3.3 -2.9 1.8 41 2.7×10-9 STK19 -4.9 -3.3 -3.2 1.1 43 2.7×10-6 NTN5 -5 3.6 -3.7 3.2 47 4.3×10-10 LINC01301 -5 -4.3 1.1 38 5.6×10-6 JAK1 -5.3 1.3 -1.7 3.4 47 1.8×10-6 RASIP1 -5.3 -5.3 -4.8 1.9 32 2.9×10-8 IFNAR2 -5.3 -3.8 -4.4 6.9 48 5×10-51 CEP97 -5.5 0.36 -1.7 2.8 17 8.2×10-7 CSF3 -5.7 -4 2 38 4.7×10-7 CCR3 -6.1 -1.8 -6.9 -9 5.9 6 2.4×10-64 ADAM15 -6.4 3 2.4 2.1 46 2.3×10-15 ARHGAP27 -6.4 3.6 0.11 5.1 44 2.4×10-9 WNT3 -7.6 -7 -4.7 2.3 47 1.3×10-10 CCR5 -16 2.4 -6.9 -3.5 3.7 46 1.5×10-51 CXCR6 -21 -6.9 -8 9.6 38 1.1×10-134 CCR9 31 13 11 7 2.6×10-223 HLA-B 2.8 -0.36 2.2 44 2×10-8 ICAM1 2.7 2.6 1.2 7 6.6×10-6 GPC2 2.7 -0.87 1.8 43 5.1×10-6 LINC02009 2.5 1.7 3.8 35 5.2×10-16 FNIP1 1.4 -1 2.4 11 1.1×10-6 MRPS6 0.97 -1.2 2.5 13 3.4×10-10 ZBTB7B 0.59 1.4 1.8 23 2.7×10-6 PBXIP1 -0.95 0.58 1.3 16 1.8×10-7 LTA -1.5 -2.4 3.2 38 7.4×10-8 TRIM46 5.8 5.1 18 5.4×10-22 CDC37 4.6 0.95 27 1.2×10-6 ZBTB11 2.5 3.9 33 1.4×10-6 CFB 1.9 1.2 31 5.5×10-8 ASH1L 1.9 2 4 4×10-22 EFNA4 1.8 4 6 3.1×10-12 HLA-DRB5 1.4 2.4 5 3.1×10-8 NFKBIZ 0.94 4.7 10 5.6×10-6 LINC01377 0.45 1.7 5 1.7×10-7 CACNG8 0.28 1.7 16 8.7×10-7 GON4L -0.53 4.7 32 4.5×10-14 ANKRD45 -0.89 1.4 21 4.1×10-6 RTP3 -1.3 2.1 5 8.4×10-7 C6orf15 -1.5 4 6 6.4×10-14 KRTCAP2 -1.8 3 4 5.9×10-10 LINC01149 -1.9 4.5 2 2.7×10-6 PLEKHM1 -1.9 3.1 6 1.2×10-17 AP000569.9 -2.1 2.4 3 9.5×10-13 CDSN -2.4 1.6 2 8.5×10-6 RP4-535B20.1 -2.7 2.1 5 8.2×10-6 RP11-798G7.6 -3.4 5.4 3 2.3×10-10 7 5 Drugs in consideration by UK-CTAP Supplementary Table 12: Drugs under consideration for use in severe Covid-19 by the independent UK COVID-19 Therapeutics Advisory Panel (UK-CTAP). Genes with potential relevance to the assessment of each drug were identified by a UK-CTAP investigator (GM) without prior knowledge of the GenOMICC results. Significant P-values in TWAS, GSMR (RNA), and Gene-level GWAS are shown. Gene Symbol Target drug Taget pathway In trial 𝑃𝑚𝑒𝑡𝑎𝑇𝑊𝐴𝑆 𝑃𝐺𝑆𝑀𝑅−𝑅𝑁𝐴 𝑃𝐺𝑒𝑛𝑒−𝑙𝑒𝑣𝑒𝑙 NLRP3 Colchicine Inflammasome ✓ NLRP1 Colchicine Inflammasome ✓ NLRC5 Colchicine Inflammasome ✓ AIM2 Colchicine Inflammasome ✓ C5 Nomacopan, Zilucoplan Inflammatory response and terminal complement pathway ✓ CSF1 Edicotinib, Cabiralizumab A macrophage stimulating factor ✓ F10 Apixaban Prevents thrombin generation ✓ FGA Alteplase Thrombolytic ✓ FGB Alteplase Thrombolytic ✓ FGG Alteplase Thrombolytic ✓ CSF2 Namilumab Monocyte/macrophage stimulating factor ✓ IFN PEG-IFN beta and lambda innate immune response ✓ ERN1 Fluvoxamine Inflammation ✓ SIGMAR1 Fluvoxamine Inflammation - sigma-1 receptor ✓ TMEM97 Fluvoxamine Inflammation - sigma-2 receptor ✓ SLC5A2 Gliflozin Sodium-glucose co-transporter-2 ✓ JAK1 Baricitinib, nezulcitinib Cytokine and interferon activation ✓ 1.8e-06 3.4e-06 STAT1 Baricitinib ✓ 0.0004 STAT2 Baricitinib ✓ TYK2 Nezulcitinib, baricitinib IL-6R and type I interferon (IFN) signalling 9.5e-18 1.2e-23 4.8e-30 ANO1 Niclosamide Calcium-activated ion channel involved in viral-induced syncytia ✓ TMPRSS2 Camostat, Nafamostat Core viral entry mechanism ✓ 4.4e-06 TNF Adalimumab ✓ 2.5e-07 2.1e-10 TRPM2 Artesunate Neutrophil activation ✓ CSNK2A1 Silmitasertib Casein kinase 2 in inflammation ✓ CSNK2A2 Silmitasertib Casein kinase 2 in inflammation ✓ CSNK2B Silmitasertib Casein kinase 2 in inflammation ✓ 0.00017 1.7e-06 ACE2 Ursodeoxycholic acid, recombinant ACE2 Core viral entry mechanism ATP2A1 Thapsigargin SERCA pump ATP2A2 Thapsigargin SERCA pump ATP2A3 Thapsigargin SERCA pump AXL Bemcentinib Cell surface receptor for viral entry CSF1R Edicotinib, Cabiralizumab Macrophage activation CTSL SLV213 Core viral entry mechanism - cysteine protease cathepsin L DHFR Pralatrexate, methotrexate Folate pathway DHODH Lefluonamide, IMU-838 GBA Ambroxol Glucosylceramidase to lower glycosphingolipids 4.2e-30 GBA2 Ambroxol Glucosylceramidase to lower glycosphingolipids GBA3 Ambroxol Glucosylceramidase to lower glycosphingolipids GPX1 Ebselen Glutathione peroxidase induced oxidant stress GPX2 Ebselen Glutathione peroxidase induced oxidant stress GPX3 Ebselen Glutathione peroxidase induced oxidant stress GPX4 Ebselen Glutathione peroxidase induced oxidant stress GPX5 Ebselen Glutathione peroxidase induced oxidant stress GPX6 Ebselen Glutathione peroxidase induced oxidant stress GPX7 Ebselen Glutathione peroxidase induced oxidant stress HIF1A 2-deoxy-D-glucose glucose metabolism - hypoxia-inducible factor-1𝛼 HRH2 Famotidine Histamine response in inflammation HTR1A Cyproheptadine Serotonin and histamine receptor binding HTR2A Cyproheptadine Serotonin and histamine receptor binding HTR3A Cyproheptadine Serotonin and histamine receptor binding HTR2C Cyproheptadine Serotonin and histamine receptor binding 8 Gene Symbol Target drug Taget pathway In trial 𝑃𝑚𝑒𝑡𝑎𝑇𝑊𝐴𝑆 𝑃𝐺𝑆𝑀𝑅−𝑅𝑁𝐴 𝑃𝐺𝑒𝑛𝑒−𝑙𝑒𝑣𝑒𝑙 IL1a Anakinra Inflammatory cytokine IL1b Anakinra Inflammatory cytokine IL5RA Fasenra Inflammation KEAP1 Ebselen Oxidant stress regulation 1.9e-15 LDHA 2-deoxy-D-glucose Glucose metabolism IFIH1 Hiltonol Innate immune response MTOR Metformin Glucose regulation NFKB1 Metformin, APPA Immune regulation NFKB2 Metformin, APPA Immune regulation NOS2 NO Antiviral action of NO NFE2L2 APPA Oxidant resistance NUP genes Ivermectin Nuclear pore complex OAS1 Hiltonol Innate immune response 2.7e-09 7e-13 2.2e-07 OAS2 Hiltonol Innate immune response 0.00042 OAS3 Hiltonol Innate immune response 4.2e-09 2.9e-07 SLC22A8 Probenecid Organic anion transporter PIKFYVE Apilimod Phosphoinositide Kinase SPHK2 Opaganib Sphingosine kinase 2 in inflammation SOD3 N-acetylcysteine Oxidant stress regulation TGM2 Nylexa Transglutaminase-2 regulating inflammation VIP Aviptadil Bronchodilator 6 Description of cohorts 6.1 Critical and hospitalisation meta-analysis cohorts Supplementary Table 13: Description of cohorts included in the critical meta-analysis with ancestry information, median age, and percentage of females for the cases. Complete details of all cohorts can be found in Supplementary Table 1. “Critical” refers to the initiation of continuous cardiorespiratory monitoring, which in adults is undertaken in intensive care units (ICU) or high dependency units (HDU) in most health care systems, or admission to ICU/HDU. This is the definition used by the GenOMICC study since 2015 and because of this, was included by HGI as the “A2” phenotype for use in registry studies. In the SCOURGE study the “severe” cohort corresponds to levels 3-4 in the SCOURGE severity grading system.2 WGS: whole-genome sequencing. NA: information not available for this cohort. **data was available for the hospitalisation cohort but not for the critically-ill patients. Study Dataset Ancestry Case definition Control definition Median age(IQR) Female(%) N cases N controls GenOMICC WGS EUR Critical Population/ mild 60(11.87) 32.17% 5989 42981 GenOMICC WGS EAS Critical Population/ mild 54(11.27) 40.87% 274 366 GenOMICC WGS SAS Critical Population/ mild 57(13.22) 25.63% 788 3793 GenOMICC WGS AFR Critical Population/ mild 57(13.06) 35% 440 1350 GenOMICC Array EUR Critical Population 58(13.86) 32.5% 3029 15215 GenOMICC Array EAS Critical Population 53(12.09) 37.5% 112 323 GenOMICC Array SAS Critical Population 58(16.10) 32.5% 324 1451 GenOMICC Array AFR Critical Population 55(16.47) 43.1% 218 1090 ISARIC4C Array EUR ICU/ CPAP/ NIV Population 63(14.92) 30% 184 920 ISARIC4C Array EAS ICU/ CPAP/ NIV Population 51(9.92) 26.67% 15 70 ISARIC4C Array SAS ICU/ CPAP/ NIV Population 59(17.79) 41.3% 29 140 ISARIC4C Array AFR ICU/ CPAP/ NIV Population 58(14.98) 25% 24 100 HGiv6 Array ALL Critical Population 8779 1001875 SCOURGE Array EUR Severe Population 70(23) 27.5% 3502 5455 23andMe Array EUR Respiratory Support Population 53(17.5)** 50.7% ** 495 680440 ALL_studies 24202 1755569 Supplementary Table 14: Cohorts including patients hospitalised with Covid-19. Description of cohorts included in the critical meta-analysis with ancestry information, median age and percentage of females for the cases. NA: information not available for this cohort. Study Dataset Ancestry Case definition Control definition Median age(IQR) Female(%) N cases N controls GenOMICC WGS EUR Critical Population/ mild 60(11.87) 32.17% 5989 42981 GenOMICC WGS EAS Critical Population/ mild 54(11.27) 40.87% 274 366 9 Study Dataset Ancestry Case definition Control definition Median age(IQR) Female(%) N cases N controls GenOMICC WGS SAS Critical Population/ mild 57(13.22) 25.63% 788 3793 GenOMICC WGS AFR Critical Population/ mild 57(13.06) 35% 440 1350 GenOMICC Array EUR Critical Population 58(13.86) 32.5% 3029 15145 GenOMICC Array EAS Critical Population 53(12.09) 37.5% 112 323 GenOMICC Array SAS Critical Population 58(16.10) 32.5% 324 1451 GenOMICC Array AFR Critical Population 55(16.47) 43.1% 218 1090 GenOMICC Saudi Arabia Array ADMIX Hospitalised Mild cases 61(16.88) 33.3% 93 645 GenOMICC Brazil Array ALL Hospitalised Mild cases 3533 1700 ISARIC4C Array EUR Hospitalised Population 64(16.69) 37.81% 548 2740 ISARIC4C Array EAS Hospitalised Population 48(9.67) 39.28% 28 127 ISARIC4C Array SAS Hospitalised Population 57(16.65) 35.55 % 59 ISARIC4C Array AFR Hospitalised Population 57(14.74) 36.58% 41 28 HGiv6 Array ALL Hospitalised Population 22637 2052436 SCOURGE Array EUR Hospitalised Population 70.66(22.1) 27.5% 5933 8810 23andMe Array EUR Respiratory Support or pneumonia Population 1128 679531 23andMe Array AMR Respiratory Support or pneumonia Population 218 94318 23andMe Array AFR Respiratory Support or pneumonia Population 64 22382 ALL 45456 2929461 10 7 Full GWAS results tables 11 Supplementary Table 15: Full results for critical covid GWAS. Chr:Pos(b38): chromosome and position on human genome build 38; rsid: lead variant rsid; EA: Effect Allele; EAF: Effect Allele Frequency; Non-EA: Non effect allele; OR: odds ratio; OR𝐶𝐼 : odds ratio confidence interval; P: P-value against null hypothesis of odds ratio of one; P𝑐𝑜𝑛𝑑: P-value in conditional analysis in variants with P> 5 × 10−8; P𝐻𝑒𝑡: Heterogeneity P-value Gene: nearest or most plausible nearby gene; Citation: first demonstration of association. GenOMICCnew indicates the new findings in the present manuscript. Chr:pos(b38) rsid EA Non-EA EAF OR OR𝐶𝐼 P P𝑐𝑜𝑛𝑑 P𝐻𝑒𝑡 N Nearest Gene Citation 1:9067157 rs2478868 A C 0.64 0.92 0.9-0.95 1.5×10-10 0.018 1766590 SLC2A5 GenOMICCnew 1:64948270 rs12046291 A G 0.33 1.1 1.07-1.13 5.1×10-11 0.69 1731600 JAK1 GenOMICCnew 1:77501822 rs71658797 A T 0.12 1.1 1.09-1.18 2.8×10-9 0.25 1759210 AK5 GenOMICCnew 1:155066988 rs114301457 T C 0.0058 2.4 1.81-3.18 1.5×10-9 1 48877 EFNA4 GenOMICC3 1:155175305 rs7528026 A G 0.03 1.3 1.25-1.44 1.5×10-15 0.46 1756890 TRIM46 GenOMICC3 1:155197995 rs41264915 A G 0.89 1.2 1.17-1.26 7.6×10-24 0.73 1765280 THBS3 HGI4 1:155278322 rs11264349 A T 0.73 0.94 0.92-0.97 7.3×10-5 3.9×10-13 0.36 1743390 HCN3 GenOMICCnew 2:60480453 rs1123573 A G 0.63 1.1 1.09-1.15 1×10-14 0.24 1725960 BCL11A GenOMICC3 3:45796521 rs2271616 T G 0.13 1.2 1.14-1.23 1.1×10-16 0.00013 1016720 SLC6A20 HGI4 3:45818159 rs17713054* A G 0.1 2 1.96-2.13 7.7×10-254 8×10-15 1764290 LZTFL1 SCGG5 3:45873093 rs35482426 CTT C 0.83 0.53 0.5-0.57 6.1×10-91 0.2 55882 LZTFL1 SCGG5 3:101790631 rs11706494 A T 0.66 1.1 1.05-1.11 9.4×10-9 0.58 1755710 NXPE3 GenOMICCnew 3:146522652 rs343314 T C 0.076 1.2 1.09-1.21 4.6×10-8 0.12 1723090 PLSCR1 GenOMICC3 4:25446871 rs7664615 A G 0.21 1.1 1.07-1.14 1.5×10-8 0.28 1725240 ANAPC4 GenOMICCnew 4:105673359 rs72670002 A G 0.06 1.1 1.09-1.21 4.4×10-8 0.037 1757770 ARHGEF38 GenOMICCnew 4:167824478 rs1073165 A G 0.61 1.1 1.05-1.11 1.1×10-9 0.78 1766650 . GenOMICCnew 5:132422622 rs2269821 A G 0.14 1.1 1.08-1.16 3×10-10 0.15 1743980 IRF1-AS1 GenOMICC3 6:31153455 rs111837807 T C 0.91 0.8 0.77-0.84 8.6×10-26 2.3×10-15 1766690 CCHCR1 GenOMICC6 6:31571991 rs2071590 A G 0.34 1.1 1.06-1.11 3.1×10-10 0.34 1766590 LTA GenOMICCnew 6:32702687 rs2858305 T G 0.62 0.93 0.9-0.95 2.1×10-9 0.02 1766220 HLA-DQA1 GenOMICC3 6:41522644 rs41435745 C G 0.077 1.4 1.31-1.51 1.5×10-20 0.45 1725810 FOXP4 HGI4 7:75623396 rs1179620 T C 0.57 0.92 0.9-0.95 2.3×10-9 0.39 1725980 HIP1 GenOMICCnew 7:100032719 rs2897075 T C 0.37 1.1 1.06-1.11 8.9×10-11 0.9 1766100 ZKSCAN1 GenOMICCnew 8:60532539 rs13276831 T C 0.39 1.1 1.05-1.1 1.7×10-8 0.64 1766140 RAB2A GenOMICCnew 9:21206606 rs28368148 C G 0.99 0.59 0.49-0.7 5.3×10-9 0.31 729815 IFNA10 GenOMICC3 9:33425186 rs60840586 G GTAAC 0.2 1.1 1.07-1.14 9.7×10-9 0.035 936386 AQP3 SCOURGE2 9:133271182 rs879055593 T C 0.26 1.1 1.1-1.16 1×10-16 0.96 1732540 ABO SCGG5 10:79946568 rs721917 A G 0.57 0.93 0.9-0.95 7.6×10-9 0.07 1743510 SFTPD HGI7 11:1219991 rs35705950 T G 0.11 0.86 0.82-0.89 3.8×10-14 0.82 1751430 MUC5B HGI7 11:34482745 rs61882275 A G 0.37 0.88 0.86-0.91 1×10-22 0.54 1765170 ELF5 GenOMICC3 12:112919637 rs2660 A G 0.67 1.1 1.08-1.13 2.8×10-15 0.45 1765230 OAS1 GenOMICC6 12:132481571 rs11614702 A G 0.49 1.1 1.08-1.13 2.1×10-16 0.74 1766600 FBRSL1 GenOMICC3 13:112881427 rs12585036 T C 0.21 1.2 1.12-1.18 9.6×10-22 0.18 1766450 ATP11A GenOMICC3 16:89196249 rs117169628 A G 0.14 1.2 1.12-1.2 2.6×10-16 0.42 1763760 SLC22A31 GenOMICC3 17:40003082 rs12941811 T C 0.41 0.93 0.91-0.95 1.1×10-9 0.42 1766110 PSMD3 GenOMICCnew 17:46085231 rs8080583 A C 0.22 0.89 0.86-0.91 1.8×10-16 0.4 1762770 KANSL1 8 17:49863303 rs77534576 T C 0.033 1.3 1.24-1.43 8.7×10-16 0.3 1759300 TAC4 8 19:4717660 rs12610495 A G 0.7 0.8 0.77-0.82 9.1×10-51 0.0019 1691560 DPP9 GenOMICC6 19:10352442 rs34536443 C G 0.045 1.5 1.39-1.61 2.2×10-28 0.97 1683680 TYK2 GenOMICC6 19:10414696 rs142770866 A G 0.083 1.2 1.19-1.3 9.4×10-21 0.65 1759600 PDE4A GenOMICCnew 19:48702915 rs516246 T C 0.47 0.9 0.88-0.93 1.4×10-15 0.4 1752670 FUT2 GenOMICC3 19:50374423 rs35463555 A G 0.32 1.1 1.07-1.13 1.9×10-13 0.44 1086190 NR1H2 HGI7 20:6489447 rs2326788 A G 0.38 0.93 0.9-0.95 1.5×10-8 0.99 1760070 CASC20 GenOMICCnew 21:33229937 rs188401375 C G 0.98 0.74 0.66-0.84 3.1×10-6 4.7×10-9 0.4 734303 IFNAR2 GenOMICC6 21:33237639 rs9636867 A G 0.67 0.83 0.81-0.85 5.2×10-48 0.03 1766650 IFNAR2 GenOMICC6 21:33287378 rs8178521 T C 0.25 1.1 1.1-1.17 6.2×10-15 0.31 1726400 IL10RB GenOMICC3 12 Chr:pos(b38) rsid EA Non-EA EAF OR OR𝐶𝐼 P P𝑐𝑜𝑛𝑑 P𝐻𝑒𝑡 N Nearest Gene Citation 21:33980963 rs76608815 T C 0.09 1.2 1.14-1.23 7.4×10-17 0.19 1765700 ATP5PO GenOMICC3 21:41479527 rs915823 A C 0.79 1.1 1.06-1.13 2.1×10-9 0.95 1767130 TMPRSS2 GenOMICCnew X:15523993 rs35697037 A G 0.55 1 1.03-1.06 6.8×10-9 0.38 1723360 ACE2 HGI7 Supplementary Table 16: Conditional analysis for critical illness phenotype. Conditional analysis calculated using EUR reference panel as most of the population from the analysis is from European ancestry. Chr: chromosome; Pos(b38): position on human genome build 38; EA: effect allele; beta: effect; SE: standard error; P: P-value; beta𝑐𝑜𝑛𝑑: beta in conditional analysis; SE𝑐𝑜𝑛𝑑: standard error in conditional analysis; P𝑐𝑜𝑛𝑑: P-value in conditional analysis; LD𝑟: LD between SNP𝑖 and SNP𝑖+1 significant in conditional analysis; Gene: nearest or most plausible nearby gene. Chr Pos(b38) rsid Eff.Allele Beta SE P Beta𝑐𝑜𝑛𝑑 SE𝑐𝑜𝑛𝑑 P𝑐𝑜𝑛𝑑 LD𝑟 Gene 1 155066988 rs114301457 T 0.87 0.14 1.5e-09 0.89 0.14 7.3e-10 -0.013 EFNA4 1 155175305 rs7528026 A 0.29 0.036 1.6e-15 0.29 0.037 1.1e-15 0.062 TRIM46 1 155197995 rs41264915 A 0.2 0.019 6.6e-24 0.22 0.02 7.1e-28 0.25 THBS3 1 155278322 rs11264349 A -0.059 0.015 7.3e-05 -0.11 0.015 4e-13 0 HCN3 1 64948270 rs12046291 A 0.094 0.014 4.7e-11 0.094 0.014 4.7e-11 0 JAK1 1 77501822 rs71658797 A 0.12 0.021 2.7e-09 0.12 0.021 2.7e-09 0 AK5 1 9067157 rs2478868 A -0.081 0.013 1.5e-10 -0.081 0.013 1.5e-10 0 SLC2A5 10 79946568 rs721917 A -0.076 0.013 8.2e-09 -0.076 0.013 8.2e-09 0 SFTPD 11 1219991 rs35705950 T -0.15 0.02 3.8e-14 -0.15 0.02 3.8e-14 0 MUC5B 11 34482745 rs61882275 A -0.12 0.013 6.9e-23 -0.12 0.013 6.9e-23 0 ELF5 12 112919637 rs2660 A 0.1 0.013 2.2e-15 0.1 0.013 2.2e-15 0 OAS1 12 132481571 rs11614702 A 0.1 0.012 2.2e-16 0.1 0.012 2.2e-16 0 FBRSL1 13 112881427 rs12585036 TRUE 0.14 0.015 7.8e-22 0.14 0.015 7.8e-22 0 ATP11A 16 89196249 rs117169628 A 0.15 0.018 3e-16 0.15 0.018 3e-16 0 SLC22A31 17 40003082 rs12941811 T -0.075 0.012 1.1e-09 -0.075 0.012 9.3e-10 -0.0039 PSMD3 17 46085231 rs8080583 A -0.12 0.015 1.8e-16 -0.12 0.015 1.2e-16 0.0031 KANSL1 17 49863303 rs77534576 T 0.29 0.036 8.6e-16 0.29 0.036 7.1e-16 0 TAC4 19 10352442 rs34536443 C 0.4 0.036 2.1e-28 0.42 0.037 2.7e-30 -0.064 TYK2 19 10414696 rs142770866 A 0.22 0.023 1e-20 0.23 0.023 6.7e-23 0 PDE4A 19 4717660 rs12610495 A -0.23 0.015 8.9e-51 -0.23 0.015 9.1e-50 -0.0092 DPP9 19 48702915 rs516246 T -0.1 0.013 1.2e-15 -0.1 0.013 2.1e-15 -0.0089 FUT2 19 50374423 rs35463555 A 0.097 0.013 2.1e-13 0.096 0.013 3.5e-13 0 NR1H2 2 60480453 rs1123573 A 0.11 0.014 9.2e-15 0.11 0.014 1.2e-14 0 BCL11A 20 6489447 rs2326788 A -0.076 0.013 1.5e-08 -0.076 0.013 1.5e-08 0 CASC20 21 33229937 rs188401375 C -0.3 0.064 3.1e-06 -0.37 0.064 4.7e-09 -0.11 IFNAR2 21 33237639 rs9636867 A -0.19 0.013 6.2e-48 -0.18 0.013 3.2e-44 -0.13 IFNAR2 21 33287378 rs8178521 T 0.12 0.016 7.2e-15 0.11 0.016 6.3e-11 -0.023 IL10RB 21 33980963 rs76608815 T 0.17 0.02 7.9e-17 0.17 0.02 1.8e-16 0.002 ATP5PO 21 41479527 rs915823 A 0.093 0.016 2.3e-09 0.091 0.016 5.9e-09 0 TMPRSS2 3 101790631 rs11706494 A 0.075 0.013 9e-09 0.075 0.013 9e-09 0 NXPE3 3 146522652 rs343314 T 0.14 0.026 4.6e-08 0.14 0.026 4.6e-08 0 PLSCR1 3 45796521 rs2271616 T 0.17 0.02 9.8e-17 0.24 0.02 4.9e-31 -0.094 SLC6A20 3 45818159 rs17713054* A 0.71 0.021 4.4e-254 0.67 0.023 1.2e-186 -0.72 LZTFL1 3 45873093 rs35482426 CTT -0.63 0.031 9.4e-91 -0.26 0.034 2.3e-14 0 LZTFL1 4 105673359 rs72670002 A 0.14 0.025 4.5e-08 0.14 0.025 4.5e-08 0 ARHGEF38 4 167824478 rs1073165 A 0.076 0.013 1.1e-09 0.076 0.013 1.1e-09 0 . 4 25446871 rs7664615 A 0.099 0.017 1.5e-08 0.099 0.017 1.5e-08 0 ANAPC4 5 132422622 rs2269821 A 0.11 0.018 2.7e-10 0.11 0.018 2.7e-10 0 IRF1-AS1 6 31153455 rs111837807 T -0.22 0.021 8.6e-26 -0.26 0.021 2.7e-33 0.12 CCHCR1 6 31571991 rs2071590 A 0.08 0.013 3.1e-10 0.094 0.013 2.1e-13 -0.044 LTA 13 Chr Pos(b38) rsid Eff.Allele Beta SE P Beta𝑐𝑜𝑛𝑑 SE𝑐𝑜𝑛𝑑 P𝑐𝑜𝑛𝑑 LD𝑟 Gene 6 32702687 rs2858305 T -0.076 0.013 2e-09 -0.088 0.013 3.3e-12 -0.007 HLA-DQA1 6 41522644 rs41435745 C 0.34 0.037 1.4e-20 0.34 0.037 2.8e-20 0 FOXP4 7 100032719 rs2897075 TRUE 0.081 0.013 8.2e-11 0.081 0.013 8.3e-11 0 ZKSCAN1 7 75623396 rs1179620 TRUE -0.082 0.014 2.4e-09 -0.082 0.014 2.4e-09 0 HIP1 8 60532539 rs13276831 TRUE 0.069 0.012 1.9e-08 0.069 0.012 1.9e-08 0 RAB2A 9 133271182 rs879055593 T 0.12 0.015 1.2e-16 0.12 0.015 1.2e-16 0 ABO 9 21206606 rs28368148 C -0.53 0.09 5.3e-09 -0.53 0.091 5.3e-09 0 IFNA10 9 33425186 rs60840586 G 0.098 0.017 1e-08 0.098 0.017 1e-08 0 AQP3 Supplementary Table 17: Full results for lead variants in severe (hospitalised) covid GWAS. Chr:Pos(b38): chromosome, Chr:Pos(b38): chromosome and position on human genome build 38; rsid: lead variant rsid; EA: effect allele; Non-EA: non-effect allele (the full insertion at rs71288014 has the sequence GCCTTACCCACAGACTCCTTCAC); OR: odds ratio; OR𝐶𝐼 : odds ratio confidence interval; P: P-value against null hypothesis of odds ratio of one; P𝑐𝑜𝑛𝑑: P-value in conditional analysis in variants with P> 5 × 10−8; P𝐻𝑒𝑡: Heterogeneity P-value; N: number of individuals in the analysis; Gene: nearest or most plausible nearby gene; Citation: first demonstration of association. GenOMICCnew indicates the new findings in the present manuscript. Chr:pos(b38) rsid EA Non-EA OR OR𝐶𝐼 P P𝑐𝑜𝑛𝑑 P𝐻𝑒𝑡 N Nearest Gene Citation 1:64948270 rs12046291 A G 1.1 1.04-1.08 3.2×10-9 0.39 2818420 JAK1 GenOMICCnew 1:77488712 rs12034334 C G 1.1 1.05-1.1 9.3×10-10 0.24 2964540 AK5 GenOMICCnew 1:155066988 rs114301457 T C 1.7 1.46-2.01 3.7×10-11 0.0051 1557660 EFNA4 GenOMICC3 1:155172916 rs41264911 A G 1.2 1.16-1.28 1×10-13 0.065 2955380 TRIM46 GenOMICC3 1:155203736 rs67579710 A G 0.87 0.85-0.9 1.7×10-22 0.22 2971380 THBS3 HGI4 2:60480759 rs7579014 A G 0.93 0.92-0.95 7×10-12 0.015 2822150 BCL11A GenOMICC3 3:45696221 rs149853133 T C 0.71 0.64-0.79 3.4×10-11 0.055 2499890 SACM1L GenOMICCnew 3:45796521 rs2271616 T G 1.1 1.11-1.17 4.8×10-20 7×10-6 2090810 SLC6A20 HGI4 3:45804256 rs17078346 A C 0.72 0.7-0.74 3.9×10-103 4.5×10-55 2234270 SLC6A20 HGI4 3:45818159 rs17713054* A G 1.7 1.62-1.73 2.8×10-239 3.9×10-42 2956580 LZTFL1 SCGG5 3:45991675 rs71288014 G GCCTTACC… 0.56 0.52-0.59 2.7×10-80 0.14 55870 FYCO1 SCGG5 3:46227281 rs6775046 A T 0.84 0.82-0.87 1.2×10-35 4.3×10-22 2970910 CCR3 SCGG5 3:47920114 rs12631365 C G 1 1.02-1.06 1.3×10-5 2.9×10-8 0.06 2909630 MAP4 GenOMICCnew 3:101800253 rs11712309 T C 1.1 1.05-1.09 2.8×10-13 0.35 2953910 NXPE3 GenOMICCnew 3:146520241 rs186910 A G 0.91 0.88-0.93 1.5×10-10 0.11 2958740 PLSCR1 GenOMICC3 4:25446871 rs7664615 A G 1.1 1.05-1.1 1.6×10-9 0.14 2912790 ANAPC4 GenOMICCnew 4:105669137 rs115599607 T G 0.9 0.87-0.93 7×10-9 0.0034 2951240 ARHGEF38 GenOMICCnew 5:132427482 rs4143335 T C 1.1 1.05-1.1 1.3×10-9 0.0086 2948530 IRF1-AS1 GenOMICC3 6:31153649 rs143334143* A G 1.2 1.13-1.19 7.5×10-23 1.7×10-21 2959380 CCHCR1 GenOMICC6 6:31556227 rs3838684 G GC 0.93 0.9-0.95 1.5×10-9 0.81 947977 NFKBIL1 GenOMICCnew 6:41522644 rs41435745 C G 1.2 1.18-1.29 1.2×10-20 0.019 2834490 FOXP4 HGI4 7:100032719 rs2897075 T C 1.1 1.04-1.07 5.8×10-9 0.28 2971270 ZKSCAN1 GenOMICCnew 8:60507169 rs2875974 A G 1.1 1.04-1.07 6.8×10-10 0.1 2971690 RAB2A GenOMICCnew 9:21206606 rs28368148 C G 0.75 0.68-0.83 4×10-8 0.01 2326800 IFNA10 GenOMICC3 9:33425570 rs60639666 A G 1.1 1.04-1.09 5×10-9 0.037 2971830 AQP3 SCOURGE2 9:133274084 rs529565 T C 0.91 0.9-0.93 9.9×10-24 0.36 2936170 ABO SCOURGE2 10:79946568 rs721917 A G 0.94 0.93-0.96 1.5×10-10 0.13 2947310 SFTPD HGI7 11:1219991 rs35705950 T G 0.89 0.87-0.92 3.6×10-14 0.48 2674960 MUC5B HGI7 11:34480495 rs7949972 T C 0.91 0.89-0.92 2.9×10-28 0.029 2964100 ELF5 GenOMICC3 12:112919637 rs2660 A G 1.1 1.06-1.1 3.1×10-17 0.00038 2948600 OAS1 GenOMICC6 12:132565387 rs5023077 T C 1.1 1.05-1.09 1.2×10-13 0.24 2829560 FBRSL1 GenOMICC3 13:112881427 rs12585036 T C 1.1 1.09-1.13 1.1×10-22 0.0021 2746150 ATP11A GenOMICC3 14 Chr:pos(b38) rsid EA Non-EA OR OR𝐶𝐼 P P𝑐𝑜𝑛𝑑 P𝐻𝑒𝑡 N Nearest Gene Citation 16:89196249 rs117169628 A G 1.1 1.09-1.14 2.6×10-17 0.23 2962620 SLC22A31 GenOMICC3 17:45983409 rs63750417 T C 0.91 0.89-0.93 1.2×10-18 0.27 2948600 MAPT GenOMICCnew 17:49863303 rs77534576 T C 1.2 1.19-1.31 2×10-17 0.11 2865730 TAC4 8 19:4063488 rs66833742 T C 0.93 0.91-0.95 2.1×10-10 0.082 2918950 ZBTB7A GenOMICCnew 19:4723658 rs2277732 A C 1.2 1.14-1.19 1.2×10-45 1.7×10-8 2897900 DPP9 GenOMICC6 19:10352632 rs149329233 A G 1.3 1.16-1.39 2.4×10-7 3.6×10-8 0.91 2788380 TYK2 GenOMICC6 19:10381598 rs144309607 T C 1.3 1.21-1.32 4.4×10-23 0.00046 2909050 TYK2 GenOMICC6 19:10414696 rs142770866 A G 1.1 1.11-1.18 2.6×10-15 0.041 2950950 PDE4A GenOMICCnew 19:48702851 rs679574 C G 1.1 1.05-1.09 1.7×10-13 0.037 2960610 FUT2 GenOMICC3 19:50379362 rs1405655 T C 0.93 0.91-0.95 5.7×10-16 0.02 2973250 NR1H2 HGI7 20:6517380 rs6117308 A G 0.95 0.93-0.97 3.8×10-9 0.57 2973250 CASC20 GenOMICCnew 21:33237639 rs9636867 A G 0.88 0.86-0.89 1.9×10-46 9.6×10-8 2972780 IFNAR2 GenOMICC6 21:33287378 rs8178521 T C 1.1 1.06-1.11 2.6×10-13 0.0039 2914120 IL10RB GenOMICC3 21:33954962 rs78258279 A G 0.88 0.85-0.9 2.3×10-18 0.002 2964540 LINC00649 GenOMICC3 21:41479527 rs915823 A C 1.1 1.05-1.1 6.5×10-11 0.84 2966090 TMPRSS2 GenOMICCnew X:15497196 C G 0.96 0.95-0.97 2.9×10-11 0.45 2377330 ACE2 HGI7 15 7.1 Forest plots Forest plots are shown here, plotting odds ratio and confidence interval of each variant per cohort for critical and hospitalised phenotypes, respectively. GenOMICC (meta-analysis of European, South Asian, East Asian and African ancestries recruited in UK and Ireland), GenOMICC Saudi Arabia, GenOMICC Brazil, HGI v6, SCOURGE and 23andMe (meta-analysis of Latino, European and African ancestries for 23andMe summary statistics). GenOMICC cohorts are represented in blue, HGI in purple, SCOURGE in green and 23andMe in orange. Size of the square represents weight of the cohort in a fixed-effect meta-analysis. 16 rs2660 OAS1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.11 1.10 1.13 1.10 95%−CI [1.07; 1.15] [1.06; 1.15] [1.05; 1.23] [0.97; 1.26] (a) rs343314 PLSCR1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.22 1.08 1.14 95%−CI [1.14; 1.31] [1.00; 1.16] [0.92; 1.42] (b) rs516246 FUT2 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 0.88 0.92 0.96 0.96 95%−CI [0.85; 0.91] [0.87; 0.96] [0.89; 1.03] [0.85; 1.09] (c) rs721917 SFTPD Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 0.92 0.92 1.00 0.81 95%−CI [0.89; 0.96] [0.89; 0.96] [0.93; 1.08] [0.71; 0.92] (d) rs915823 TMPRSS2 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.09 1.10 1.15 1.13 95%−CI [1.04; 1.14] [1.04; 1.15] [1.03; 1.28] [0.95; 1.34] (e) rs1123573 BCL11A Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 1.13 1.12 1.00 95%−CI [1.09; 1.18] [1.07; 1.16] [0.88; 1.14] (f) rs1179620 HIP1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 0.91 0.93 0.90 95%−CI [0.88; 0.95] [0.89; 0.97] [0.79; 1.03] (g) rs2071590 LTA Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 1.10 1.06 1.09 1.10 95%−CI [1.06; 1.14] [1.01; 1.10] [1.01; 1.17] [0.96; 1.25] (h) rs2269821 IRF1−AS1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.19 1.07 1.12 1.04 95%−CI [1.12; 1.26] [1.02; 1.13] [1.01; 1.24] [0.87; 1.25] (i) rs2271616 SLC6A20 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.26 1.11 1.12 95%−CI [1.19; 1.34] [1.04; 1.19] [1.01; 1.24] (j) rs2326788 CASC20 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 0.93 0.93 0.90 95%−CI [0.90; 0.96] [0.89; 0.97] [0.79; 1.03] (k) rs2478868 SLC2A5 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 0.90 0.95 0.94 0.95 95%−CI [0.87; 0.93] [0.91; 0.99] [0.87; 1.02] [0.84; 1.09] (l) Supplementary Figure 2: Forest plots (critical phenotype) 17 rs2858305 HLA−DQA1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 0.91 0.93 0.98 0.96 95%−CI [0.88; 0.94] [0.89; 0.97] [0.91; 1.06] [0.84; 1.09] (a) rs2897075 ZKSCAN1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.10 1.08 1.05 1.11 95%−CI [1.06; 1.13] [1.03; 1.12] [0.97; 1.13] [0.98; 1.27] (b) rs7528026 TRIM46 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.5 1 2 Odds Ratio OR 1.36 1.23 1.38 1.70 95%−CI [1.23; 1.49] [1.08; 1.41] [1.11; 1.70] [1.25; 2.33] (c) rs7664615 ANAPC4 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.11 1.08 1.25 95%−CI [1.06; 1.16] [1.03; 1.14] [1.06; 1.46] (d) rs8080583 KANSL1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 0.89 0.89 0.86 0.94 95%−CI [0.85; 0.93] [0.84; 0.93] [0.79; 0.94] [0.81; 1.10] (e) rs8178521 IL10RB Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.17 1.09 1.14 95%−CI [1.12; 1.22] [1.04; 1.14] [0.99; 1.31] (f) rs9636867 IFNAR2 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 0.82 0.87 0.76 0.87 95%−CI [0.79; 0.84] [0.83; 0.90] [0.70; 0.82] [0.76; 0.99] (g) rs11264349 HCN3 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 0.92 0.97 0.95 0.91 95%−CI [0.88; 0.96] [0.92; 1.02] [0.88; 1.04] [0.79; 1.05] (h) rs11614702 FBRSL1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 1.11 1.09 1.15 1.02 95%−CI [1.08; 1.15] [1.05; 1.14] [1.06; 1.24] [0.90; 1.16] (i) rs11706494 NXPE3 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 1.10 1.05 1.09 1.09 95%−CI [1.06; 1.13] [1.00; 1.09] [1.01; 1.19] [0.95; 1.25] (j) rs12046291 JAK1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.09 1.10 1.10 1.15 95%−CI [1.05; 1.14] [1.05; 1.15] [1.01; 1.20] [1.01; 1.32] (k) rs12585036 ATP11A Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.19 1.11 1.11 1.09 95%−CI [1.15; 1.24] [1.06; 1.16] [1.01; 1.21] [0.94; 1.26] (l) Supplementary Figure 3: Forest plots (critical phenotype) 18 rs12610495 DPP9 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 0.76 0.83 0.89 95%−CI [0.73; 0.79] [0.80; 0.87] [0.78; 1.02] (a) rs12941811 PSMD3 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 0.92 0.95 0.92 0.84 95%−CI [0.89; 0.95] [0.91; 0.99] [0.85; 0.99] [0.73; 0.95] (b) rs13276831 RAB2A Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 1.08 1.05 1.13 1.01 95%−CI [1.04; 1.11] [1.01; 1.10] [1.04; 1.22] [0.88; 1.14] (c) rs28368148 IFNA10 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.5 1 2 Odds Ratio OR 0.57 0.80 95%−CI [0.48; 0.69] [0.44; 1.45] (d) rs34536443 TYK2 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.5 1 2 Odds Ratio OR 1.50 1.48 1.51 95%−CI [1.37; 1.66] [1.32; 1.67] [1.14; 2.00] (e) rs35463555 NR1H2 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 1.09 1.11 1.14 95%−CI [1.05; 1.13] [1.06; 1.16] [1.05; 1.23] (f) rs35482426 LZTFL1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.75 1 1.5 Odds Ratio OR 0.53 95%−CI [0.5; 0.57] (g) rs35697037 ACE2 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 1.04 1.06 1.03 95%−CI [1.02; 1.06] [1.03; 1.09] [0.93; 1.14] (h) rs35705950 MUC5B Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 0.87 0.83 0.87 0.92 95%−CI [0.82; 0.92] [0.77; 0.89] [0.77; 0.97] [0.74; 1.15] (i) rs41264915 THBS3 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.24 1.22 1.15 1.20 95%−CI [1.17; 1.30] [1.14; 1.30] [1.02; 1.29] [0.97; 1.48] (j) rs41435745 FOXP4 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.5 1 2 Odds Ratio OR 1.43 1.43 1.11 1.72 95%−CI [1.29; 1.58] [1.27; 1.61] [0.86; 1.44] [1.16; 2.56] (k) rs60840586 AQP3 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.10 1.06 1.26 95%−CI [1.05; 1.15] [1.00; 1.12] [1.15; 1.37] (l) Supplementary Figure 4: Forest plots (critical phenotype) 19 rs61882275 ELF5 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 0.87 0.91 0.85 0.93 95%−CI [0.84; 0.90] [0.87; 0.95] [0.79; 0.92] [0.82; 1.06] (a) rs71658797 AK5 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.17 1.12 0.99 1.07 95%−CI [1.11; 1.23] [1.04; 1.21] [0.87; 1.13] [0.87; 1.31] (b) rs72670002 ARHGEF38 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.75 1 1.5 Odds Ratio OR 1.21 1.13 1.09 0.78 95%−CI [1.13; 1.30] [1.04; 1.22] [0.95; 1.24] [0.58; 1.04] (c) rs76608815 ATP5PO Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.23 1.14 1.15 1.14 95%−CI [1.16; 1.31] [1.07; 1.22] [1.00; 1.33] [0.93; 1.40] (d) rs77534576 TAC4 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.75 1 1.5 Odds Ratio OR 1.38 1.26 1.47 1.10 95%−CI [1.26; 1.52] [1.12; 1.42] [1.14; 1.90] [0.76; 1.58] (e) rs111837807 CCHCR1 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.75 1 1.5 Odds Ratio OR 0.75 0.88 0.78 0.71 95%−CI [0.71; 0.80] [0.83; 0.94] [0.69; 0.89] [0.59; 0.86] (f) rs114301457 EFNA4 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.5 1 2 Odds Ratio OR 2.40 95%−CI [1.81; 3.18] (g) rs117169628 SLC22A31 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.75 1 1.5 Odds Ratio OR 1.16 1.16 1.09 1.32 95%−CI [1.10; 1.21] [1.09; 1.23] [0.98; 1.22] [1.12; 1.55] (h) rs142770866 PDE4A Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.75 1 1.5 Odds Ratio OR 1.24 1.23 1.24 1.35 95%−CI [1.16; 1.32] [1.14; 1.33] [1.07; 1.42] [1.10; 1.67] (i) rs188401375 IFNAR2 Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.75 1 1.5 Odds Ratio OR 0.74 0.82 95%−CI [0.65; 0.84] [0.51; 1.30] (j) rs879055593 ABO Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.8 1 1.25 Odds Ratio OR 1.11 1.15 1.13 1.16 95%−CI [1.06; 1.16] [1.10; 1.20] [1.04; 1.23] [1.01; 1.33] (k) rs1073165 . Critical GenOMICC UK HGI A2 Critical SCOURGE Critical 23andme 0.9 1 1.1 Odds Ratio OR 1.07 1.09 1.08 1.08 95%−CI [1.04; 1.11] [1.04; 1.13] [1.00; 1.17] [0.95; 1.23] (l) Supplementary Figure 5: Forest plots (critical phenotype) 20 ACE2 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 0.96 0.95 0.93 95%−CI [0.95; 0.98] [0.94; 0.97] [0.87; 0.99] (a) rs2660 OAS1 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 1.11 1.19 1.06 1.16 1.12 95%−CI [1.07; 1.15] [1.05; 1.35] [1.04; 1.09] [1.10; 1.24] [1.03; 1.22] (b) rs186910 PLSCR1 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.87 1.02 0.93 0.86 0.93 95%−CI [0.82; 0.92] [0.86; 1.22] [0.89; 0.97] [0.78; 0.95] [0.82; 1.06] (c) rs529565 ABO Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.93 1.04 0.90 0.96 0.85 95%−CI [0.89; 0.97] [0.93; 1.16] [0.88; 0.92] [0.91; 1.02] [0.79; 0.92] (d) rs679574 FUT2 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 1.13 0.96 1.04 1.04 1.09 95%−CI [1.09; 1.17] [0.87; 1.07] [1.02; 1.06] [0.99; 1.10] [1.01; 1.17] (e) rs721917 SFTPD Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 0.92 1.02 0.95 0.99 0.88 95%−CI [0.89; 0.96] [0.92; 1.14] [0.93; 0.97] [0.93; 1.04] [0.82; 0.95] (f) rs915823 TMPRSS2 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 1.09 1.04 1.06 1.12 1.10 95%−CI [1.05; 1.14] [0.89; 1.22] [1.03; 1.10] [1.03; 1.21] [1.00; 1.22] (g) rs1405655 NR1H2 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 0.92 0.91 0.93 0.88 0.96 95%−CI [0.89; 0.95] [0.82; 1.02] [0.91; 0.96] [0.83; 0.94] [0.88; 1.03] (h) rs2271616 SLC6A20 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 1.26 1.11 1.09 95%−CI [1.19; 1.34] [1.07; 1.15] [1.00; 1.17] (i) rs2277732 DPP9 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 1.31 1.26 1.11 1.11 95%−CI [1.26; 1.37] [1.11; 1.43] [1.08; 1.14] [1.02; 1.21] (j) rs2875974 RAB2A Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 1.07 1.11 1.05 1.07 1.02 95%−CI [1.03; 1.10] [1.00; 1.24] [1.03; 1.07] [1.01; 1.13] [0.94; 1.10] (k) rs2897075 ZKSCAN1 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 1.10 1.13 1.04 1.01 1.05 95%−CI [1.06; 1.13] [1.02; 1.26] [1.01; 1.06] [0.96; 1.07] [0.97; 1.13] (l) Supplementary Figure 6: Forest plots (hospitalised phenotype) 21 rs3838684 NFKBIL1 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 0.91 0.93 95%−CI [0.88; 0.95] [0.90; 0.96] (a) rs4143335 IRF1−AS1 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.5 1 2 Odds Ratio OR 1.19 1.08 1.13 1.05 1.07 1.02 95%−CI [1.12; 1.26] [0.95; 1.23] [0.61; 2.09] [1.02; 1.09] [0.99; 1.15] [0.92; 1.13] (b) rs5023077 FBRSL1 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 1.12 1.11 1.06 1.04 1.07 95%−CI [1.07; 1.16] [0.99; 1.24] [1.03; 1.08] [0.99; 1.10] [0.98; 1.16] (c) rs6117308 CASC20 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 0.93 0.98 0.96 0.94 0.94 95%−CI [0.90; 0.96] [0.88; 1.09] [0.94; 0.98] [0.89; 1.00] [0.87; 1.01] (d) rs6775046 CCR3 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.72 0.92 0.89 0.84 0.81 95%−CI [0.69; 0.76] [0.80; 1.06] [0.86; 0.92] [0.76; 0.93] [0.72; 0.91] (e) rs7579014 BCL11A Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 0.90 0.94 0.99 95%−CI [0.86; 0.93] [0.92; 0.96] [0.91; 1.08] (f) rs7664615 ANAPC4 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 1.11 0.99 1.07 1.08 95%−CI [1.06; 1.16] [0.88; 1.11] [1.04; 1.09] [0.98; 1.19] (g) rs7949972 ELF5 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.88 0.88 0.93 0.86 0.90 95%−CI [0.85; 0.91] [0.79; 0.98] [0.91; 0.95] [0.82; 0.91] [0.84; 0.98] (h) rs8178521 IL10RB Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 1.17 1.04 1.05 1.18 95%−CI [1.12; 1.22] [0.91; 1.19] [1.02; 1.08] [1.08; 1.28] (i) rs9636867 IFNAR2 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.82 0.88 0.91 0.82 0.88 95%−CI [0.79; 0.85] [0.79; 0.98] [0.89; 0.93] [0.77; 0.87] [0.81; 0.95] (j) rs11712309 NXPE3 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 1.10 0.98 1.06 1.07 1.11 95%−CI [1.06; 1.14] [0.88; 1.10] [1.03; 1.08] [1.01; 1.14] [1.02; 1.20] (k) rs12034334 AK5 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 1.11 1.03 1.07 1.08 0.99 95%−CI [1.06; 1.16] [0.88; 1.20] [1.03; 1.10] [1.00; 1.16] [0.90; 1.10] (l) Supplementary Figure 7: Forest plots (hospitalised phenotype) 22 rs12046291 JAK1 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 1.09 1.08 1.05 1.03 1.10 95%−CI [1.05; 1.14] [0.97; 1.21] [1.03; 1.08] [0.97; 1.09] [1.01; 1.21] (a) rs12585036 ATP11A Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.9 1 1.1 Odds Ratio OR 1.20 1.07 1.07 1.12 1.13 95%−CI [1.15; 1.25] [0.94; 1.23] [1.04; 1.10] [1.05; 1.20] [1.03; 1.23] (b) rs12631365 MAP4 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.5 1 2 Odds Ratio OR 1.03 1.16 0.42 1.05 1.05 95%−CI [0.99; 1.07] [1.04; 1.30] [0.21; 0.80] [1.02; 1.07] [0.97; 1.13] (c) rs17078346 SLC6A20 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.5 1 2 Odds Ratio OR 0.50 0.87 0.80 0.95 95%−CI [0.47; 0.53] [0.74; 1.02] [0.77; 0.82] [0.73; 1.22] (d) rs17713054 LZTFL1 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.5 1 2 Odds Ratio OR 2.27 1.40 1.42 1.74 1.69 95%−CI [2.15; 2.40] [1.13; 1.75] [1.37; 1.48] [1.56; 1.94] [1.50; 1.90] (e) rs28368148 IFNA10 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.5 1 2 Odds Ratio OR 0.57 0.94 0.85 0.75 95%−CI [0.48; 0.69] [0.51; 1.73] [0.75; 0.97] [0.52; 1.09] (f) rs35705950 MUC5B Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.87 0.94 0.89 0.91 0.99 95%−CI [0.83; 0.92] [0.77; 1.13] [0.86; 0.93] [0.83; 0.99] [0.87; 1.13] (g) rs41264911 TRIM46 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.75 1 1.5 Odds Ratio OR 1.36 1.30 1.12 1.24 1.33 95%−CI [1.23; 1.49] [0.91; 1.84] [1.05; 1.21] [1.06; 1.46] [1.09; 1.63] (h) rs41435745 FOXP4 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.75 1 1.5 Odds Ratio OR 1.43 1.35 1.18 1.02 1.48 95%−CI [1.29; 1.58] [1.13; 1.62] [1.12; 1.25] [0.85; 1.23] [1.15; 1.91] (i) rs60639666 AQP3 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 1.08 1.12 1.03 1.18 1.06 95%−CI [1.04; 1.13] [0.98; 1.27] [1.01; 1.06] [1.11; 1.26] [0.97; 1.16] (j) rs63750417 MAPT Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.90 0.84 0.92 0.88 0.96 95%−CI [0.86; 0.93] [0.73; 0.97] [0.89; 0.94] [0.83; 0.94] [0.88; 1.05] (k) rs66833742 ZBTB7A Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.90 0.89 0.95 0.94 0.83 95%−CI [0.86; 0.94] [0.79; 1.00] [0.93; 0.98] [0.87; 1.00] [0.75; 0.92] (l) Supplementary Figure 8: Forest plots (hospitalised phenotype) 23 rs67579710 THBS3 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.82 0.87 0.90 0.87 0.84 95%−CI [0.77; 0.86] [0.75; 1.02] [0.87; 0.94] [0.80; 0.95] [0.74; 0.96] (a) rs71288014 FYCO1 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.75 1 1.5 Odds Ratio OR 0.56 95%−CI [0.52; 0.59] (b) rs77534576 TAC4 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.75 1 1.5 Odds Ratio OR 1.38 1.06 1.21 1.23 1.13 95%−CI [1.25; 1.51] [0.77; 1.45] [1.13; 1.29] [1.01; 1.49] [0.93; 1.38] (c) rs78258279 LINC00649 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.81 1.02 0.91 0.86 0.90 95%−CI [0.76; 0.86] [0.85; 1.22] [0.88; 0.94] [0.78; 0.96] [0.80; 1.02] (d) rs114301457 EFNA4 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.001 0.1 1 10 1000 Odds Ratio OR 2.40 42.92 1.47 95%−CI [1.81; 3.18] [1.57; 1175.13] [1.21; 1.77] (e) rs115599607 ARHGEF38 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 0.81 1.01 0.92 0.96 1.00 95%−CI [0.76; 0.87] [0.81; 1.26] [0.88; 0.96] [0.87; 1.06] [0.85; 1.17] (f) rs117169628 SLC22A31 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 1.15 1.12 1.08 1.12 1.24 95%−CI [1.10; 1.20] [0.94; 1.33] [1.05; 1.12] [1.03; 1.22] [1.12; 1.37] (g) rs142770866 PDE4A Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 1.23 1.07 1.09 1.22 1.14 95%−CI [1.15; 1.31] [0.85; 1.34] [1.04; 1.14] [1.10; 1.36] [1.00; 1.31] (h) rs143334143 CCHCR1 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.8 1 1.25 Odds Ratio OR 1.36 1.16 1.08 1.16 1.20 95%−CI [1.28; 1.44] [0.98; 1.37] [1.04; 1.12] [1.05; 1.27] [1.07; 1.35] (i) rs144309607 TYK2 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.75 1 1.5 Odds Ratio OR 1.45 1.07 1.16 1.38 1.53 95%−CI [1.32; 1.60] [0.77; 1.49] [1.09; 1.23] [1.18; 1.62] [1.28; 1.82] (j) rs149329233 TYK2 Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.75 1 1.5 Odds Ratio OR 1.27 1.24 1.44 1.28 95%−CI [1.05; 1.53] [1.11; 1.40] [1.09; 1.89] [0.88; 1.86] (k) rs149853133 SACM1L Hospital GenOMICC UK Hospital GenOMICC Brazil Hospital GenOMICC Saudi Ar. HGI B2 Hospital SCOURGE Hospital 23andme 0.5 1 2 Odds Ratio OR 0.61 0.74 0.70 0.96 95%−CI [0.49; 0.76] [0.44; 1.25] [0.62; 0.79] [0.63; 1.45] (l) Supplementary Figure 9: Forest plots (hospitalised phenotype) 24 8 Mendelian randomisation for Protein expression (INTER- VAL) Full tabular results from GSMR analyses are available in Supplementary Table 4 and Supplementary Table 3. −1.0 −0.5 0.0 0.5 − 0. 15 − 0. 10 − 0. 05 0. 00 0. 05 QSOX2.8397.147.3 (bzx) CO VI D 19 (b z y) cis−pQTL −0.8 −0.6 −0.4 −0.2 − 0. 15 − 0. 10 − 0. 05 CREB3L4.11308.8.3 (bzx) CO VI D 19 (b z y) cis−pQTL −0.2 0.0 0.2 0.4 − 0. 10 − 0. 05 0. 00 MPO.2580.83.2 (bzx) CO VI D 19 (b z y) cis−pQTL −0.5 0.0 0.5 − 0. 10 − 0. 05 0. 00 0. 05 0. 10 ADAMTS13.3175.51.5 (bzx) CO VI D 19 (b z y) cis−pQTL −0.5 0.0 0.5 − 0. 15 − 0. 10 − 0. 05 0. 00 0. 05 0. 10 0. 15 MBL2.3000.66.1 (bzx) CO VI D 19 (b z y) cis−pQTL Supplementary Figure 10: GSMR effect-size plots. SNP to protein expression and SNP to Covid-19 severity effect-size are shown for QSOX2, CREB3L4, MPO, ADAMTS13, and MBL2. These protein GSMR results are novel with respect a similar analysis performed using the most recent GenOMICC Covid-19 GWAS.3 Each point on the graph represents a single SNP. cis-pQTL (SNP located within ±2Mb of the protein’s locus) are coloured gold. Other colours represent distant loci (each locus greater then 5Mb distant from each other). x-axis: the effect of that SNP on the exposure (protein expression), y-axis: the effect of that SNP on the outcome (Covid-19 severity). Bars are standard errors. The dashed grey line is the GSMR effect-size estimate of exposure on outcome. 9 Mendelian randomisation for RNA expression (eQTLgen) 25 −0.3 −0.2 −0.1 0.0 0.1 − 0. 20 − 0. 10 0. 00 ABTB2 (bzx) CO VI D 19 (b z y) cis−QTL −0.8 −0.4 0.0 0.2 − 0. 2 − 0. 1 0. 0 0. 1 AC005682.5 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.2 0.4 0.6 − 0. 15 − 0. 05 0. 05 AC005682.6 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.2 0.0 0.2 0.4 − 0. 10 0. 00 0. 05 0. 10 AC079031.1 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 −0.1 0.0 0.1 0.2 − 0. 05 0. 00 0. 05 ACSL6 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 0.4 − 0. 15 − 0. 05 0. 05 ADORA2B (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 0.4 − 0. 20 − 0. 10 0. 00 0. 10 ANAPC4 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 0.4 − 0. 1 0. 0 0. 1 0. 2 ARHGAP27 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 − 0. 15 − 0. 05 0. 05 0. 15 ARRDC5 (bzx) CO VI D 19 (b z y) cis−QTL −0.15 −0.05 0.05 0.15 − 0. 08 − 0. 04 0. 00 0. 04 ATF6B (bzx) CO VI D 19 (b z y) cis−QTL −0.14 −0.12 −0.10 −0.08 − 0. 04 0. 00 0. 04 ATG16L2 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 − 0. 05 0. 05 0. 10 ATP6V1G2 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.1 0.2 0.3 − 0. 10 0. 00 0. 05 ATP7B (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 − 0. 06 − 0. 02 0. 02 0. 06 BACH2 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 0.3 − 0. 20 − 0. 10 0. 00 BAG3 (bzx) CO VI D 19 (b z y) cis−QTL −0.05 0.00 0.05 − 0. 10 − 0. 05 0. 00 BCL11A (bzx) CO VI D 19 (b z y) cis−QTL 0.10 0.20 0.30 − 0. 12 − 0. 08 − 0. 04 BEND3P3 (bzx) CO VI D 19 (b z y) cis−QTL −0.3 −0.1 0.1 0.3 − 0. 05 0. 05 0. 10 C7orf43 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.2 0.4 − 0. 2 − 0. 1 0. 0 0. 1 CA8 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.2 0.2 0.6 − 0. 2 − 0. 1 0. 0 0. 1 CAT (bzx) CO VI D 19 (b z y) cis−QTL Supplementary Figure 11: Effect size plots for significant RNA expression (eQTLgen) to GenOMICC GSMR (FDR < 0.05; n = 156). 26 −0.3 −0.1 0.1 0.2 0.3 − 0. 05 0. 00 0. 05 0. 10 CCHCR1 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.2 0.2 0.4 0.6 − 0. 1 0. 1 0. 2 0. 3 CCR1 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.1 0.2 0.3 − 0. 10 0. 00 0. 10 0. 20 CCR5 (bzx) CO VI D 19 (b z y) cis−QTL −0.05 0.00 0.05 0.10 − 0. 06 − 0. 02 0. 02 0. 06 CD79A (bzx) CO VI D 19 (b z y) cis−QTL −0.20 −0.10 0.00 0.10 − 0. 08 − 0. 04 0. 00 0. 04 CD79B (bzx) CO VI D 19 (b z y) cis−QTL −0.10 0.00 0.05 − 0. 05 0. 00 0. 05 CEACAM3 (bzx) CO VI D 19 (b z y) cis−QTL −0.10 0.00 0.05 0.10 − 0. 06 0. 00 0. 04 0. 08 CEP97 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.2 0.4 0.6 − 0. 15 − 0. 05 0. 05 CNPY4 (bzx) CO VI D 19 (b z y) cis−QTL −0.10 0.00 0.10 0.20 − 0. 05 0. 05 0. 15 0. 25 CORO1B (bzx) CO VI D 19 (b z y) cis−QTL −1.0 −0.5 0.0 − 0. 1 0. 0 0. 1 0. 2 CRHR1−IT1 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 −0.1 0.0 0.1 0.2 − 0. 05 0. 00 0. 05 CSNK2B (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.2 0.4 − 0. 1 0. 0 0. 1 0. 2 CXCR1 (bzx) CO VI D 19 (b z y) cis−QTL −0.05 0.00 0.05 − 0. 06 − 0. 02 0. 02 0. 06 CXCR5 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 −0.1 0.0 0.1 0.2 − 0. 05 0. 05 0. 15 CXCR6 (bzx) CO VI D 19 (b z y) cis−QTL −0.05 0.00 0.05 0.10 − 0. 02 0. 02 0. 06 CXXC5 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.4 0.8 − 0. 15 − 0. 05 0. 05 CYP21A1P (bzx) CO VI D 19 (b z y) cis−QTL 0.18 0.20 0.22 0.24 − 0. 20 − 0. 10 0. 00 0. 10 DAP3 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.4 −0.2 0.0 0.2− 0. 20 − 0. 10 0. 00 0. 10 DARS (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.2 0.4 0.6 − 0. 2 − 0. 1 0. 0 0. 1 DDR1 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.1 0.2 0.3 − 0. 10 0. 00 0. 10 DDX39B (bzx) CO VI D 19 (b z y) cis−QTL Supplementary Figure 12: Effect size plots for significant RNA expression (eQTLgen) to GenOMICC GSMR (FDR < 0.05; n = 156). 27 −0.4 0.0 0.2 0.4 0.6 − 0. 10 0. 00 0. 10 DDX55 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 0.3 0. 0 0. 1 0. 2 0. 3 DEF8 (bzx) CO VI D 19 (b z y) cis−QTL −1.5 −1.0 −0.5 0.0− 0. 10 0. 00 0. 10 0. 20 DND1P1 (bzx) CO VI D 19 (b z y) cis−QTL −0.3 −0.2 −0.1 0.0 0.1 − 0. 06 − 0. 02 0. 02 0. 06 DNMT1 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 0.3 − 0. 05 0. 00 0. 05 DPP9 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 0.4− 0. 20 − 0. 10 0. 00 0. 10 DR1 (bzx) CO VI D 19 (b z y) cis−QTL −0.15 −0.05 0.05 0.15 − 0. 10 0. 00 0. 10 EID3 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.1 0.2 0.3 − 0. 25 − 0. 15 − 0. 05 0. 05 EIF2AK2 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.2 0.4 0.6 − 0. 10 − 0. 06 − 0. 02 0. 02 FAM22B (bzx) CO VI D 19 (b z y) cis−QTL −0.8 −0.4 0.0 0.4 − 0. 15 − 0. 05 0. 05 FCER1G (bzx) CO VI D 19 (b z y) cis−QTL −0.05 0.00 0.05 0.10 − 0. 08 − 0. 04 0. 00 0. 04 FCGR2A (bzx) CO VI D 19 (b z y) cis−QTL −0.05 0.00 0.05 0.10 0.15 − 0. 06 − 0. 02 0. 02 0. 06 FKBPL (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.2 0.4 0.6 − 0. 05 0. 00 0. 05 0. 10 FLT1P1 (bzx) CO VI D 19 (b z y) cis−QTL −0.20 −0.15 −0.10 −0.05 − 0. 02 0. 02 0. 06 GATA2 (bzx) CO VI D 19 (b z y) cis−QTL −0.5 0.0 0.5 1.0 − 0. 3 − 0. 1 0. 1 GSDMB (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 − 0. 10 − 0. 05 0. 00 0. 05 GSTCD (bzx) CO VI D 19 (b z y) cis−QTL −0.15 −0.05 0.05 0.15 − 0. 10 − 0. 05 0. 00 0. 05 GSTK1 (bzx) CO VI D 19 (b z y) cis−QTL −0.10 0.00 0.10 − 0. 04 0. 00 0. 04 HBBP1 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.2 0.2 0.6 − 0. 15 − 0. 05 0. 05 HBG1 (bzx) CO VI D 19 (b z y) cis−QTL −0.5 0.0 0.5 1.0 − 0. 2 0. 0 0. 2 0. 4 HCG27 (bzx) CO VI D 19 (b z y) cis−QTL Supplementary Figure 13: Effect size plots for significant RNA expression (eQTLgen) to GenOMICC GSMR (FDR < 0.05; n = 156). 28 −0.5 0.0 0.5 1.0 − 0. 15 − 0. 05 0. 05 HCG4P3 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.1 0.2 − 0. 04 0. 00 0. 04 0. 08 HCP5 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.2 0.4 0.6 0.8 − 0. 10 0. 00 0. 10 HEBP2 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 − 0. 20 − 0. 10 0. 00 HERC5 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.2 0.2 0.6 − 0. 20 − 0. 10 0. 00 0. 10 HIP1 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.2 0.2 0.4 0.6 − 0. 15 0. 00 0. 10 HLA−F (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.2 0.4 0.6 − 0. 10 0. 00 0. 10 HLA−G (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 − 0. 20 − 0. 10 0. 00 0. 10 HLA−L (bzx) CO VI D 19 (b z y) cis−QTL −1.2 −0.8 −0.4 − 0. 05 0. 05 0. 10 0. 15 HLA−S (bzx) CO VI D 19 (b z y) cis−QTL −2.0 −1.0 0.0 0.5 − 0. 10 0. 00 0. 10 0. 20 HLA−U (bzx) CO VI D 19 (b z y) cis−QTL −0.20 −0.10 0.00 − 0. 05 0. 05 0. 10 0. 15 ICAM5 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 0.3 − 0. 20 − 0. 10 0. 00 IFI44 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 0.3 − 0. 20 − 0. 10 0. 00 IFI44L (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 0.3 − 0. 20 − 0. 10 0. 00 IFI6 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 0.3 − 0. 20 − 0. 10 0. 00 IFIT1 (bzx) CO VI D 19 (b z y) cis−QTL −0.3 −0.1 0.1 0.2 − 0. 10 0. 00 0. 10 0. 20 IFNAR1 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.2 0.4 − 0. 3 − 0. 1 0. 0 0. 1 IFNAR2 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.4 −0.2 0.0 0.2 0.4 − 0. 15 − 0. 05 0. 05 IKZF3 (bzx) CO VI D 19 (b z y) cis−QTL 0.04 0.05 0.06 0.07 0.08 − 0. 06 − 0. 02 0. 00 IRF1 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.1 0.2 − 0. 05 0. 05 0. 15 IRF7 (bzx) CO VI D 19 (b z y) cis−QTL Supplementary Figure 14: Effect size plots for significant RNA expression (eQTLgen) to GenOMICC GSMR (FDR < 0.05; n = 156). 29 −0.15 −0.05 0.05 − 0. 04 0. 00 0. 04 ISG15 (bzx) CO VI D 19 (b z y) cis−QTL −1.5 −1.0 −0.5 0.0 0.5 − 0. 1 0. 0 0. 1 0. 2 KANSL1−AS1 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2− 0. 20 − 0. 10 0. 00 0. 10 KLC1 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.2 0.4 − 0. 10 0. 00 0. 10 KLHL24 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.2 0.0 0.2 0.4 0.6 − 0. 3 − 0. 2 − 0. 1 0. 0 0. 1 LINC00649 (bzx) CO VI D 19 (b z y) cis−QTL 0.2 0.4 0.6 0.8 − 0. 15 − 0. 05 0. 05 LRRC37A16P (bzx) CO VI D 19 (b z y) cis−QTL −1.0 −0.5 0.0 0.5 − 0. 1 0. 0 0. 1 0. 2 LRRC37A2 (bzx) CO VI D 19 (b z y) cis−QTL −0.5 0.0 0.5 1.0 1.5 − 0. 3 − 0. 1 0. 1 0. 2 LRRC37A4P (bzx) CO VI D 19 (b z y) cis−QTL 0.08 0.12 0.16 − 0. 02 0. 02 0. 06 LTA (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.1 0.2 0.3 0. 0 0. 2 0. 4 MAP2K2 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 −0.1 0.0 0.1 0.2 − 0. 05 0. 00 0. 05 MARS2 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 − 0. 10 − 0. 05 0. 00 0. 05 MED24 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 0.3 − 0. 10 0. 00 0. 05 METTL8 (bzx) CO VI D 19 (b z y) cis−QTL −1.0 −0.5 0.0 0.5 1.0 − 0. 2 − 0. 1 0. 0 0. 1 MICA (bzx) CO VI D 19 (b z y) cis−QTL −0.05 0.00 0.05 0.10 − 0. 02 0. 02 0. 06 MKLN1 (bzx) CO VI D 19 (b z y) cis−QTL −0.20 −0.10 0.00 0.10 0. 0 0. 1 0. 2 0. 3 MME (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 0.3 0. 0 0. 1 0. 2 0. 3 MOSPD3 (bzx) CO VI D 19 (b z y) cis−QTL −0.06 −0.02 0.02 0.06 − 0. 06 − 0. 02 0. 02 0. 06 MS4A1 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 − 0. 2 0. 0 0. 1 0. 2 MUC1 (bzx) CO VI D 19 (b z y) cis−QTL −0.5 0.0 0.5 1.0 − 0. 3 − 0. 1 0. 1 0. 3 NAPSB (bzx) CO VI D 19 (b z y) cis−QTL Supplementary Figure 15: Effect size plots for significant RNA expression (eQTLgen) to GenOMICC GSMR (FDR < 0.05; n = 156). 30 −0.2 0.0 0.1 0.2 0.3 − 0. 1 0. 0 0. 1 0. 2 NCOR1 (bzx) CO VI D 19 (b z y) cis−QTL −0.3 −0.1 0.1 0.2 − 0. 10 0. 00 0. 10 NDUFS2 (bzx) CO VI D 19 (b z y) cis−QTL −0.3 −0.2 −0.1 0.0 0.1 0.2 − 0. 10 0. 00 0. 10 NFKBIZ (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 − 0. 04 0. 00 0. 04 NLRP6 (bzx) CO VI D 19 (b z y) cis−QTL −0.3 −0.1 0.0 0.1 0.2 − 0. 10 0. 00 0. 10 NSF (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.4 −0.2 0.0 0.2 − 0. 05 0. 05 0. 15 NTN5 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.2 0.2 0.6 − 0. 10 0. 00 0. 10 OAS1 (bzx) CO VI D 19 (b z y) cis−QTL −0.10 −0.05 0.00 0.05 − 0. 06 − 0. 02 0. 02 OAS2 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 −0.1 0.0 0.1 0.2 − 0. 10 0. 00 OBSCN (bzx) CO VI D 19 (b z y) cis−QTL −0.5 0.0 0.5 − 0. 2 − 0. 1 0. 0 0. 1 0. 2 ORMDL3 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.2 0.4 0.6 0.8 − 0. 05 0. 05 0. 15 PARP16 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 0.3 0.4 − 0. 05 0. 00 0. 05 PBX2 (bzx) CO VI D 19 (b z y) cis−QTL −0.05 0.00 0.05 − 0. 10 − 0. 05 0. 00 PPAPDC1B (bzx) CO VI D 19 (b z y) cis−QTL −0.15 −0.05 0.05 0.15 − 0. 10 0. 00 0. 05 0. 10 PPP1R3B (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 − 0. 05 0. 00 0. 05 PRRC2A (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.1 − 0. 2 − 0. 1 0. 0 0. 1 RAB2A (bzx) CO VI D 19 (b z y) cis−QTL 0.20 0.25 0.30 0.35 − 0. 15 − 0. 10 − 0. 05 0. 00 RIT1 (bzx) CO VI D 19 (b z y) cis−QTL −0.06 −0.02 0.02 0.06 − 0. 06 − 0. 02 0. 02 RNF165 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.2 0.4 0.6 − 0. 1 0. 0 0. 1 0. 2 RP11−119F19.2 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.4 0.8 − 0. 05 0. 05 0. 15 RP11−214C8.5 (bzx) CO VI D 19 (b z y) cis−QTL Supplementary Figure 16: Effect size plots for significant RNA expression (eQTLgen) to GenOMICC GSMR (FDR < 0.05; n = 156). 31 −1.0 −0.5 0.0 − 0. 05 0. 05 0. 15 RP11−259G18.1 (bzx) CO VI D 19 (b z y) cis−QTL −0.8 −0.6 −0.4 −0.2 0. 00 0. 10 0. 20 RP11−259G18.2 (bzx) CO VI D 19 (b z y) cis−QTL −1.0 −0.5 0.0− 0. 10 0. 00 0. 10 0. 20 RP11−259G18.3 (bzx) CO VI D 19 (b z y) cis−QTL −0.8 −0.4 0.0 0.2 − 0. 05 0. 05 0. 10 0. 15 RP11−486O12.2 (bzx) CO VI D 19 (b z y) cis−QTL −1.0 −0.5 0.0 0.5 − 0. 05 0. 05 0. 15 RP11−503G7.2 (bzx) CO VI D 19 (b z y) cis−QTL 0.10 0.20 0.30 0.40 − 0. 10 − 0. 06 − 0. 02 RP11−506M13.3 (bzx) CO VI D 19 (b z y) cis−QTL −1.5 −1.0 −0.5 0.0 0.5 − 0. 10 0. 00 0. 10 0. 20 RP11−707O23.5 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.2 0.4 0.6 0.8 − 0. 05 0. 05 0. 15 RP11−798G7.5 (bzx) CO VI D 19 (b z y) cis−QTL −0.8 −0.4 0.0 0.2 0.4 − 0. 10 0. 00 0. 10 RP11−798G7.6 (bzx) CO VI D 19 (b z y) cis−QTL 0.0 0.2 0.4 0.6 − 0. 05 0. 00 0. 05 0. 10 RPS18 (bzx) CO VI D 19 (b z y) cis−QTL −0.3 −0.1 0.1 0.2 0.3 − 0. 10 0. 00 0. 10 SFTPD (bzx) CO VI D 19 (b z y) cis−QTL −0.4 0.0 0.2 0.4 0.6 − 0. 10 − 0. 05 0. 00 SH3GL1P3 (bzx) CO VI D 19 (b z y) cis−QTL −0.8 −0.4 0.0 0.2 − 0. 15 − 0. 05 0. 05 SLC22A31 (bzx) CO VI D 19 (b z y) cis−QTL −0.15 −0.05 0.05 0.15 − 0. 10 0. 00 0. 05 SMARCA4 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.1 0.2 0.3 − 0. 20 − 0. 10 0. 00 0. 10 SNRPD2 (bzx) CO VI D 19 (b z y) cis−QTL −1.0 −0.5 0.0 0.5 − 0. 20 − 0. 10 0. 00 0. 10 SNX19 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.2 0.4 − 0. 1 0. 0 0. 1 0. 2 0. 3 STAG3 (bzx) CO VI D 19 (b z y) cis−QTL −0.3 −0.1 0.0 0.1 0.2 − 0. 05 0. 00 0. 05 STAM2 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.2 0.2 0.4 0.6 − 0. 10 0. 00 0. 10 STARD10 (bzx) CO VI D 19 (b z y) cis−QTL −0.10 0.00 0.05 0.10 0.15 − 0. 08 − 0. 04 0. 00 0. 04 STAT1 (bzx) CO VI D 19 (b z y) cis−QTL Supplementary Figure 17: Effect size plots for significant RNA expression (eQTLgen) to GenOMICC GSMR (FDR < 0.05; n = 156). 32 −0.8 −0.4 0.0 0.2 − 0. 15 − 0. 05 0. 05 TCF19 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.2 0.4 0.6 0.8 − 0. 20 − 0. 10 0. 00 TIMP2 (bzx) CO VI D 19 (b z y) cis−QTL −0.05 0.05 0.15 − 0. 06 − 0. 02 0. 02 TMED1 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 − 0. 1 0. 0 0. 1 0. 2 TMEM50B (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.1 0.2 0.3 − 0. 05 0. 00 0. 05 0. 10 TNF (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 − 0. 10 0. 00 0. 05 0. 10 TNFSF8 (bzx) CO VI D 19 (b z y) cis−QTL −0.6 −0.2 0.0 0.2 0.4 − 0. 10 0. 00 0. 10 TNXB (bzx) CO VI D 19 (b z y) cis−QTL −0.2 0.0 0.2 0.4 − 0. 15 − 0. 05 0. 05 0. 15 TOMM7 (bzx) CO VI D 19 (b z y) cis−QTL −0.3 −0.1 0.1 0.3 − 0. 05 0. 00 0. 05 TRBV20−1 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 0.4 − 0. 1 0. 0 0. 1 0. 2 0. 3 TTC19 (bzx) CO VI D 19 (b z y) cis−QTL −0.2 −0.1 0.0 0.1 0.2 − 0. 15 − 0. 05 0. 05 TYK2 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.3 −0.2 −0.1 0. 05 0. 10 0. 15 XRCC6 (bzx) CO VI D 19 (b z y) cis−QTL −0.4 −0.2 0.0 0.2 0.4 − 0. 10 0. 00 0. 10 ZDHHC20P1 (bzx) CO VI D 19 (b z y) cis−QTL −1.0 −0.5 0.0 0.5 − 0. 20 − 0. 10 0. 00 0. 10 ZFP57 (bzx) CO VI D 19 (b z y) cis−QTL −0.1 0.0 0.1 0.2 − 0. 05 0. 00 0. 05 ZSCAN21 (bzx) CO VI D 19 (b z y) cis−QTL −1.0 −0.5 0.0 0.5 − 0. 2 0. 0 0. 1 0. 2 ZSWIM7 (bzx) CO VI D 19 (b z y) cis−QTL Supplementary Figure 18: Effect size plots for significant RNA expression (eQTLgen) to GenOMICC GSMR (FDR < 0.05; n = 156). 33 Supplementary Figure 19: Concordance of effect-size estimates using different Mendelian randomisation (MR) methods: GSMR, IVW, Mode, PRESSO, Robust, Simple Median, and Weighted Median. y-axis: effect-size estimates and 95% confidence interval. Significant RNA expression (eQTLgen) to GenOMICC GSMR results displayed (FDR < 0.01; n = 79). 34 Supplementary Figure 20: Concordance of effect-size estimates using different Mendelian randomisation (MR) methods: GSMR, IVW, Mode, PRESSO, Robust, Simple Median, and Weighted Median. y-axis: effect-size estimates and 95% confidence interval. Significant RNA expression (eQTLgen) to GenOMICC GSMR results displayed (FDR < 0.01; n = 79). 35 Supplementary Figure 21: Concordance of effect-size estimates using different Mendelian randomisation (MR) methods: GSMR, IVW, Mode, PRESSO, Robust, Simple Median, and Weighted Median. y-axis: effect-size estimates and 95% confidence interval. Significant RNA expression (eQTLgen) to GenOMICC GSMR results displayed (FDR < 0.01; n = 79). 36 Supplementary Figure 22: Concordance of effect-size estimates using different Mendelian randomisation (MR) methods: GSMR, IVW, Mode, PRESSO, Robust, Simple Median, and Weighted Median. y-axis: effect-size estimates and 95% confidence interval. Significant RNA expression (eQTLgen) to GenOMICC GSMR results displayed (FDR < 0.01; n = 79). 37 Supplementary Figure 23: Concordance of effect-size estimates using different Mendelian randomisation (MR) methods: GSMR, IVW, Mode, PRESSO, Robust, Simple Median, and Weighted Median. y-axis: effect-size estimates and 95% confidence interval. Significant RNA expression (eQTLgen) to GenOMICC GSMR results displayed (FDR < 0.01; n = 79). 38 Supplementary Figure 24: Concordance of effect-size estimates using different Mendelian randomisation (MR) methods: GSMR, IVW, Mode, PRESSO, Robust, Simple Median, and Weighted Median. y-axis: effect-size estimates and 95% confidence interval. Significant RNA expression (eQTLgen) to GenOMICC GSMR results displayed (FDR < 0.01; n = 79). 39 Supplementary Figure 25: Concordance of effect-size estimates using different Mendelian randomisation (MR) methods: GSMR, IVW, Mode, PRESSO, Robust, Simple Median, and Weighted Median. y-axis: effect-size estimates and 95% confidence interval. Significant RNA expression (eQTLgen) to GenOMICC GSMR results displayed (FDR < 0.01; n = 79). 40 Supplementary Figure 26: Concordance of effect-size estimates using different Mendelian randomisation (MR) methods: GSMR, IVW, Mode, PRESSO, Robust, Simple Median, and Weighted Median. y-axis: effect-size estimates and 95% confidence interval. Significant RNA expression (eQTLgen) to GenOMICC GSMR results displayed (FDR < 0.01; n = 79). 41 10 Fine mapping We have performed fine-mapping to compute credible sets of variants for the identified loci. In a small number of regions, the finemapping algorithm fails to converge, with quality controls pointing at the lack of a suitable linkage disequilibrium panel as a potential cause. Finemapping using meta analysis summary statistics from heterogenous cohorts, as is the case here, is difficult and remains an open problem with existing finemapping methods recently shown to perform poorly in this context.9 While we note these limitations, we provide the obtained credible sets to aid any further functional work (Supplementary Figures 27-44, Supplementary Table 5). -lo g P 0 5 10 rs2478868 ←RERE RPL7P11→ ←RPL7P7 ←Y_RNA ENSG00000226545→ ←ENSG00000228423 RPL23AP19→ ←ENO1 ←MIR6728 ENO1-AS1→ ←RNU6-304P HMGN2P17→ ←ENSG00000232208 ENSG00000232663→ CA6→ ←ENSG00000290109 ←RN7SL451P ←SLC2A7 ←SLC2A5 ENSG00000252404→ ←GPR157 ←MIR34AHG ←MIR34A ←ENSG00000289914 LNCTAM34A→ H6PD→ SPSB1→ ←ENSG00000284652 ←LINC02606 ←RNA5SP40 ←ENSG0000023 SLC25A ~8.6 Mb Chr 1 ~9.6 Mb (a) -lo g P 0 5 10 rs12046291 CACHD1→ MIR4794→ RAVER2→ ←JAK1 ENSG00000234784→ ENSG00000233877→ ←LINC01359 ←SLC2A3P2 ←ENSG00000272506 ←RNU6-1176P ←MIR3671 ←MIR101-1 ENSG00000288804→ ←ENSG00000235804 ←MRPS21P1 AK4→ RPS29P7→ DNAJC6→ ←ENSG00000229294 ←COX6CP13 ENSG00000290094→ RNU2-15 LEPRO ~64.4 Mb Chr 1 ~65.4 Mb (b) Supplementary Figure 27: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 42 -lo g P 0 5 10 rs71658797 AC5→ MIR7156→ SG00000288543→ SG00000230498→ ←PIGK ENSG00000226084→ ENSG00000228187→ ENSG00000289212→ ENSG00000287870→ AK5→ ←ENSG00000233099 RNU7-8P→ ←ENSG00000287647 ←ZZZ3 RNA5SP20→ RN7SL370P→ ←USP33 ←ACTG1P21 MIGA1→ RNA5SP21→ ←ENSG00000219201 NSRP1P1→ HSPE1P25→ ←NEXN-AS1 NEXN→ ←FUBP DNAJ ~77.0 Mb Chr 1 ~78.0 Mb (a) -lo g P 0 5 10 15 rs1123573 SG00000285611→ ←MIR4432HG ENSG00000287640→ RNU1-32P→ ←MIR4432 ←BCL11A ENSG00000233953→ RN7SL361P→ ←IFITM3P9 RPL26P13→ RNU6-612P→ ←ATP1B3P1 PAPOLG→ ←REL-DT ←RN7SL632P RPL21P33→ REL→ RNU4-51P→ ENSG00000267 ←NONOP ←RPS12P ←PU ~60.0 Mb Chr 2 ~61.0 Mb (b) Supplementary Figure 28: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 43 -lo g P 0 5 10 rs11706494 PG2 ←SENP7 ZNF90P1→ FAM136CP→ ←ENSG00000282978 Y_RNA→ FAM172BP→ TRMT10C→ PCNP→ ←ENSG00000242299 ENSG00000289629→ ←RPL32P7 RNU6-1256P→ ←ZBTB11 ←RNY1P12 ZBTB11-AS1→ ←RPL24 PDCL3P4→ CEP97→ NXPE3→ ←ENSG00000249474 NFKBIZ→ ENSG00000287682→ RDUR→ ENSG00000241280→ ZPLD ~101.3 Mb Chr 3 ~102.3 Mb (a) -lo g P 0 3 6 9 rs343314 ←PLOD2 G00000261051 G00000243415→ LNCSRLR ←PLSCR4 ←ENSG00000243596 ←ENSG00000241358 ←PLSCR2 ←ENSG00000279320 ←PLSCR1 RNU6-428P→ ←PLSCR5 PLSCR5-AS1→ ← LINC02010→ ←RNU6-5 ~146.0 Mb Chr 3 ~147.0 Mb (b) Supplementary Figure 29: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 44 -lo g P 0 3 6 9 rs7664615 49 ←LGI2 ←SEPSECS SEPSECS-AS1→ PI4K2B→ ENSG00000271172→ U2→ ZCCHC4→ ANAPC4→ ENSG00000249320→ ENSG00000248608→ ENSG00000248545→ ←RNU7-126P ENSG00000228154→ SLC34A2→ RPS29P11→ ←SLIRPP2 ←MTND4P9 ←MTND4LP22 ←MTND3P5 ←MTCO3P44 ←SEL1L3 ENSG00000250541→ SMIM20→ ←ENSG00000251 ~24.9 Mb Chr 4 ~25.9 Mb (a) -lo g P 0 3 6 9 rs72670002 TET2→ T2-AS1 RN7SL89P→ ←PPA2 RNU6-553P→ EEF1A1P9→ ←PIMREGP2 ATP5F1EP1→ ←ENSG00000250522 ARHGEF38→ ARHGEF38-IT1→ ←ENSG00000248778 ←INTS12 GSTCD→ ←GSTCD-AS1 NPNT→ ←ENSG00000250740 ←ENSG00000249635 ←T ~105.2 Mb Chr 4 ~106.2 Mb (b) Supplementary Figure 30: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 45 -lo g P 0 5 10 rs1073165 ←RN7SL776P PHB1P14→ RN7SKP188→ ←ENSG00000270336 ←ENSG00000248601 ANXA10→ ←ENSG00000287188 ←DDX60 ~167.3 Mb Chr 4 ~168.3 Mb (a) -lo g P 0 5 10 rs2269821 N 000281938 0000234758→ ←ACSL6 ACSL6-AS1→ NSG00000231585→ IL3→ CSF2→ ENSG00000253067→ ←ENSG00000227616 ←ENSG00000235775 ←ENSG00000224015 P4HA2-AS1→ ←P4HA2 ENSG00000224431→ ←MIR6830 PDLIM4→ SLC22A4→ ←MIR3936HG ←MIR3936 SLC22A5→ IRF1-AS1→ ENSG00000283782→ ←LINC02863 ←IRF1 Y_RNA→ ←IL5 RAD50→ ←TH2LCRR IL13→ IL4→ ENSG00000230612→ ←KIF3A CCNI2→ ←SEPTIN8 SOWAHA→ ←ENSG0000027220 ←SHROOM1 RNA5SP192→ ←GDF9 UQCRQ→ LEAP2→ ←AF ~131.9 Mb Chr 5 ~132.9 Mb (b) Supplementary Figure 31: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 46 -lo g P 0 5 10 rs2858305 OTCH4 TSBP1-AS1→ ←TSBP1 HNRNPA1P2→ RNU6-603P→ ←BTNL2 HLA-DRA→ ←HLA-DRB9 ←HLA-DRB5 ←RNU1-61P ←HLA-DRB6 ←HLA-DRB1 HLA-DQA1→ ←HLA-DQB1 HLA-DQB1-AS1→ ←MTCO3P1 ENSG00000232080→ ←HLA-DQB3 HLA-DQA2→ ←MIR3135B ←HLA-DQB2 ←HLA-DOB ←ENSG00000250264 ←TAP2 ←PSMB8 PSMB8-AS1→ PSMB9→ ←TAP1 ←PPP1R2P1 ←ENSG00000289559 ENSG00000289047→ HLA-Z→ ←HLA-DMB ←ENSG00000248993 ←HLA-DMA BRD2→ ENSG00000223837→ ←ENSG00000263756 ←HLA-DOA ←HLA-DPA1 HLA-DPB1→ RPL32P1→ ←HLA-DPA2 ←COL11A2P1 ENSG0000029111 HLA-DPB2→ ←HLA-DPA3 HCG24→ ←COL1 ←RX RNY4P SLC39 ~32.2 Mb Chr 6 ~33.2 Mb (a) -lo g P 0 10 20 rs41435745 NC5CL ←OARD1 SPO2→ POBEC2→ NFYA→ NSG00000287678 ADCY10P1→ ←TREML1 ENSG00000290034→ ←TREM2 ←TREML2 ←ENSG00000290563 ←TREML3P TREML4→ ←RNA5SP207 TREML5P→ ENSG00000274256→ ENSG00000278745→ ←TREM1 ←ENSG00000218809 ←RNU6-643P ←RPL32P15 NCR2→ ←ENSG00000279284 ENSG00000280371→ ←FOXP4-AS1 LINC01276→ FOXP4→ MIR4641→ MDFI→ NPM1P51→ ←TFEB ENSG00000231102→ ←PGC ←ENSG00000269387 ←FRS3 ENSG00000124593→ PRICKLE4→ TOMM6→ ←USP49 ENSG00000268745→ ←ENSG00000288721 ENSG00000206977→ ENSG00000227516→ ←MED20 ←Y_RNA BYSL→ ←CCND ←RNU6 ~41.0 Mb Chr 6 ~42.0 Mb (b) Supplementary Figure 32: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 47 -lo g P 0 5 10 rs1179620 RD2B→ ←NCF1C ←GTF2IP1 PHB1P6→ ENSG00000277675→ ENSG00000263081→ ←ENSG00000275121 SPDYE13→ ←PMS2P13 ←Y_RNA SPDYE14→ ←PMS2P10 SPDYE15→ ←PMS2P2 ENSG00000290951→ STAG3L1→ ←ENSG00000290834 ←ENSG00000146722 TRIM73→ NSUN5P1→ ←POM121C ←ENSG00000242073 SPDYE5→ ←PMS2P3 ←HIP1 ←ENSG00000279996 ←CCL26 ←CCL24 ENSG00000219039→ RHBDD2→ POR→ MIR4651→ RPL7L1P3→ SNORA14A→ ←TMEM120A ←STYXL1 ←ENSG00000280 MDH2→ ←ENSG000002 RNU6-863 ←ENSG0000 ←GTF2 ←RABG ←ENSG000 ~75.1 Mb Chr 7 ~76.1 Mb (a) -lo g P 0 5 10 rs2897075 AN5→ AM200A NF655→ 00000272647→ TMEM225B→ ZSCAN25→ ←ENSG00000224448 ←CYP3A5 ←CYP3A7-CYP3A51P ←CYP3A51P ←CYP3A7 ←CYP3A4 ENSG00000273407→ CYP3A137P→ CYP3A43→ ENSG00000260445→ CYP3A52P→ ←OR2AE1 ←TRIM4 ←GJC3 ENSG00000237640→ Y_RNA→ ENSG00000222966→ ←AZGP1 ENSG00000286921→ AZGP1P1→ ENSG00000235713→ ENSG00000286923→ ZKSCAN1→ ZSCAN21→ ←ZNF3 COPS6→ ←MCM7 ←MIR25 ←MIR93 ←MIR106B AP4M1→ ←TAF6 ←ENSG00000242798 CNPY4→ MBLAC1→ ENSG00000235077→ ←RPL7P60 ←ENSG00000288976 LAMTOR4→ ←TRAPPC14 ←MIR4658 ←GAL3ST4 ←GPC2 STAG3→ ←CASTOR3P PVRIG→ ←ENSG00000291178 SPDYE3→ ←PMS2P1 STAG3L5P→ STAG3L5P-PVRIG2P-PILRB→ PILRB→ PVRIG2P→ MIR6840→ PILRA→ ←ENSG00000287631 ENSG00000289691→ ENSG00000289690→ ←ZCWPW1 MEPCE→ ENSG00000241357 ←PPP1R35 PPP1R35-AS1→ ←SPACDR ←TSC22D4 ←ENSG000002 ←ENSG000002 NYAP1→ ENSG000002 ←RN7S ~99.5 Mb Chr 7 ~100.5 Mb (b) Supplementary Figure 33: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 48 -lo g P 0 3 6 9 rs13276831 G00000254775→ SLC2A13P1→ ←CA8 ←LINC01301 PDCL3P1→ RAB2A→ ←ENSG00000255321 ←ENSG00000228862 ENSG00000255289→ CHD7→ ←ENSG00000254432 ENSG00000287975→ IFITM3P8→ ENSG00000254777 ←NASPP1 ←ENSG0000025 ~60.0 Mb Chr 8 ~61.0 Mb (a) -lo g P 0 5 10 rs28368148 FOCAD→ R491→ SNORA30B→ ←HACD4 ←IFNNP1 ←IFNB1 IFNWP4→ ←ENSG00000275980 ←IFNW1 ←Y_RNA ←IFNA21 ←IFNWP15 ←IFNA4 ←IFNWP9 ←IFNA7 ←IFNA10 ←IFNWP18 ←IFNA16 ←IFNA17 ←IFNWP5 ←IFNA14 ←IFNA22P ←IFNA5 IFNA20P→ ←KLHL9 ←IFNA6 ←IFNA13 ←MIR31HG ←IFNA2 ←ENSG00000261696 ←IFNA11P IFNA12P→ IFNA8→ IFNWP2→ IFNA1→ IFNWP19→ ←IFNE ←MIR31 ←SNORD39 H3P30→ KHSRP RN7SL1 ~20.7 Mb Chr 9 ~21.7 Mb (b) Supplementary Figure 34: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 49 -lo g P 0 5 10 rs60840586 ←APTX A3P4→ S1P12→ ←TCEA1P4 ←LAGE3P1 DNAJA1→ ←SMU1 ←B4GALT1 B4GALT1-AS1→ RNU4ATAC15P→ SPINK4→ ←BAG1 CHMP5→ NFX1→ ←Y_RNA ←AQP7 ENSG00000286322→ ←AQP3 ENSG00000270542→ ←NOL6 ←MIR6851 ←SUGT1P1 ←ENSG00000228072 ANKRD18B→ ←ENSG00000225123 SNX18P7→ CYP4F26P→ ←PRSS3P4 TRBV20OR9-2→ ANXA2P2→ TRBV21OR9-2→ TRBV22OR9-2→ TRBV23OR9-2→ TRBV24OR9-2→ TRBV25OR9-2→ ←PTENP1 PTENP1-AS→ TRBV26OR9-2→ ENSG00000260947→ ENSG00000287063→ ENSG00000227301→ ENSG00000287495→ ←UBE2R2-AS1 PRSS3→ TRBV29OR9-2→ UBE2R2→ RNU4ATAC11 ~32.9 Mb Chr 9 ~33.9 Mb (a) -lo g P 0 5 10 15 rs879055593 ←AK8 SPACA9→ ←TSC1 GFI1B→ MIR548AW→ ENSG00000234907→ RNU7-21P→ EEF1A1P5→ ←ENSG00000288989 GTF3C5→ MIR6877→ CEL→ ENSG00000290769→ CELP→ ←RALGDS ←ENSG00000285245 ←GBGT1 ←OBP2B ←LCN1P1 ←ABO Y_RNA→ LCN1P2→ ←SURF6 ←MED22 ENSG00000230064→ RPL7A→ SNORD24→ SNORD36B→ SNORD36A→ SNORD36C→ ←SURF1 SURF2→ ←SURF4 STKLD1→ ←REXO4 ADAMTS13→ CACFD1→ ←SLC2A6 ←MYMK ADAMTSL2→ ←FAM163B ←ENSG00000261018 DBH→ ←DBH-AS1 ←SARDH ~132.8 Mb Chr 9 ~133.8 Mb (b) Supplementary Figure 35: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 50 -lo g P 0 5 10 rs721917 ←TPRX1P1 SG00000241317 SG00000235705 EIF5AL1→ NSG00000271985 RPS12P18→ ←SFTPA2 ←MBL3P ←SFTPA3P SFTPA1→ ←LINC02679 ENSG00000244733→ ←NUTM2B-AS1 ENSG00000272489→ ←ENSG00000280355 BEND3P3→ ←ENSG00000224886 NUTM2B→ ENSG00000272447→ NUTM2E→ NPAP1P2→ ←CTSLP6 ←PGGT1BP2 ENSG00000283913→ BMS1P21→ MBL1P→ ←SFTPD SFTPD-AS1→ ZNRF2P3→ ←DPY19L2P5 ←ENSG00000229616 ←C1DP3 ←C1DP2 ←C1DP4 ←TMEM254-AS1 ←ENSG00000282432 TMEM254→ ←ENSG00000279399 RPL22P18→ PLAC9→ ←ANXA11 LINC00857→ ←RPS12P2 ENSG00000234382→ ←EIF5AP4 ENSG00000279359→ ←MAT1A ZNF519P1→ ENSG00000235858→ ←DYDC1 DYDC2→ PRXL2A ~79.4 Mb Chr 10 ~80.4 Mb (a) -lo g P 0 5 10 15 rs35705950 L2→ 000269915 ALDO1→ ←GATD1 GATD1-DT→ G00000279672→ G00000255142→ ←CEND1 ←SLC25A22 PANO1→ ←PIDD1 RPLP2→ SNORA52→ PNPLA2→ ←ENSG00000255108 CRACR2B→ CD151→ ←POLR2L TSPAN4→ ←ENSG00000250397 ←CHID1 AP2A2→ RNU6-1025P→ ←MUC6 LINC02688→ MUC2→ MUC5AC→ ENSG00000286275→ MUC5B→ ←MUC5B-AS1 MIR6744→ ←TOLLIP TOLLIP-DT→ ←ENSG00000287935 LINC02689→ BRSK2→ ←ENSG00000285581 ←MOB2 ←DUSP8 KRTAP5-AS1→ ←KRTAP5-1 ←KRTAP5-2 ←KRTAP5-3 ←KRTAP5-4 KRTAP5-5→ ←ENSG0000023 FAM99A→ ←FAM99 LINC0270 KRTAP5 ~0.7 Mb Chr 11 ~1.7 Mb (b) Supplementary Figure 36: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 51 -lo g P 0 10 20 rs61882275 NSG00000286626 CAPRIN1→ NAT10→ ←ABTB2 Y_RNA→ ←MMADHCP2 ←ENSG00000220204 CIR1P3→ CAT→ ←ELF5 ←ENSG00000255271 LINC02707→ EHF→ ENSG00000271369→ ENSG00000270491→ ←APIP PDHX MIR1343 ~34.0 Mb Chr 11 ~35.0 Mb (a) -lo g P 0 5 10 15 rs2660 PTPN11→ RPH3A→ ←MIR1302-1 OAS1→ ←ENSG00000257452 OAS3→ OAS2→ IMMP1LP2→ RPS15AP32→ DTX1→ ←RASAL1 CFAP73→ ←Y_RNA ←DDX54 ←MIR7106 RITA1→ ←ENSG00000257286 ←IQCD TPCN1→ ENSG00000277566→ MIR6762→ ←SLC8B1 PLBD2→ ENSG00000288 ←SD ~112.4 Mb Chr 12 ~113.4 Mb (b) Supplementary Figure 37: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 52 -lo g P 0 5 10 15 rs11614702 EP400→ NORA49→ ENSG00000257000 ←ENSG00000274670 ENSG00000291171→ ←ENSG00000279640 EP400P1→ ←ENSG00000256804 ←DDX51 NOC4L→ ENSG00000276693→ ←LINC02361 ENSG00000256312→ ←GALNT9 ENSG00000279480→ ENSG00000256943→ ENSG00000256542→ ←ENSG00000278872 ENSG00000277011→ ENSG00000255916→ ENSG00000279113→ ENSG00000286008→ ENSG00000279704→ ENSG00000279023→ ENSG00000280150→ ←ENSG00000274373 ENSG00000256783→ ENSG00000256875→ FBRSL1→ ENSG00000280287→ ENSG00000279700→ MIR6763→ ←ENSG00000277186 ←LRCOL1 P2RX2→ ←ENSG00000280311 ←POLE PXMP2→ ENSG00000256632→ PGAM5→ ←RNA5SP379 ←ANKLE2 ENSG00000256108→ ←GOLGA3 ←CHFR RPS11P5→ ←RNU6-327P ←ENSG00000278949 CHFR-DT→ ENSG0000025570 ENSG000002507 ←ZNF605 ENSG00000 ←NANOG ~132.0 Mb Chr 12 ~133.0 Mb (a) -lo g P 0 10 20 rs12585036 ACA7→ ←TUBGCP3 ←ENSG00000277159 ATP11AUN→ ←ENSG00000274922 ATP11A→ ←ATP11A-AS1 ENSG00000277545→ MCF2L→ ←ENSG00000267868 ←MCF2L-AS1 ENSG00000289354→ ENSG00000269356→ ENSG00000269376→ F7→ F10→ ←F10-AS1 KARS1P2→ ←ENSG00000283828 PROZ→ ←ENSG00000269125 ←PCID2 CUL4A→ MIR8075→ LDHBP1→ LAMP1→ ←GRTP ←ENSG000002 GRTP1-A ~112.4 Mb Chr 13 ~113.4 Mb (b) Supplementary Figure 38: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 53 -lo g P 0 5 10 15 rs117169628 NF166 00259813→ TU2→ 00000278341 ←PIEZO1 MIR4722 000260121→ 00000224888→ 00000260617→ 00000182376→ CDT1→ ←APRT ←GALNS TRAPPC2L→ ←PABPN1L ←CBFA2T3 ENSG00000259881→ ←ENSG00000261226 ENSG00000205018→ ENSG00000259989→ ←ENSG00000256982 ACSF3→ ←ENSG00000261546 LINC00304→ LINC02138→ CDH15→ ←SLC22A31 ←ZNF778-DT ZNF778→ ←ENSG00000260659 ←ANKRD11 ENSG00000268218→ ENSG00000260279→ ←ENSG00000288715 ENSG00000261253→ ←ENSG00000261692 ENSG00000287351→ RNU6-430P→ ENSG00000270832→ SPG7→ ←ENSG00000261118 RPL13→ SNORD68→ CPNE7→ DPEP1→ ←CHMP1 SPATA33 ENSG000002 CDK1 ←LINC0 ~88.7 Mb Chr 16 ~89.7 Mb (a) -lo g P 0 5 10 rs12941811 K12→ RNU6-233P G00000273576→ ←NEUROD2 ENSG00000214546→ PPP1R1B→ STARD3→ TCAP→ PNMT→ ←PGAP3 ERBB2→ MIR4728→ ←MIEN1 GRB7→ ←IKZF3 ←KRT8P34 ←ENSG00000226117 ZPBP2→ ←GSDMB ←ORMDL3 LRRC3C→ ENSG00000264968→ GSDMA→ PSMD3→ ←ENSG00000265799 CSF3→ ←MED24 ←MIR6884 ←SNORD124 THRA→ ←NR1D1 ←ENSG00000279199 MSL1→ CASC3→ MIR6866→ RAPGEFL1→ MIR6867→ WIPF2→ CDC6→ RARA→ ←ENSG00000287644 ←RARA-AS1 ←ENSG00000278918 ←GJD3 GJD3-AS1→ PPIAP54→ RNA5SP441→ ←ENSG00000278346 ←TOP2A ←Y_RNA ←RPL23AP7 IGFBP4→ ←ENSG00000 ←TN ~39.5 Mb Chr 17 ~40.5 Mb (b) Supplementary Figure 39: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 54 -lo g P 0 5 10 15 rs8080583 1P1→ 0000285668 00280022→ PK8IP1P2 S26P8→ NC02210→ LINC02210-CRHR1→ ←ENSG00000265547 ←ENSG00000265964 CRHR1→ ←MAPT-AS1 SPPL2C→ MAPT→ MAPT-IT1→ ←ENSG00000262881 Metazoa_SRP→ STH→ ←KANSL1 ENSG00000262372→ KANSL1-AS1→ ←Y_RNA MAPK8IP1P1→ ←ENSG00000262539 ENSG00000291018→ ENSG00000261575→ ←ARL17B ←ENSG00000289729 LRRC37A→ RN7SL656P→ NSFP1→ ←ARL17A RDM1P2→ LRRC37A2 RN7SL199P ←FAM2 ~45.6 Mb Chr 17 ~46.6 Mb (a) -lo g P 0 5 10 15 rs77534576 2-AS1→ G00000262039→ 000250948→ G00000186244 ←PHB1 00000250186→ ←Y_RNA ←EIF4EP2 ←LINC02075 ←ENSG00000279036 NGFR→ ←NGFR-AS1 MIR6165→ ←ENSG00000250310 NXPH3→ ←SPOP ←SLC35B1 ENSG00000250751→ ←FAM117A KAT7→ SRP14P3→ ENSG00000262837→ ←TAC4 ENSG00000204584→ ENSG00000248954→ ENSG00000254039→ ENSG00000249176→ ←RNU6-1313P DLX4→ ←DLX3 ENSG00000248172→ ←PICART1 ITGA3→ ENSG00000276851→ PDK2→ ←ENSG00000275025 ←ENSG00000250282 ←SAMD14 ←PPP1R9B ENSG00000236472→ ←ENSG00000253730 ←ENSG00000261959 SGCA→ ←H1-9P ←COL1A1 ENSG00000249406→ ←ENSG00000263176 SUMO2P7→ TMEM92→ ←TMEM92-AS XYLT ←ENSG00 ~49.4 Mb Chr 17 ~50.4 Mb (b) Supplementary Figure 40: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 55 -lo g P 0 20 40 60 rs12610495 D24→ BI3→ G00000280247 YJU2→ SHD→ ←TMIGD2 FSD1→ ←STAP2 ENSG00000269425→ MPND→ ←ENSG00000269807 ←EIF1P6 ←ENSG00000269318 ←SH3GL1 ENSG00000267980→ CHAF1A→ ←ENSG00000267255 ←UBXN6 MIR4746→ ENSG00000267030→ ENSG00000280239→ ENSG00000267769→ ←ENSG00000267011 HDGFL2→ ←PLIN4 ←PLIN5 ←ENSG00000267385 ←LRG1 ←SEMA6B ENSG00000267408→ TNFAIP8L1→ ←MYDGF ←ENSG00000268565 ←DPP9 DPP9-AS1→ ENSG00000287884→ MIR7-3HG→ MIR7-3→ ←ENSG00000268536 FEM1A→ ←ENSG00000269604 ←ENSG00000290068 ←TICAM1 ENSG00000267484→ ←PLIN3 ←ARRDC5 UHRF1→ MIR4747→ KDM4B→ ← PTPRS-AS ~4.2 Mb Chr 19 ~5.2 Mb (a) -lo g P 0 10 20 30 rs34536443 rs142770866 ←OLFM2 ←COL5A3 ENSG00000267650→ RDH8→ C3P1→ MIR5589→ SHFL→ ←ENSG00000267387 ←ANGPTL6 PPAN-P2RY11→ PPAN→ SNORD105→ SNORD105B→ P2RY11→ ←EIF3G ←DNMT1 ←S1PR2 MIR4322→ MRPL4→ ←ENSG00000266978 ←ENSG00000267105 ICAM1→ ←ICAM4-AS1 ICAM4→ ICAM5→ ←ZGLP1 ←ENSG00000167807 ←FDX2 ←ENSG00000267303 ←RAVER1 ENSG00000274425→ ←ICAM3 ←TYK2 ←CDC37 ←MIR1181 PDE4A→ ←KEAP1 ←ENSG00000267197 ←S1PR5 ATG4D→ ←RNU7-140P MIR1238→ ←KRI1 ←CDKN2D ←AP1M2 ←ENSG00000271010 SLC44A2→ ←ILF3-DT ILF3→ QTRT1→ DNM2→ MIR638→ MIR4748→ ←MIR199A1 MIR6793→ ←TMED1 C19orf38→ HIKESHIP2→ CARM ~9.9 Mb Chr 19 ~10.9 Mb (b) Supplementary Figure 41: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 56 -lo g P 0 5 10 15 rs516246 CARD8 00268583→ ARD8-AS1→ ←ZNF114-AS1 ZNF114→ ←ODAD1 EMP3→ ←TMEM143 SYNGR4→ ←KDELR1 GRIN2D→ GRWD1→ KCNJ14→ ←ENSG00000268530 ENSG00000268465→ CYTH2→ ←LMTK3 ←ENSG00000287603 SULT2B1→ ←FAM83E SPACA4→ ←RPL18 ←ENSG00000268093 SPHK2→ ←DBP ←CA11 SEC1P→ ←NTN5 FUT2→ ←MAMSTR ←RASIP1 ←IZUMO1 ←FUT1 FGF21→ ←RNU6-317P ←BCAT2 ENSG00000286024→ ←HSD17B14 ←PLEKHA4 PPP1R15A→ ←TULP2 NUCB1→ ←NUCB1-AS1 ENSG00000260366→ DHDH→ BAX→ ENSG00000267898→ FTL→ ←GYS1 RUVBL2→ MIR6798→ ←LHB ←ENSG00000268655 ←CGB3 ←ENSG00000267335 ←NTF6A NTF6G→ CGB2→ ←CGB1 ←NTF6B ENSG00000268669→ CGB5→ ←CGB8 ←ENSG00000269706 ←CGB7 ←ENSG00000283663 ←ENSG00000283251 ENSG00000268108→ ←NTF4 ENSG00000268287→ ←KCNA7 RN7SL708P→ SNRNP70→ LIN7B→ ←C19orf73 PPFIA3→ ←HRC TRPM4 ~48.2 Mb Chr 19 ~49.2 Mb (a) -lo g P 0 5 10 15 rs35463555 NKP KT1S1 1D17→ 4750→ ←IL4I1 ←NUP62 SG00000269179 ATF5→ MIR4751→ ←SIGLEC11 ←U3 SIGLEC16→ ←VRK3 Metazoa_SRP→ ZNF473→ ←ENSG00000269091 ZNF473CR→ ←ENSG00000269540 ENSG00000267890→ ←ENSG00000287001 ←IZUMO2 MYH14→ ←ENSG00000267815 ←KCNC3 NR1H2→ ←ENSG00000291230 ←NAPSB ←NAPSA ←ENSG00000269392 POLD1→ ENSG00000142539→ SPIB→ MYBPC2→ ←GARIN5A EMC10→ ←ENSG00000268854 ←ENSG00000268518 ←ENSG00000289950 ←JOSD2 ←ASPDH ←LRRC4B ←ENSG00000268231 ←SYT3 C19orf81→ ←SHANK1 CLEC11A→ GPR32P1→ GPR32→ ←ENSG000002613 ACP4→ ←ENSG00000268 ←C19orf48 ←SNORD88B ←SNORD88A ←SNORD88C ←ENSG0000028 TMEM277P→ ←KLK1 ←KLK15 ENSG0000026 KLK3 KLK ~49.9 Mb Chr 19 ~50.9 Mb (b) Supplementary Figure 42: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 57 -lo g P 0 3 6 9 rs2326788 8→ 00286235→ M8-AS1 000275632→ L498P→ CRLS1→ ←LRRN4 NSG00000278192 ←FERMT1 ←TARDBPP1 ENSG00000234241→ ENSG00000271565→ ENSG00000276915→ CASC20→ ←LINC01713 BMP2→ ~6.0 Mb Chr 20 ~7.0 Mb (a) -lo g P 0 10 20 30 40 50 rs188401375 rs9636867 rs8178521 rs76608815 P1-AS1→ AXBP1 C21orf62-AS1→ G00000279690 ←C21orf62 NSG00000224427 ←SNORA70 NSG00000232360 ←ENSG00000227757 LINC01690→ OLIG2→ LINC00945→ OLIG1→ ←ENSG00000226527 ENSG00000226433→ ←LINC01548 IFNAR2→ ENSG00000249624→ ←IL10RB-DT IL10RB→ ←ENSG00000289238 IFNAR1→ USF1P1→ ENSG00000289939→ IFNGR2→ ←TMEM50B ←RPS5P3 ←ENSG00000231355 ←DNAJC28 ←GART ←BTF3P6 SON→ MIR6501→ ←DONSON ←ENSG00000249209 ←CRYZL1 ITSN1→ ←ATP5PO LINC00649→ ←RN7SL740P ←ENSG00000273102 MRPS6→ SLC5A3→ ENSG00000272657→ ←RPS5P2 LINC00310→ ENSG00000214955→ ←ENSG0000022 KCNE2→ SMIM11→ ←C21orf14 ENSG0000027 ←SMIM3 ENSG0000027 ←KC ←ENSG0000 ~32.7 Mb Chr 21 ~34.5 Mb (b) Supplementary Figure 43: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 58 -lo g P 0 5 10 rs915823 G00000286425 ←LINC00323 MIR3197→ BACE2→ ←PLAC4 BACE2-IT1→ FAM3B→ MX2→ MX1→ ←ENSG00000228318 ←TMPRSS2 ENSG00000207503→ ←ENSG00000232806 ←ENSG00000223400 PCSEAT→ LINC00111→ ←LINC00479 LINC00112→ ←RIPK4 ENSG00000236883→ ←MIR6814 ENSG00000289513→ ←PRDM15 ENSG00000236545→ ←ENSG0000022769 ENSG00000251778 ←C2CD2 ~41.0 Mb Chr 21 ~42.0 Mb (a) Supplementary Figure 44: Fine mapping results obtained using SuSiE for regions surrounding lead vari- ants. Lead variants are indicated from conditional analysis are indicated by diamonds. Variants contained in 95% credible sets are colored by set membership. Protein coding genes are shown in the lower panels. 59 11 Change in allele frequency over time 60 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0 200 400 600 800 1000 1200 Sa m pl e Si ze (a) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr1:9067157:C:A (rs2478868) (b) 20 20 -03 -01 20 20 -05 -01 20 20 -07 -01 20 20 -09 -01 20 20 -11 -01 20 21 -01 -01 20 21 -03 -01 20 21 -05 -01 20 21 -07 -01 20 21 -09 -01 20 21 -11 -01 0.1 0.2 0.3 0.4 0.5 Ef fe ct A lle le Fr eq ue nc y chr1:64948270:A:G (rs12046291) (c) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr1:77501822:T:A (rs71658797) (d) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr1:155066988:C:T (rs114301457) (e) 20 20 -03 -01 20 20 -05 -01 20 20 -07 -01 20 20 -09 -01 20 20 -11 -01 20 21 -01 -01 20 21 -03 -01 20 21 -05 -01 20 21 -07 -01 20 21 -09 -01 20 21 -11 -01 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 Ef fe ct A lle le Fr eq ue nc y chr1:155175305:G:A (rs7528026) (f) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 Ef fe ct A lle le Fr eq ue nc y chr1:155197995:A:G (rs41264915) (g) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.5 0.6 0.7 0.8 0.9 1.0 Ef fe ct A lle le Fr eq ue nc y chr1:155278322:A:T (rs11264349) (h) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.50 0.55 0.60 0.65 0.70 0.75 Ef fe ct A lle le Fr eq ue nc y chr2:60480453:A:G (rs1123573) (i) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 Ef fe ct A lle le Fr eq ue nc y chr3:45818159:G:A (rs17713054*) (j) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 Ef fe ct A lle le Fr eq ue nc y chr3:45873093:CTT:C (rs35482426) (k) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 Ef fe ct A lle le Fr eq ue nc y chr3:101790631:A:T (rs11706494) (l) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr3:146522652:C:T (rs343314) (m) 20 20 -03 -01 20 20 -05 -01 20 20 -07 -01 20 20 -09 -01 20 20 -11 -01 20 21 -01 -01 20 21 -03 -01 20 21 -05 -01 20 21 -07 -01 20 21 -09 -01 20 21 -11 -01 0.0 0.1 0.2 0.3 0.4 Ef fe ct A lle le Fr eq ue nc y chr4:25446871:A:G (rs7664615) (n) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr4:105673359:G:A (rs72670002) (o) Supplementary Figure 45: Effect allele frequency (EAF +/- 95%CI) in critically-ill group (GenOMICC UK only) by month of for all lead variants. Dashed red line indicates EAF in the whole cohort. Sample sizes for each month are shown in panel (a) above. 61 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.50 0.55 0.60 0.65 0.70 0.75 Ef fe ct A lle le Fr eq ue nc y chr4:167824478:A:G (rs1073165) (a) 20 20 -03 -01 20 20 -05 -01 20 20 -07 -01 20 20 -09 -01 20 20 -11 -01 20 21 -01 -01 20 21 -03 -01 20 21 -05 -01 20 21 -07 -01 20 21 -09 -01 20 21 -11 -01 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 0.40 Ef fe ct A lle le Fr eq ue nc y chr5:132422622:A:G (rs2269821) (b) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr6:31153455:T:C (rs111837807) (c) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr6:31571991:A:G (rs2071590) (d) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.45 0.50 0.55 0.60 0.65 0.70 0.75 Ef fe ct A lle le Fr eq ue nc y chr6:32702687:G:T (rs2858305) (e) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr6:41522644:G:C (rs41435745) (f) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr7:75623396:T:C (rs1179620) (g) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 Ef fe ct A lle le Fr eq ue nc y chr7:100032719:C:T (rs2897075) (h) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr8:60532539:C:T (rs13276831) (i) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr9:21206606:C:G (rs28368148) (j) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr9:33425186:GTAAC:G (rs60840586) (k) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 Ef fe ct A lle le Fr eq ue nc y chr9:133271182:T:C (rs879055593) (l) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.500 0.525 0.550 0.575 0.600 0.625 0.650 0.675 0.700 Ef fe ct A lle le Fr eq ue nc y chr10:79946568:A:G (rs721917) (m) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr11:1219991:G:T (rs35705950) (n) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr11:34482745:G:A (rs61882275) (o) Supplementary Figure 46: Effect allele frequency (EAF +/- 95%CI) in critically-ill group (GenOMICC UK only) by month of for all lead variants. Dashed red line indicates EAF in the whole cohort. Sample sizes for each month are shown in panel (a) above. 62 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.5 0.6 0.7 0.8 0.9 Ef fe ct A lle le Fr eq ue nc y chr12:112919637:G:A (rs2660) (a) 20 20 -03 -01 20 20 -05 -01 20 20 -07 -01 20 20 -09 -01 20 20 -11 -01 20 21 -01 -01 20 21 -03 -01 20 21 -05 -01 20 21 -07 -01 20 21 -09 -01 20 21 -11 -01 0.45 0.50 0.55 0.60 0.65 0.70 0.75 Ef fe ct A lle le Fr eq ue nc y chr12:132481571:G:A (rs11614702) (b) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr13:112881427:C:T (rs12585036) (c) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr16:89196249:G:A (rs117169628) (d) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr17:40003082:T:C (rs12941811) (e) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr17:46085231:C:A (rs8080583) (f) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr17:49863303:C:T (rs77534576) (g) 20 20 -03 -01 20 20 -05 -01 20 20 -07 -01 20 20 -09 -01 20 20 -11 -01 20 21 -01 -01 20 21 -03 -01 20 21 -05 -01 20 21 -07 -01 20 21 -09 -01 20 21 -11 -01 0.6 0.7 0.8 0.9 1.0 Ef fe ct A lle le Fr eq ue nc y chr19:4717660:A:G (rs12610495) (h) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr19:10352442:G:C (rs34536443) (i) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr19:10414696:G:A (rs142770866) (j) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr19:48702915:C:T (rs516246) (k) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.15 0.20 0.25 0.30 0.35 0.40 0.45 0.50 Ef fe ct A lle le Fr eq ue nc y chr19:50374423:G:A (rs35463555) (l) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr20:6489447:G:A (rs2326788) (m) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr21:33229937:C:G (rs188401375) (n) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.50 0.55 0.60 0.65 0.70 0.75 0.80 0.85 Ef fe ct A lle le Fr eq ue nc y chr21:33237639:A:G (rs9636867) (o) Supplementary Figure 47: Effect allele frequency (EAF +/- 95%CI) in critically-ill group (GenOMICC UK only) by month of for all lead variants. Dashed red line indicates EAF in the whole cohort. Sample sizes for each month are shown in panel (a) above. 63 20 20 -03 -01 20 20 -05 -01 20 20 -07 -01 20 20 -09 -01 20 20 -11 -01 20 21 -01 -01 20 21 -03 -01 20 21 -05 -01 20 21 -07 -01 20 21 -09 -01 20 21 -11 -01 0.0 0.1 0.2 0.3 0.4 Ef fe ct A lle le Fr eq ue nc y chr21:33287378:C:T (rs8178521) (a) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.0 0.2 0.4 0.6 0.8 Ef fe ct A lle le Fr eq ue nc y chr21:33980963:C:T (rs76608815) (b) 20 20 -01 -01 20 20 -04 -01 20 20 -07 -01 20 20 -10 -01 20 21 -01 -01 20 21 -04 -01 20 21 -07 -01 20 21 -10 -01 20 22 -01 -01 0.2 0.4 0.6 0.8 1.0 Ef fe ct A lle le Fr eq ue nc y chr21:41479527:A:C (rs915823) (c) Supplementary Figure 48: Effect allele frequency (EAF +/- 95%CI) in critically-ill group (GenOMICC UK only) by month of for all lead variants. Dashed red line indicates EAF in the whole cohort. Sample sizes for each month are shown in panel (a) above. 64 12 Contributing Studies 12.1 Ethical approval All participants, or their representatives where appropriate, gave informed consent. Details of ethical review for each study can be found below. 12.2 GenOMICC and ISARIC4C Patients were recruited to the GenOMICC (Genetics Of Mortality In Critical Care) study in 224 inten- sive care units in the UK and Ireland (genomicc.org). All cases had confirmed Covid-19 according to local clinical testing and were deemed, in the view of the treating clinician, to require continuous car- diorespiratory monitoring. In UK practice this kind of monitoring is undertaken in high-dependency or intensive care units. Additional Covid-19 confirmed hospitalised cases were recruited through the Inter- national Severe Acute Respiratory Infection Consortium (ISARIC) Coronavirus Clinical Characterisation Consortium (4C).Both studies were approved by the appropriate research ethics committees (Scotland, 15/SS/0110; England, Wales and Northern Ireland, 19/WM/0247). Current and previous versions of the study protocol are available at genomicc.org/protocol. All participants gave informed consent. Participants were recruited to the mild Covid-19 cohort on the basis of having experienced mild (non- hospitalised) or asymptomatic Covid-19. Participants volunteered to take part in the study via a microsite and were required to self-report the details of a positive Covid-19 test. Volunteers were prioritised for genome sequencing based on demographic matching with the critical Covid-19 cohort considering self- reported ancestry, sex, age and location. 12.2.1 Whole genome sequencing summary statistics 8794 critically ill individuals and 1809 mild Covid-19 controls were sequenced through the GenOMICC study. To increase control numbers, we added general population controls from 100k-genomes cohort. Participants were enrolled in the 100,000 Genomes Project from families with a broad range of rare diseases, cancers and infection by 13 regional NHS Genomic Medicine Centres across England and in Northern Ireland, Scotland and Wales. For this analysis, participants for whom a positive SARS-CoV- 2 test had been recorded as of March, 2021 were not included due to uncertainty in the severity of Covid-19 symptoms. Only participants for whom genome sequencing was performed from blood derived DNA were included and participants with haematological malignancies were excluded to avoid potential tumour contamination. DNA extraction, sequencing, ancestry estimation, kinship estimation, principal components calculation and QC pipelines were performed as described in Kousathanas et al.3 GWAS was performed using a 2-step logistic mixed model regression approach as implemented in SAIGE v0.44.5 for single variant association analyses with sex, age, age squared , age by sex interaction and 20 principal components as covariates. The principal components were computed separately by predicted genetic ancestry (i.e, EUR-specific, AFR-specific, etc.), to capture subtle structure effects. 12.2.2 Genotype summary statistics 9484 Critically ill cases recruited through the GenOMICC, and 958 additional Covid-19 confirmed hospi- talised cases recruited through ISARIC4C were genotyped. DNA extraction, sample QC, genotype QC, kinship estimation, ancestry estimation and imputation were performed with the pipelines described in Pairo-Castineira et al.6. After these steps and removing individuals with whole genome sequencing data available3 there were 3577 unrelated individuals assigned to the European ancestry group, 383 unrelated individuals assigned to the South Asian ancestry group, 259 unrelated individuals assigned to the African ancestry group and 140 individuals assigned to East Asian ancestry group. Individuals from American ancestry were removed from the analysis because there were less than 100. For the critical illness analysis, individuals which did nof fulfill the critical illness criteria (ICU admission, or ventilation) were filtered out. Final numbers for critical illness GWAS are: 3213 individuals from European ancestry, 127 from East Asian ancestry, 353 from South Asian ancestry and 242 from African ancestry. UK Biobank participants from a subset with no relationships up to third degree were considered as po- tential controls if they were not identified by the UK Biobank as outliers based on either genotyping missingness rate or heterogeneity, and their sex inferred from the genotypes matched their self-reported sex. After excluding participants who had received PCR tests for Covid-19, based on information down- loaded from the UK Biobank on 27/01/2022. For each GenOMICC individual we considered the subset of UK Biobank individuals with matching assigned ancestry group sex, age and BMI distribution as 65 Supplementary Figure 49: Whole cohort PCA. Genomic PCA plot showing the first two principal com- ponents for the combination of all UK Biobank and GenOMICC participants. Assigned ancestry group for GenOMICC participants is indicated through colour. controls. For non-European ancestries we selected the five closest controls, based on euclidean distance in the space of the first six ancestry specific genomic principal components. Test for association between case–control status and allele dosage was performed by hospitalised and critical illness separately by fitting a logistic regression model using PLINK 2.00 with sex, age, mean- centred age2, deprivation score decile of residential postcode, and the first 10 ancestry specific genomic principal components as covariates. GWAS results for individuals from European ancestry were filtered for 𝑀𝐴𝐹 > 0.01, HWE 𝑝 − 𝑣𝑎𝑙𝑢𝑒 > 10−50, genotyping rate > 0.99 and imputation score > 0.9 in both GenOMICC and UK Biobank. To avoid bias for using a different genotyping array and imputation method between cases and controls, MAF for each SNP was compared between UK Biobank and gNOMAD non-Finnish European individuals, and SNPs were removed from following two rules (1)In SNPs with MAF > 0.1 in gnomAD, an absolute difference in MAF of 0.05 between gnomAD and UK Biobank controls; (2) in SNPs with MAF < 0.1 in gnomAD, a difference in MAF of > 0.25 × 𝑀𝐴𝐹𝑔𝑛𝑜𝑚𝑎𝑑 between UK Biobank controls and gnomAD. After this filter, a further LD-check filter, following Kousathanas et al3 was used to clean the GWAS from false positives. GWAS analyses of individuals of East Asian, South Asian and African ancestries were filtered for variants filtered for a MAF> 0.05 in UK Biobank corresponding to the same ancestry and then for the SNPs that passed quality control in the European GWAS. 12.2.3 BraCovid/GenoMICC Brazil Covid-19 patients were enrolled after hospitalisation in one of the following tertiary care centers in the metropolitan area of Sao Paulo, Brazil: Instituto do Coração, and Instituto Central do Hospital das Clíni- cas da Faculdade de Medicina da Universidade de São Paulo. The study was approved by the National Research Ethics Committee (CONEP) and Ethics Committee for the Analysis of Research Projects at HC FMUSP (CAPPesq, 5025/20/054). Non-hospitalised cases were selected by serological studies surveys for previous SARS-CoV-2 infection or SARS-CoV-2 PCR test among health professionals or the general population.After signing an informed consent, a sample of whole-blood already collected for in-hospital biochemical analysis or SARS-CoV-2 serology was used for genomic DNA extraction.DNA extraction, genotyping, imputation and QC pipelines are described in Pereira et al.1. Principal components for 66 Supplementary Figure 50: Ancestry-specific PCA. Genomic PCA plots showing the distribution of all cases and controls for the first 5 principal components for each ancestry group. Cases are shown as coloured open circles: European (EUR, blue), African (AFR, red), and South Asian (SAS, purple). Controls are dark grey closed circles. UK Biobank population background is shown as light grey closed circles. 67 cases and controls were calculated with PLINK 2.0. Due to the level of admixture and complex genetic structure present in the Brazilian population, three different ancestry subgroups were defined (European, African, Native American) using k-means clustering. GWAS of Covid-19 hospitalised cases versus Covid- 19 positive mild controls was performed with a logistic regression model in PLINK 2.0 including age, sex, array type and four principal components as covariates for each ancestry. A trans-ancestry fixed-effect meta-analysis was calculated using the plink meta-analysis routine1. 12.2.4 GenOMICC Saudi Arabia In Saudi Arabia 1036 participants were recruited as part of the GenOMICC Saudi Arabia study. Informed Consent was provided to each participant or their legal guardian (if the participant could not consent) by the corresponding institute. This study was approved the IRB of each participating hospitals, and the IRB at King Abdullah International Medical Research Centre, Ministry of National Guard–Health Affairs, Riyadh, Ministry of Health, and King Fahad Medical City. Participants were diagnosed of Covid- 19 through a positive PCR test, and were genotyped using the Affymetrix Saudi Arabia platform. After a manual QC with Axiom suite, sample QC, genotype QC and kinship estimation were performed as in Pairo-Castineira et al.6. To infer ancestry, a first step was done projecting the genotype data into 1000 Genomes principal components calculated with GCTA 1.9. Most individuals had admix ancestry according to PCA projection (Supplementary Figure 51), which is consistent with population structure analysis of the region10. Outliers belonging to East Asian, South Asian or African ancestries were removed from the analysis because there were not enough numbers to perform an ancestry-specific GWAS. Then we performed a principal component analysis of the remaining individuals using GCTA 1.9(Supplementary Figure 52). Individuals with a deviation more than 2sd from the mean in the 10 first principal components were considered outliers and removed from the dataset. After QC 93 severe cases and 645 controls were used for the GWAS. Analysis was performed as in Pairo-Castineira et al.6 using PLINK2 and unrelated individuals but in order to account for the admix ancestry of the participants, we included into the model age, sex and first 10 pcs as covariates and an interaction term between the genotype and the first principal component. Supplementary Figure 51: Genomic PCA plot showing the first two principal components for the combi- nation of 1000 Genomes project and GenOMICC Saudi Arabia participants. GenOMICC Saudi Arabia cases are coloured in blue, GenOMICC Saudi Arabia controls in dark grey, and GenOMICC Saudi Arabia participants removed for the analysis due to ancestry in orange 68 Supplementary Figure 52: Ancestry-specific PCA plot for Saudi Arabian participants. Severe cases are coloured in blue and mild cases used as controls in grey 12.3 SCOURGE In Spain, 11,939 Covid-19 positive cases were recruited as part of SCOURGE study from 34 centres in 25 cities.2 Study samples and data were collected by the participating centers, through their respective biobanks after informed consent, with the approval of the respective Ethic and Scientific Committees. The whole project was approved by the Galician Ethical Committee Ref 2020/197. Individuals were diagnosed as Covid-19 positive through a PCR-based test or according to local clinical and laboratory procedures. All cases were classified in a five-level severity scale. Two Spanish sample collections with unknown Covid-19 status were included as general population controls in some analyses: 3,437 samples from the Spanish DNA biobank (https://www.bancoadn.org) and 2,506 samples from the GR@CE consortium. DNA extraction, genotyping, imputation, ancestry estimation, kinship estimation and QC pipelines are described in Cruz et al.2. GWAS was performed by fitting a logisitic regression models implemented in SAIGE. For the hospitalised meta-analysis the summary statistics of the hospitalisation vs non-hospitalised (mild cases and population controls) analysis were used. For the critical illness meta-analysis, the summary statistics of severity grade 3 and 4 as defined by SCOURGE2 vs population controls were used. 12.4 HGI release 6 In total 25 studies contributed to the A2 analysis, with 8779 cases and 1001572 controls and 43 studies contributed to the B2 analysis with 24274 cases and 2061529 controls without including 23andMe data. All studies followed protocols approved by local Institutional Review Boards; All protocols followed local ethics recommendations and informed consent was obtained when required. Meta-analysis of all cohorts was performed with and inverse-weighting variance method as described by the Covid-19 Host Genetics Initiative11 In order to account for signal due to sample overlap we performed a mathematical subtraction from HGIv6B2 of the GenOMICC GWAS of European genetic ancestry and the BraCovid analysis, and a mathematical subtraction from HGIv6A2 of the GenOMICC GWAS of European genetic ancestry . Publicly-available HGI data was downloaded from https://www.covid19hg.org/results/r6/. The sub- traction was performed using MetaSubtract package (version 1.60) for R (version 4.0.2) after removing 69 1K AFR 1K AMR 1K EAS 1K EUR 1K SAS SCOURGE cases SCOURGE controls Supplementary Figure 53: Genomic PCA plot showing the first two principal components for the com- bination of 1000 Genomes project and SCOURGE cases and controls. 1000 Genomes individuals are coloured according to ancestry, SCOURGE cases in blue and controls in grey −0.04 0.00 0.04 −0.02 0.00 0.02 0.04 PC1 PC 2 SCOURGE cases SCOURGE controls Supplementary Figure 54: Ancestry Specific PCA plot showing the first two principal components for the SCOURGE study. Controls are coloured in grey and cases in blue 70 variants with the same genomic position and using the lambda.cohorts with genomic inflation calculated on the GenOMICC summary statistics. 12.5 23andMe Participants were recruited from the customer base of 23andMe, Inc., a personal genetics com- pany. 23andMe, Inc. participants provided informed consent and volunteered to participate in the research online, under a protocol approved by the external AAHRPP-accredited IRB, Ethical & Independent (E&I) Review Services. As of 2022, E&I Review Services is part of Salus IRB (https://www.versiticlinicaltrials.org/salusirb). Study participation consisted solely of web-based surveys, and different phenotypes were defined for disease severity: pneumonia, hospitalisation and respiratory support. DNA extraction, genotyping, im- putation, ancestry estimation, kinship estimation and QC pipelines are described in Shelton et al.12. GWAS were performed for each phenotype and ancestry separately using a logistic regression using age, sex, age squared, a age:sex interaction and top ten principal components as covariates, as described in Shelton et al.12 For the hospitalisation meta-analysis we used summary statistics from the respiratory support or pneumo- nia phenotype against population controls GWAS from European, African and Latino ancestries. For the critically-ill meta-analysis we used summary statistics from the respiratory phenotype against population controls GWAS. We filtered variants that passed internal 23andMe ancestry QC12 and had imputation score > 0.6 and with MAF > 0.005. 13 Contributors 13.1 GenOMICC Investigators 13.1.1 Co-Investigators J. Kenneth Baillie1,2,3,11, Colin Begg27, Sara Clohisey3, Charles Hinds20, Peter Horby21, Julian Knight8, Lowell Ling22, David Maslove14, Danny McAuley23,24, Johnny Millar3, Hugh Montgomery25, Alistair Nichol15, Peter J.M. Openshaw12,26, Alexandre C Pereira48, Chris P Ponting2, Kathy Rowan47, Malcolm G Semple16,17, Manu Shankar-Hari18, Charlotte Summers19, Timothy Walsh11. 13.1.2 Management, Laboratory and Data team Emma Aitkin3, Latha Aravindan49, Ruth Armstrong3, J. Kenneth Baillie3,11, Heather Biggs50, Ceilia Boz3, Adam Brown3, Primmy Chikowore3, Richard Clark13, Sara Clohisey3, Audrey Coutts13, Judy Coyle3, Louise Cullum3, Sukamal Das49, Nicky Day3, Lorna Donnelly13, Esther Duncan3, Angie Fawkes13, Paul Finernan3, Max Head Fourman3, Anita Furlong50, James Furniss3, Bernadette Gallagher3, Tammy Gilchrist13, Ailsa Golightly3, Fiona Griffiths3, Katarzyna Hafezi13, Debbie Hamilton3, Ross Hendry3, Naomi Kearns3, Andy Law3, Dawn Law3, Rachel Law3, Sarah Law3, Rebecca Lidstone-Scott3, Christen Lauder13, Louise Macgillivray13, Alan Maclean13, Hanning Mal3, Sarah McCafferty13, Ellie Mcmaster3, Jen Meikle3, Shona C Moore16, Kirstie Morrice13, Lee Murphy13, Sheena Murphy49, Hellen Mybaya3, Miranda Odam3, Wilna Oosthuyzen3, Chenqing Zheng51, Jiantao Chen51, Nick Parkinson3, Trevor Paterson3, Petra Tucker50, Katherine Schon50, Andrew Stenhouse3, Mihaela Das49, Maaike Swets3,52, Helen Szoor-McElhinney3, Filip Taneski3, Lance Turtle16, Tony Wackett3, Mairi Ward3, Jane Weaver3, Nicola Wrobel13, Marie Zechner3. 13.1.3 Guys and St Thomas’ Hospital, London, UK Jacqueline Pan53, Neus Grau53, Tim Owen Jones53, Rosario Lim53, Martina Marotti53, Christopher Whitton53, Aneta Bociek53, Sara Campos53, Gill Arbane53, Manu Shankar-Hari53, Marlies Ostermann53, Mina Cha53, Fabiola DAmato53, Eirini Kosifidou53, Shelley Lorah53, Kyma Morera53. 13.1.4 James Cook University Hospital, Middlesbrough, UK Laura Brady54, Keith Hugill54, Jeremy Henning54, Stephen Bonner54, Evie Headlam54, Jessica Jones54, Abigail List54, Joanne Morley54, Amy Welford54, Bobette Kamangu54, Anitha Ratnakumar54, Abiola Shoremekun54. 71 13.1.5 Barts Health NHS Trust, London, UK Zoe Alldis55, Raine Astin-Chamberlain55, Fatima Bibi55, Jack Biddle55, Sarah Blow55, Matthew Bolton55, Catherine Borra55, Ruth Bowles55, Maudrian Burton55, Yasmin Choudhury55, Amber Cox55, Amy Easthope55, Patrizia Ebano55, Stavros Fotiadis55, Jana Gurasashvili55, Rosslyn Halls55, Pippa Hartridge55, Delordson Kallon55, Jamila Kassam55, Ivone Lancoma-Malcolm55, Maninderpal Matharu55, Peter May55, Oliver Mitchelmore55, Tabitha Newman55, Mital Patel55, Jane Pheby55, Irene Pinzuti55, Zoe Prime55, Oleksandra Prysyazhna55, Julian Shiel55, Melanie Taylor55, Carey Tierney55, Olivier Zongo55, Suzanne Wood55, Anne Zak55, David Collier55. 13.1.6 Royal Stoke University Hospital, Staffordshire, UK Manuela Mundy56, Christopher Thompson56, Lisa Pritchard56, Minnie Gellamucho56, David Cartlidge56, Nageswar Bandla56, Lucy Bailey56, Michelle Davies56, Jane Delaney56, Leanne Scott56. 13.1.7 North Middlesex University Hospital NHS trust, London, UK Marwa Abdelrazik57, Frater Alasdair57, David Carter57, Munzir Elhassan57, Arunkumar Ganesan57, Samuel Jenkins57, Zoe Lamond57, Dharam Purohit57, Kumar Rohit57, Malik Saleem57, Alanna Wall57, Kugan Xavier57, Dhanalaksmi Bakthavatsalam57, Kirolos Gehad57, Pakeerathan Gnanapragasam57, Kapil Jain57, Swati Jain57, Abdul Malik57, Naveen Pappachan57, Jeronimo Moreno-Cuesta57, Anne Haldeos57, Rachel Vincent57, Maryjane Oziegb57. 13.1.8 King’s College Hospital, London, UK Anna Cavazza58, Maeve Cockrell58, Eleanor Corcoran58, Maria Depante58, Clare Finney58, Ellen Jerome58, Abigail Knighton58, Monalisa Nayak58, Evita Pappa58, Rohit Saha58, Sian Saha58, Andrew Dodd58, Kevin O’Reilly58, Mark McPhail58, Emma Clarey58, Harriet Noble58, John Smith58. 13.1.9 Charing Cross Hospital, St Mary’s Hospital and Hammersmith Hospital, London, UK Phoebe Coghlan59, Stephen Brett59, Anthony Gordon59, Maie Templeton59, David Antcliffe59, Dorota Banach59, Sarah Darnell59, Ziortza Fernandez59, Eleanor Jepson59, Amal Mohammed59, Roceld Rojo59, Sonia Sousa Arias59, Anita Tamang Gurung59, Jenny Wong59. 13.1.10 The Royal Liverpool University Hospital, Liverpool, UK Jaime Fernandez-Roman60, David O. Hamilton60, Emily Johnson60, Brian Johnston60, Maria Lopez Martinez60, Suleman Mulla60, Alicia A.C. Waite60, Karen Williams60, Victoria Waugh60, Ingeborg Welters60, Jessica Emblem60, Maria Norris60, David Shaw60. 13.1.11 John Radcliffe Hospital, Oxford, UK Archana Bashyal61, Sally Beer61, Paula Hutton61, Stuart McKechnie61, Neil Davidson61, Soya Mathew61, Grace Readion61, Jung Ryu61, Jean Wilson61. 13.1.12 Addenbrooke’s Hospital, Cambridge, UK Shruti Agrawal62, Kay Elston62, Megan Jones62, Eoghan Meaney62, Petra Polgarova62, Muhammad Elbehery62, Charlotte Summers62, Esther Daubney62, Anthony Ng62, Jocelyn Marshall62, Nazima Pathan62, Katerina Stroud62, Deborah White62. 13.1.13 Nottingham University Hospital, Nottingham, UK Angela Andrew63, Saima Ashraf63, Amy Clark63, Martin Dent63, Margaret Langley63, Cecilia Peters63, Lucy Ryan63, Julia Sampson63, Shuying Wei63, Alice Baddeley63, Megan Meredith63, Lucy Morris63, Alexandra Gibbons63, Lisa McLoughlin63. 13.1.14 St George’s Hospital, London, UK Carlos Castro Delgado64, Victoria Clark64, Deborah Dawson64, Lijun Ding64, Georgia Durrant64, Obi- ageri Ezeobu64, Abiola Harrison64, William James Hurt64, Rebecca Kanu64, Ashley Kinch64, Susannah Leaver64, Ana Lisboa64, Jisha Mathew64, Kamal Patel64, Romina Pepermans Saluzzio64, John Rawlins64, Tinashe Samakomva64, Nirav Shah64, Christine Sicat64, Joana Texeira64, Joana Gomes De Queiroz64, 72 Edna Fernandes Da Gloria64, Elena Maccacari64, Nikki Yun64, Soumendu Manna64, Sarah Farnell- Ward64, Maria Maizcordoba64, Maria Thanasi64, Hawakin Haji Ali64. 13.1.15 BHRUT (Barking Havering) - Queens Hospital and King George Hospital, Essex, UK Janice Hastings65, Lina Grauslyte65, Musarat Hussain65, Bobby Ruge65, Sam King65, Tatiana Pogreban65, Lace Rosaroso65, Helen Smith65, Mandeep-Kaur Phull65, Nikkita Adams65, George Franke65, Aparna George65, Erika Salciute65, Joanna Wong65, Karen Dunne65, Luke Flower65, Emma Sharland65, Sukhmani Sra65. 13.1.16 Royal Infirmary of Edinburgh, Edinburgh, UK Gillian Andrew66, Marie Callaghan66, Lucy Barclay66, Lucy Marshall66, Kenneth Baillie66, Maria Amamio66, Sophie Birch66, Kate Briton66, Sarah Clark66, Katerine Doverman66, Dave Hope66, Corri- enne Mcculloch66, Scott Simpson66, Jo Singleton66. 13.1.17 Kingston Hospital, Surrey, UK Rita Fernandez67, Meryem Allen67, David Baptista67, Rebecca Crowe67, Jonathan Fox67, Jacyntha Khera67, Adam Loveridge67, India McKenley67, Eriko Morino67, Andres Naranjo67, Denise O’Connor67, Richard Simms67, Kathryn Sollesta67, Andrew Swain67, Harish Venkatesh67, Rosie Herdman-Grant67, Anna Joseph67. 13.1.18 Queen Alexandra Hospital, Portsmouth, UK Angela Nown68, Steve Rose68, David Pogson68, Helen Boxall68, Lutece Brimfield68, Helen Claridge68, Zoe Daly68, Shenu George68, Andrew Gribbin68. 13.1.19 Royal Gwent Hospital, Newport, UK Yusuf Cheema69, Sean Cutler69, Owen Richards69, Anna Roynon-Reed69, Shiney Cherian69, Anne Emma Heron69, Gemma Williams69, Tamas Szakmany69, Abby Waters69, Kim Collins69, Jill Dunhill69, Ffion Jones69, Rebecca Morris69, Lucy Ship69, Amy Cardwell69. 13.1.20 Royal Blackburn Teaching Hospital, Blackburn, UK Syamlan Ali70, Ravi Bhatterjee70, Rachel Bolton70, Srikanth Chukkambotla70, Dabheoc Coleman70, Jack Dalziel70, Joseph Dykes70, Christopher Fine70, Bethan Gay70, Wendy Goddard70, Drew Goodchild70, Rhiannan Harling70, Muhammad Hijazi70, Sarah Keith70, Meherunnisa Khan70, Roseanna Matt70, Janet Ryan-Smith70, Samuel Saad70, Philippa Springle70, Jacqueline Thomas70, Nick Truman70, Aayesha Kazi70, Matthew Smith70, Heather Collier70, Chloe Davison70, Stephen Duberley70, Jeanette Hargreaves70, Janice Hartley70, Tahera Patel70, Ellen Smith70. 13.1.21 Stepping Hill Hospital, Stockport, UK Alissa Kent71, Emma Goodwin71, Ahmed Zaki71, Clare Tibke71, Susan Hopkins71, Hywel Gerrard71, Matthew Jackson71, Sara Bennett71, Liane Marsh71, Rebecca Mills71. 13.1.22 Northumbria Healthcare NHS Foundation Trust, North Shields, UK Jessica Bell72, Helen Campbell72, Angela Dawson72, Steve Dodds72, Stacey Duffy72, Lisa Gallagher72, Gemma McCafferty72, Stacey Short72, Tracy Smith72, Kirsty Thomas72, Claire Walker72, Jessica Reynolds72, Bryan Yates72, Hayley McKie72, Maria Panteli72, Maria Thompson72, Gail Waddell72. 13.1.23 Countess of Chester Hospital, Chester, UK Sarah De Beger73, Azmerelda Abraheem73, Charlie Dunmore73, Rumanah Girach73, Rhianna Jones73, Emily London73, Imrun Nagra73, Farah Nasir73, Hannah Sainsbury73, Clare Smedley73, Stephen Brearey73, Caroline Burchett73, Kathryn Cawley73, Maria Faulkner73, Helen Jeffrey73, Peter Bamford73, Firdaus Shaikh73, Lauren Slack73, Angela Davies73. 73 13.1.24 Pinderfields General Hospital, Wakefield, UK Hollie Brooke74, Jose Cebrian Suarez74, Ruth Charlesworth74, Karen Hansson74, John Norris74, Alice Poole74, Rajdeep Sandhu74, Elizabeth Smithson74, Muthu Thirumaran74, Veronica Wagstaff74, Sarah Buckley74, Brendan Sloan74, Alastair Rose74, Amy Major74, Alexandra Metcalfe74. 13.1.25 Ninewells Hospital, Dundee, UK Christine Almaden-Boyle75, Pauline Austin75, Susan Chapman75, Alexandre Eros75, Louise Cabrelli75, Stephen Cole75, Clare Whyte75, Matt Casey75. 13.1.26 Croydon University Hospital, Croydon, UK Vasileios Bafitis76, George Tsinaslanidis76, Cassandra George76, Reena Khade76, Christopher Black76, Sundar Raj Ashok76. 13.1.27 Morriston Hospital, Swansea, UK Sean Farley77, Elaine Brinkworth77, Rachel Harford77, Carl Murphy77, Marie Williams77, Luke Newey77, Hannah Toghill77, Sophie Lewis77, Tabitha Rees77, Ceri Battle77, Mark Baker77, Jenny Travers77, Karen Chesters77. 13.1.28 Queen Elizabeth University Hospital, Glasgow, UK Nicola Baxter78, Andrew Arnott78, Gordan McCreath78, Christopher McParland78, Laura Rooney78, Malcolm Sim78, Steven Henderson78, Lynn Abel78, Carol Dalton78, Sophie Kennedy-Hay78, Lynn O’Donohoe78, Megan O’Hare78, Izabela Orlikowska78, Natasha Parker78. 13.1.29 Broomfield Hospital, Chelmsford, UK Fiona McNeela79, Amanda Lyle79, Alistair Hughes79, Jayachandran Radhakrishnan79, Sian Gibson79. 13.1.30 Heartlands Hospital, Birmingham, UK Hollie Bancroft80, Mary Bellamy80, Jacqueline Daglish80, Salma Kadiri80, Faye Moore80, Joanne Rhodes80, Mirriam Sangombe80, Zhane Peterkin80, James Scriven80, Margaret Carmody80. 13.1.31 Royal Sussex County Hospital, Brighton, UK Juliet Cottle81, Emily Peasgood81, Laura Ortiz-Ruiz de Gordoa81, Claire Phillips81, Denise Skinner81. 13.1.32 York Hospital, York, UK Zoe Cinquina82, Kate Howard82, Rosie Joy82, Samantha Roche82, Isobel Birkinshaw82, Joseph Carter82, Jo Ingham82, Nicola Marshall82, Harriet Pearson82, Zoe Scott82. 13.1.33 Queen Elizabeth Hospital, Birmingham, UK Jo Dasgin83, Jaspret Gill83, Annette Nilsson83, Amy Bamford83, Diana Hull83, James Scriven83, Nafeesah Ahmadhaider83, Michelle Bates83, Christopher McGhee83. 13.1.34 Royal Glamorgan Hospital, Pontyclun, UK Hannah Ellis84, Gwenllian Sera Howe84, Jayaprakash Singh84, Natalie Stroud84, Lisa Roche84, Ceri Lynch84, Bethan Deacon84, Carla Pothecary84, Justyna Smeaton84, Kevin Agravante84. 13.1.35 Barnet Hospital, London, UK Vinodh Krishnamurthy85, Cynthia Diaba85, Lincy John85, Lai Lim85, Rajeev Jha85. 13.1.36 Wythenshawe Hospital, Manchester, UK Jasmine Egan86, Timothy Felton86, Susannah Glasgow86, Grace Padden86, Ozerah Choudhr86, Joanne Bradley-Potts86, Stuart Moss86, Saejohn Lingeswaran86, Peter Alexander86, Craig Brandwood86, Sofia Fiouni86, Luke Ward86, Schvearn Allen86, Jane Shaw86, Christopher Smith86. 74 13.1.37 Medway Maritime Hospital, Gillingham, UK Oluronke Adanini87, Rebecca Collins87, Maines Msiska87, Linda Ofori87, Nikhil Bhatia87, Hayley Dolan87. 13.1.38 Royal Berkshire NHS Foundation Trust, Berkshire, UK Mark Brunton88, Jess Caterson88, Holly Coles88, Liza Keating88, Emma Tilney88, Nicola Jacques88, Matthew Frise88, Jennifer Armistead88, Shauna Bartley88, Parminder Bhuie88, Sabi Rai88, Gabriela Tomkova88. 13.1.39 Whiston Hospital, Prescot, UK Sandra Greer89, Karen Shuker89, Ascanio Tridente89. 13.1.40 The Royal Oldham Hospital, Manchester, UK Emma Dobson90, Jodie Hunt90, Redmond Tully90, Joy Dearden90, Andrew Drummond90, Prakash Kamath90, Emily Bullock90, Michelle Mulcahy90, Shelia Munt90, Grainne O’Connor90, Jennifer Philbin90, Chloe Rishton90, Chloe Scott90, Sarah Winnard90. 13.1.41 Chesterfield Royal Hospital Foundation Trust, Chesterfield, UK Nurkamalia Hasni91, Rachel Gascoyne91, Joanne Hawes91, Kelly Pritchard91, Lesley Stevenson91, Amanda Whileman91, Sarah Beavis91, Lauren Bishop91, Cindy Cart91, Katie Dale91, Mary Kelly- Baxter91, Adam Mendelski91, Emma Moakes91, Rheanna Smith91, Jan Woodward91, Stephanie Wright91. 13.1.42 Aberdeen Royal Infirmary, Aberdeen, UK Angela Allan92, Adriana Botello92, Jade Liew92, Jasmine Medhora92, Erin Trumper92, Felicity Savage92, Teresa Scott92, Marc Place92, Callum Kaye92. 13.1.43 Royal Devon and Exeter Hospital, Exeter, UK Sarah Benyon93, Suzie Marriott93, Linda Park93, Helen Quinn93, Daisy Skyes93, Lily Zitter93, Kizzy Baines93, Elizabeth Gordon93, Samantha Keenan93, Andrew Pitt93. 13.1.44 Glasgow Royal Infirmary, Glasgow, UK Katharine Duffy94, Jane Ireland94, Gary Semple94, Lynne Turner94, Susanne Cathcart94, Dominic Rimmer94, Alex Puxty94, Kathryn Puxty94, Andrew Hurst94, Jennifer Miller94, Susan Speirs94, Lauren Walker94. 13.1.45 Blackpool Victoria Hospital, Blackpool, UK Zena Bradshaw95, Joanna Brown95, Sarah Melling95, Stephen Preston95, Nicola Slawson95, Scott Warden95, Alanna Beasley95, Emma Stoddard95, Leonie Benham95, Jason Cupitt95, Melanie Caswell95, Lisa Elawamy95, Ashleigh Wignall95. 13.1.46 Southampton General Hospital, Southampton, UK Belinda Roberts96, Hannah Golding96, Samantha Leggett96, Michelle Male96, Martyna Marani96, Kirsty Prager96, Toran Williams96, Kim Golder96, Oliver Jones96, Rebecca Cusack96, Clare Bolger96, Rachel Burnish96, Michael Carter96, Susan Jackson96, Karen Salmon96, Jonathan Biss96. 13.1.47 Ashford and St Peter’s Hospital, Surrey, UK Maia Aquino97, Maria Croft97, Victoria Frost97, Ian White97, Keshnie Govender97. 13.1.48 Derriford Hospital, Plymouth, UK Natasha Webb98, Liana Stapleton98, Colin Wells98, Nikitas Nikitas98, Ana Sanchez - Rodriguez98, Kayleigh Spencer98, Bethan Stowe98. 75 13.1.49 East Surrey Hospital, Redhill, UK Yvonne Izzard99, Michelle Poole99, Sonja Monnery99, Sallyanne Trotman99, Valerie Beech99, Edward Combes99, Teishel Joefield99. 13.1.50 Poole Hospital, Poole, UK Patrick Covernton100, Sarah Savage100, Elizabeth Woodward100, Julie Camsooksai100, Henrik Reschreiter100, Charlotte Barclay100, Yasmin DeAth100, Judith Dube100, Charlotte Humphrey100, Sarah Jenkins100, Emma Langridge100, Rebecca Milne100, Beverley Wadams100, Megan Woolcock100. 13.1.51 Royal Alexandra Hospital, Paisley, UK Michael Brett101, Brian Digby101, Lisa Gemmell101, James Hornsby101, Patrick MacGoey101, Pauline O’Neil101, Richard Price101, Radha Sundaram101, Lynn Abel101, Natalie Rodden101, Nicola Thomson101, Kevin Rooney101, Susan Currie101, Natasha Parker101, Lauren Walker101, Philip Henderson101. 13.1.52 St James’s University Hospital and Leeds General Infirmary, Leeds, UK Bethan Ogg102, Simon Whiteley102, Liz Wilby102, Kate Long102, Shailamma Matthew102, Sheila Salada102, Susan Trott102, Sarah Watts102, Zoe Friar102, Abigail Speight102. 13.1.53 Bedford Hospital, Bedford, UK Victoria Bastion103, Humza Chandna103, Brice Djeugam103, Muhammad Haseeb103, Harriet Kent103, Gamu Lubimbi103, Sophie Murdoch103, Alastair Thomas103, Beena David103, Rachel Lorusso103, Ana Vochin103, Melchizedek Penacerrada103, Retno Wulandari103. 13.1.54 Southport and Formby District General Hospital, Ormskirk, UK Charlotte Heath104, Srinivas Jakkula104, Anna Morris104, Ashar Ahmed104, Arvind Nune104, Claire Buttriss104, Emma Whitaker104. 13.1.55 The Tunbridge Wells Hospital and Maidstone Hospital, Kent, UK Miriam Davey105, David Golden105, Amy Acklery105, Fabio Fernandes105, Bec Seaman105, Victoria Earl105. 13.1.56 Queen Elizabeth Hospital, Woolwich, London, UK Amy Collins106, Waqas Khaliq106, Rachel Adam106, Estefania Treus106. 13.1.57 North Manchester General Hospital, Manchester, UK Sarah Holland107, Jordan Alfonso107, Bethan Blackledge107, Michelle Bruce107, Laura Jayne Durrans107, Ayaa Eltayeb107, Jade Harris107, Samuel Hey107, Martin Hruska107, Thomas Lamb107, Joanne Rothwell107, Adele Fitzgerald107, Gabriella Lindergard107, Helen T-Michael107, Tracey Duncan107, Sharon Baxter-Dore107, Lisa Cooper107, Claire Fox107, Jacinta Guerin107, Tracey Hodgkiss107, Karen Connolly107. 13.1.58 Royal Victoria Infirmary, Newcastle Upon Tyne, UK Paul McAlinden108, Victoria Bridgett108, Maggie Fearby108, A Gulati108, Helen Hanson108, Sinead Kelly108, Louise McCormack108, Rachel Nixon108, Philip Robinson108, Victoria Slater108, Elaine Stephenson108, Andrea Webster108, K Webster108, Carole Hays108, Anne Hudson108, Bijal Patel108, Ian Clement108, John Davis108, Sarah Francis108, Douglas Jerry108. 13.1.59 Hull Royal Infirmary, Hull, UK Caroline Abernathy109, Louise Foster109, Andrew Gratrix109, Llucia Cabral-Ortega109, Matthew Hines109, Victoria Martinson109, Elizabeth Stones109, Karen Winter109. 76 13.1.60 Manchester Royal Infirmary, Manchester, UK Esther Barrow110, Katharine Wylie110, Deborah Baines110, Katie Birchall110, Laurel Kolakaluri110, Richard Clark110, Anila Sukumaran110, Craig Brandwood110, Melanie Barker110, Deborah Paripoorani110, Lara Smith110, Charlotte Taylor110. 13.1.61 Royal Derby Hospital, Derby, UK Charlotte Downes111, Melanie Hayman111, Katie Riches111, Priya Daniel111, Deepak Subramanian111, Kathleen Holding111, Mary Hilton111, Carly Mcdonald111, Georgina Richardson111. 13.1.62 Aintree University Hospital, Liverpool, UK Georgia Halladay112, Peter Harding112, Amie Reddy112, Ian Turner-Bone112, Laura Wilding112, Robert Parker112, Michaela Lloyd112, Leanne Smith112, Charlie Kelly112. 13.1.63 Fairfield General Hospital, Bury, UK Maria Lazo113, Alan Neal113, Olivia Walton113, Julie Melville113, Jay Naisbitt113, Emily Bullock113, Rosane Joseph113. 13.1.64 Norfolk and Norwich University hospital (NNUH), Norwich, UK Sara Callam114, Lisa Hudig114, Jocelyn Keshet-Price114, Katie Stammers114, Karen Convery114, Georgina Randell114, Deirdre Fottrell-gould114. 13.1.65 Milton Keynes University Hospital, Milton Keynes, UK Esther Mwaura115, Sara-Beth Sutherland115, Richard Stewart115, Louise Mew115, Lynn Wren115. 13.1.66 Good Hope Hospital, Birmingham, UK Laura Thrasyvoulou116, Heather Willis116, James Scriven116, Bridget Hopkins116, Daniel Lenton116, Abi- gail Roberts116. 13.1.67 Queen Elizabeth Hospital Gateshead, Gateshead, UK Maria Bokhari117, Rachael Lucas117, Wendy McCormick117, Jenny Ritzema117, Vanessa Linnett117, Amanda Sanderson117, Helen Wild117. 13.1.68 Royal Bolton Hospital, Bolton, UK Rebecca Flanagan118, Robert Hull118, Kat Rhead118, Emma McKenna118, Gareth Hughes118, Jennifer Anderson118, Kelly Jones118, Scott Latham118, Heather Riley118. 13.1.69 Tameside General Hospital, Ashton Under Lyne, UK Martina Coulding119, Martyn Clark119, Jacqueline McCormick119, Oliver Mercer119, Darsh Potla119, Hafiz Rehman119, Heather Savill119, Victoria Turner119, Edward Jude119, Susan Kilroy119. 13.1.70 Salford Royal Hospital, Manchester, UK Elena Apetri120, Cathrine Basikolo120, Bethan Blackledge120, Laura Catlow120, Matthew Collis120, Reece Doonan120, Jade Harris120, Alice Harvey120, Karen Knowles120, Stephanie Lee120, Diane Lomas120, Chloe Lyons120, Liam McMorrow120, Angiy Michael120, Jessica Pendlebury120, Jane Perez120, Maria Poulaka120, Nicola Proudfoot120, Kathryn Slevin120, Vicky Thomas120, Danielle Walker120, Paul Dark120, Bethan Charles120, Danielle McLaughlan120, Melanie Slaughter120, Dan Horner120, Kathryn Cawley120, Tracy Marsden120. 13.1.71 Great Ormond St Hospital and UCL Great Ormond St Institute of Child Health NIHR Biomedical Research Centre, London, UK Joyann Andrews121, Emily Beech121, Olugbenga Akinkugbe121, Alasdair Bamford121, Holly Belfield121, Gareth A. L. Jones121, Tara McHugh121, Hamza Meghari121, Samiran Ray121, Ana Luisa Tomas121, Lau- ran O’Neill121, Mark Peters121, Michael Bell121, Sarah Benkenstein121, Catherine Chisholm121, Charlene Davies121, Klaudia Kupiec121, Caroline Payne121. 77 13.1.72 Southmead Hospital, Bristol, UK Joanna Halls122, Hayley Blakemore122, Elizabeth Goff122, Kati Hayes122, Kerry Smith122, Deanna Stephens122, Ruth Worner122, Borislava Borislavova122, Beverley Faulkner122, Matt Thomas122, Ruth Cookson122, Emma Gendall122, Georgina Larman122, Rebecca Pope122, Artur Smalira122. 13.1.73 William Harvey Hospital, Ashford, UK Victoria Priestley123, Tracey Cosier123, Gemma Millen123, James Rand123, Natasha Schumacher123, Rox- ana Sandhar123, Heather Weston123, Neil Richardson123, Lucy Cooper123. 13.1.74 Arrowe Park Hospital, Wirral, UK Cathy Jones124, Ya-Wen Jessica Huang124, Reni Jacob124, Craig Denmade124, Lewis Mcintyre124. 13.1.75 Royal Hampshire County Hospital, Hampshire, UK Dawn Trodd125, Jane Martin125, Geoff Watson125, Emily Bevan125, Caroline Wreybrown125. 13.1.76 Bradford Royal Infirmary, Bradford, UK Shereen Bano126, Ruth Bellwood126, Michael Bentley126, Matt Bromley126, Lucy Gurr126, Camilla Ledgard126, Janet McGowan126, Kate Pye126, Kirsten Sellick126, Amelia Stacey126, Deborah Warren126, Brian Wilkinson126, Louise Akeroyd126, Huma Shafique126, James Morgan126, Susan Shorter126, Rachel Swinger126, Emily Waters126, Tom Lawton126. 13.1.77 Glan Clwyd Hospital, Bodelwyddan, UK Elizabeth Allan127, Kate Darlington127, Ffyon Davies127, Llinos Davies127, Jack Easton127, Sumit Kumar127, Richard Lean127, Callum Mackay127, Richard Pugh127, Xinyi Qiu127, Stephanie Rees127, Jeremy Scanlon127, Joanne Lewis127, Daniel Menzies127, Annette Bolger127, Gwyneth Davies127, Jen- nifer Davies127, Esther Garrod127, Helen Jones127, Rachel Manley127, Hannah Williams127. 13.1.78 Royal Bournemouth Hospital, Bournemouth, UK Jordan Frankham128, Sally Pitts128, Nigel White128, Debbie Branney128, Heather Tiller128. 13.1.79 Bristol Royal Infirmary, Bristol, UK Georgia Efford129, Zoe Garland129, Lisa Grimmer129, Bethany Gumbrill129, Rebekah Johnson129, Katie Sweet129, Jeremy Bewley129, Christina Coleman129, Katie Corcoran129, Eva Maria Hernandez Morano129, Rachel Shiel129, Denise Webster129, Josephine Bonnici129, Eleanor Daniel129, Abbie Dell129. 13.1.80 University Hospital North Durham, Darlington, UK and Darlington Memorial Hospital, Darlington, UK Melanie Kent130, Ami Wilkinson130, Ellen Brown130, Andrea Kay130, Suzanne Campbell130, Amanda Cowton130, Mark Birt130, Vicki Greenaway130, Kathryn Potts130, Clare Hutton130, Andrew Shepperson130. 13.1.81 Basildon Hospital, Basildon, UK Miranda Forsey131, Alice Nicholson131, Mark Vertue131, Joanne Riches131, Agilan Kaliappan131, Anne Nicholson131. 13.1.82 University College Hospital, London, UK Niall MacCallum132, Eamon Raith132, Georgia Bercades132, Ingrid Hass132, David Brealey132, Gladys Martir132, Anna Reyes132, Deborah Smyth132, Maria Zapatamartinez132. 13.1.83 Whittington Hospital, London, UK Ana Alvaro133, Champa Jetha133, Louise Ma133, Lauren Booker133, Loreta Mostoles133, Anezka Pratley133, Abdelhakim Altabaibeh133, Chetan Parmar133, Kayleigh Gilbert133. 78 13.1.84 Western General Hospital, Edinburgh, UK Susie Ferguson134, Amy Shepherd134, Sheila Morris134, Jo Singleton134, Rosie Baruah134, Maria Amamio134, Sophie Birch134, Kate Briton134, Sarah Clark134, Katherine Doverman134, Lucy Marshall134, Scott Simpson134. 13.1.85 Ipswich Hospital, Ipswich, UK Georgina Lloyd135, Stephanie Bell135, Vanessa Rivers135, Bally Purewal135. 13.1.86 Hereford County Hospital, Hereford, UK Kate Hammerton136, Susan Anderson136, Janine Birch136, Emma Collins136, Ryan Oleary136. 13.1.87 Sunderland Royal Hospital, Sunderland, UK Sarah Cornell137, Jordan Jarmain137, Kimberley Rogerson137, Fiona Wakinshaw137, Lindsey Woods137, Anthony Rostron137, Zeynep Elcioglu137, Alistair Roy137. 13.1.88 Queens Hospital Burton, Burton-On-Trent, UK Gillian Bell138, Holly Dickson138, Louise Wilcox138, Amro Katary138, Katy English138. 13.1.89 Musgrove Park Hospital, Taunton, UK Joanne Hutter139, Corinne Pawley139, Patricia Doble139, Charmaine Shovelton139, Marius Vaida139, Re- becca Purnell139, Ashly Thomas139. 13.1.90 The Royal Papworth Hospital, Cambridge, UK Lenka Cagova140, Adama Fofano140, Helen Holcombe140, Alice Michael Mitchell140, Lucy Mwaura140, Krithivasan Praman140, Lucie Garnr140, Sue Mepham140, Kitty Paques140, Alain Vuylsteke140, Jennifer Mackie140, Carmen Pearn140, Julie Zamikula140. 13.1.91 University Hospital Lewisham, London, UK Mark Birt141, Estefania Treus Gude141, Maggie Nyirenda141, Lisa Capozzi141, Rosie Reece-Anthony141, Waqas Khaliq141, Hazma Noor141, Alfa Cresia Nilo141. 13.1.92 The Princess Alexandra Hospital, Harlow, UK Michelle Grove142, Amelia Daniel142, Amy Easthope142, Joanne Finn142, Nikki White142, Rajnish Saha142, Bibi Badal142, Karen Ixer142. 13.1.93 University Hospital of Wales, Cardiff, UK Donna Duffin143, Ben Player143, Helen Hill143, Jade Cole143, Jenny Brooks143, Michelle Davies143, Rhys Davies143, Lauren Hunt143, Emma Thomas143, Angharad Williams143. 13.1.94 West Middlesex Hospital, Isleworth, UK Metod Oblak144, Mini Thankachen144, Jamie Irisari144, Amrinder Sayan144, Monica Popescu144. 13.1.95 Royal Albert Edward Infirmary, Wigan, UK Cheryl Finch145, Andrew Jamieson145, Alison Quinn145, Joshua Cooper145, Sarah Liderth145, Natalia Waddington145. 13.1.96 Stoke Mandeville Hospital, Buckinghamshire, UK Iona Burn146, Katarina Manso146, Ruth Penn146, Julie Tebbutt146, Danielle Thornton146, James Winchester146, Geraldine Hambrook146, Pradeep Shanmugasundaram146. 13.1.97 Royal Lancaster Infirmary, Lancaster, UK Jayne Craig147, Kerry Simpson147, Andrew Higham147, Louise Sibbett147. 79 13.1.98 Basingstoke and North Hampshire Hospital, Basingstoke, UK Sheila Paine148, Annabel Reed148, Jo-Anna Conyngham148, Mcdonald Mupudzi148, Rachel Thomas148, Mary Wright148, Denise Griffin148, Richard Partridge148, Maria Alvarez Corral148, Nycola Muchenje148, Mildred Sitonik148, Caroline Wrey Brown148. 13.1.99 Worthing Hospital, Worthing, UK and St Richard’s Hospital, Chichester, UK Aaron Butler149, Linda Folkes149, Heather Fox149, Amy Gardner149, David Helm149, Gillian Hobden149, Kirsten King149, Jordi Margalef149, Michael Margarson149, Tim Martindale149, Emma Meadows149, Dana Raynard149, Yvette Thirlwall149, Yolanda Baird149, Raquel Gomez149, Darren Martin149, Luke Hodgson149, Clinton Corin149, Erikka Sidall149, Densie Szabo149, Sharon Floyd149. 13.1.100 The Alexandra Hospital, Redditch and Worcester Royal Hospital, Worcester, UK Hannah Davies150, Karen Austin150, Olivia Kelsall150, Hannah Wood150, Hannah Davies150, Peter Anderson150, Katie Archer150, Andrew Burtenshaw150, Sarah Clayton150, Naiara Cother150, Nicholas Cowley150, Caroline Davis150, Stephen Digby150, Alison Durie150, Alison Harrison150, Emma Low150, Michael McAlindon150, Alex McCurdy150, Aled Morgan150, Tobias Rankin150, Jessica Thrush150, Helen Tranter150, Charlie Vigurs150, Laura Wild150, Karen Austin150, Olivia Kelsall150, Hannah Wood150. 13.1.101 Royal Cornwall Hospital, Truro, UK Thomas Cornell151, Kate Ralph151, Sarah Bean151, Karen Burt151, Michael Spivey151, Carol Richards151, Rachel Tedstone151. 13.1.102 Watford General Hospital, Watford, UK Siobhain Carmody152, Xiaobei Zhao152, Valerie Page152, Mark Louie Guanco152, Elvira Hoxha152, Camilla Zorloni152. 13.1.103 Macclesfield District General Hospital, Macclesfield, UK Charlotte Dean153, Emma Jones153, Emma Carter153, Joshua Dunn153, Thomas Kong153, Mervin Mahenthran153, Chris Marsh153, Maureen Holland153, Natalie Keenan153, Mohamed Mahmoud153, Marc Lyons153, Joanne Bradley-Potts153, Helen Wassall153, Meghan Young153. 13.1.104 Royal Surrey County Hospital, Guildford, UK Paul Bradley154, Dorota Burda154, Sinead Donlon154, Lesley Harden154, Celia Harris154, Irving Mayangao154, Rugia Montaser154, Sheila Mtuwa154, Charles Piercy154, Eleanor Smith154, Sarah Stone154, Jerik Verula154, Helen Blackman154, Cheryl Marriott154, Natalia Michalak154, Ben Creagh-Brown154, Armorel Salberg154, Naomi Boyer154, Veronika Pristopan154. 13.1.105 Rotherham General Hospital, Rotherham, UK Victoria Maynard155, Rachel Walker155, Anil Hormis155, Dawn Collier155, Cheryl Graham155, Vicky Maynard155, Jake McCormick155, Jake Warrington155. 13.1.106 Craigavon Area Hospital, County Armagh, NI Denise Cosgrove156, Denise McFarland156, Judith Ratcliffe156, Rob Charnock156. 13.1.107 King’s Mill Hospital, Nottingham, UK Inez Wynter157, Mandy Gill157, Jill Kirk157, Paul Paul157, Valli Ratnam157, Sarah Shelton157. 13.1.108 Dumfries and Galloway Royal Infirmary, Dumfries, UK Catherine Jardine158, Alasdair Hay158, Dewi Williams158. 13.1.109 Prince Charles Hospital, Merthyr Tydfil, UK Bethan Deacon159, Latha Durga159, Meg Hibbert159, Gareth Kennard-Holden159, Chrsitopher Woodford159, Carla Pothecary159, Lisa Roche159, Dariusz Tetla159, Kevin Agravante159, Justyna Smeaton159. 80 13.1.110 Ysbyty Gwynedd, Bangor, UK Alicia Price160, Alice Thomas160, Chris Thorpe160, Ellen Knights160, Donna Ward160. 13.1.111 Royal Preston Hospital, Preston, UK Shondipon Laha161, Mark Verlander161, Alexandra Williams161. 13.1.112 The Great Western Hospital, Swindon, UK Rachel Prout162, Helen Langton162, Malcolm Watters162, Charlotte Hunt162, Catherine Novis162. 13.1.113 Lincoln County Hospital, Lincoln, UK Sarwat Arif163, Amy Cunningham163, Claire Hewitt163, Julia Hindale163, Karen Jackson-Lawrence163, Sarah Shepardson163, Maryanne Wills163, Susie Butler163, Silivia Tavares163, Russell Barber163, Annette Hilldrith163, Kelly Hubbard163. 13.1.114 University Hospital of North Tees, Stockton on Tees, UK Dawn Egginton164, Michele Clark164, Sarah Purvis164, Simon Sinclair164, Vicky Collins164. 13.1.115 Glangwili General Hospital, Camarthen, UK Bethan Landeg165, Craig Sell165, Samantha Coetzee165, Alistair Gales165, Igor Otahal165, Becky Icke165, Meena Raj165, Caroline Williams165, Jill Williams165, Lucy Hill165. 13.1.116 Southend University Hospital, Westcliff-on-Sea, UK Abdul Kayani166, Bridgett Masunda166, Prisca Gondo166, Nigara Atayeva166. 13.1.117 Lister Hospital, Stevenage, UK Carina Cruz167, Natalie Pattison167. 13.1.118 Diana Princess of Wales Hospital, Grimsby, UK Caroline Burnett168, Jonathan Hatton168, Elaine Heeney168, Maria Newton168, Hassan Al-Moasseb168, Teresa Behan168, Jasmine Player168, Rachael Stead168, Atideb Mitra168, Kirsty Nauyokas168. 13.1.119 West Suffolk Hospital, Bury St Edmunds, UK Sally Humphreys169, Helen Cockerill169, Ruth Tampsett169. 13.1.120 Victoria Hospital, Kirkcaldy, UK Evgeniya Postovalova170, Tina Coventry170, Amanda McGregor170, Susan Fowler170, Mike Macmahon170, Patricia Cochrane170, Sandra Pirie170. 13.1.121 Calderdale Royal Hospital, Halifax, UK and Huddersfield Royal Infirmary, Hud- dersfield, UK Sarah Hanley171, Asifa Ali171, Megan Brady171, Sam Dale171, Annalisa Dance171, Lisa Gledhill171, Jill Greig171, Kathryn Hanson171, Kelly Holdroyd171, Marie Home171, Tahira Ishaq171, Diane Kelly171, Lear Matapure171, Deborah Melia171, Samantha Mellor171, Ekta Merwaha171, Tonicha Nortcliffe171, Lisa Shaw171, Ryan Shaw171, Tracy Wood171, Lee-Ann Bayo171, Miranda Usher171, Alison Wilson171, Ross Kitson171, Jez Pinnell171, Matthew Robinson171, Kaitlin Boltwood171. 13.1.122 Dorset County Hospital, Dorchester, UK Jenny Birch172, Laura Bough172, Rebecca Tutton172, Barbara Winter-Goodwin172, Josie Goodsell172, Kate Taylor172, Patricia Williams172, Sarah Williams172, Ashleigh Cave172, James Rees172. 81 13.1.123 Russell’s Hall Hospital, Dudley, UK Janet Imeson-Wood173, Jacqueline Smith173, Vishal Amin173, Komala Karthik173, Rizwana Kausar173, Elena Anastasescu173, Karen Reid173, Vikram Anumakonda173, Ella Stoddart173. 13.1.124 Royal United Hospital, Bath, UK Carrie Demetriou174, Charlotte Eckbad174, Lucy Howie174, Sarah Mitchard174, Lidia Ramos174, Katie White174, Sarah Hierons174, Fiona Kelly174, Alfredo Serrano-Ruiz174, Gabrielle Evans174. 13.1.125 St Mary’s Hospital, Newport, UK Liz Nicol175, Joy Wilkins175, Kim Hulacka175, Gabor Debreceni175, Alison Brown175, Vikki Crickmore175. 13.1.126 George Eliot Hospital NHS Trust, Nuneaton, UK Kay Hill176, Thogulava Kannan176. 13.1.127 Yeovil Hospital, Yeovil, UK Zenaida Dagutao177, Kate Beesley177, Alison Lewis177, Jess Perry177, Sherly Antony177, Sarah Board177, Clare Buckley177, Lucy Pippard177, Alfonso Tanate177, Diane Wood177, Agnieska Kubisz-Pudelko177, Ayman Gouda177. 13.1.128 Forth Valley Royal Hospital, Falkirk, UK Fiona Auld178, Joanne Donnachie178, Euan Murdoch178, Lynn Prentice178, Nikole Runciman178, Dha- neesha Senaratne178, Abigail Short178, Laura Sweeney178, Lesley Symon178, Anne Todd178, Patricia Turner178, Erin McCann178, Dario Salutous178, Ian Edmond178, Lesley Whitelaw178. 13.1.129 Frimley Park Hospital, Surrey, UK Harish Venkatesh179, Yvonne Bland179, Istvan Kajtor179, Lisa Kavanagh179, Karen Singler179, George Linfield-Brown179. 13.1.130 Chelsea & Westminster NHS Foundation Trust, London, UK Luke Stephen Prockter Moore180, Marcela Vizcaychipi180, Laura Martins180, Luke Moore180, Rhian Bull180, Jaime Carungcong180. 13.1.131 Queen Elizabeth the Queen Mother Hospital, Margate, UK Louise Allen181, Eva Beranova181, Alicia Knight181, Carly Price181, Sorrell Tilbey181, Sharon Turney181, Tracy Hazelton181, Gabriella Tutt181, Mansi Arora181, Salah Turki181, Emily Sinfield181, Joanne Deery181, Hazel Ramos181. 13.1.132 Royal Brompton Hospital, London, UK Daniele Cristiano182, Natalie Dormand182, Zohreh Farzad182, Mahitha Gummadi182, Sara Salmi182, Geral- dine Sloane182, Mathew Varghese182, Vicky Thwaites182, Brijesh Patel182, Liyanage Kamal182, Anelise Catelan Zborowski182. 13.1.133 Darent Valley Hospital, Dartford, UK Ryan Coe183, Madeleine Anderson183, Jane Beadle183, Charlotte Coates183, Katy Collins183, Maria Crowley183, Laura Johnson183, Laura King183, Remi Paramsothy183, Janet Sargeant183, Pedro Silva183, Carmel Stuart183, June Taylor183, David Tyl183, Phillipa Wakefield183, Charlotte Kamundi183, Olumide Olufuwa183, Zakaulla Belagodu183, Anca Gherman183, Naomi Oakley183. 13.1.134 University Hospital Crosshouse, Kilmarnock, UK John Allan184, Tim Geary184, Alistair Meikle184, Peter O’Brien184, Stephen Wood184, Andrew Clark184, Gordon Houston184. 82 13.1.135 University Hospital Wishaw, Wishaw, UK Karen Black185, Michelle Clarkson185, Stuart D’Sylva185, Alan Morrison185, Kathryn Norman185, Mar- garet Taylor185, Suzanne Clements185, Catriona Cohrane185, Nora Gonzalez185, Dominic Strachan185, Claire Beith185, Kirsten Moar185. 13.1.136 University College Dublin, St Vincent’s University Hospital, Dublin, Ireland Lorna Murphy186, Michelle Smythe186, Alistair Nichol186, Kathy Brickell186. 13.1.137 The Queen Elizabeth Hospital, King’s Lynn, UK Inthakab Ali Mohamed Ali187, Karen Beaumont187, Mohamed Elsaadany187, Kay Fernandes187, Sameena Mohamed Ally187, Harini Rangarajan187, Varun Sarathy187, Sivarupan Selvanayagam187, Dave Vedage187, Matthew White187, Zoe Coton187, Aricsa Joshy187, Mark Blunt187, Hollie Curgenven187. 13.1.138 Walsall Manor Hospital, Walsall, UK Liam Botfield188, Catherine Dexter188, Aditya Kuravi188, Joanne Butler188, Robert Chadwick188, Poonam Ranga188, Lisa Richardson188, Emma Virgilio188, Maddiha Anwer188, Atul Garg188, Donna Botfield188, Xana Marriott188. 13.1.139 Princess Royal Hospital, Brighton, UK Keely Stewart189, Dee Mullan189, Claire Phillips189, Jane Gaylard189, Justyna Nowak189, Denise Skinner189. 13.1.140 Barnsley Hospital, Barnsley, UK Sian Jones190, Rikki Crawley190, Abigail Crew190, Mishell Cunningham190, Allison Daniels190, Laura Harrison190, Susan Hope190, Nicola Lancaster190, Jamie Matthews190, Gemma Wray190, Alice Nicholson190, Ken Inweregbu190, Sarah Cutts190, Katharine Miller190. 13.1.141 Warrington General Hospital, Warrington, UK Ailbhe Brady191, Rebekah Chan191, Shane McIvor191, Helena Prady191, Bijoy Mathew191, Jeff Little191, Tim Furniss191. 13.1.142 Royal Victoria Hospital, Belfast, NI Chris Wright192, Bernadette King192, Christopher Wasson192, Aisling O’Neill192, Christine Turley192, Pe- ter McGuigan192, Erin Collins192, Stephanie Finn192, Jackie Green192, Julie McAuley192, Abitha Nair192, Charlotte Quinn192, Suzanne Tauro192, Kathryn Ward192, Michael McGinlay192, Kiran Reddy192. 13.1.143 Royal Hallamshire Hospital and Northern General Hospital, Sheffield, UK Norfaizan Ahmad193, Samantha Anderson193, Joann Barker193, Kris Bauchmuller193, Kathryn Birchall193, Sarah Bird193, Kay Cawthron193, Luke Chetam193, Joby Cole193, Ben Donne193, David Foote193, Am- ber Ford193, Helena Hanratty193, Kate Harrington193, Lisa Hesseldon193, Kay Housley193, Yvonne Jackson193, Claire Jarman193, Faith Kibutu193, Becky Lenagh193, Irene Macharia193, Shamiso Masuko193, Leanne Milner193, Helen Newell193, Lorenza Nwafor193, Simon Oxspring193, Patrick Phillips193, Ajay Raithatha193, Sarah Rowland-Jones193, Jacqui Smith193, Roger Thompson193, Helen Trower193, Sara Walker193, James Watson193, Matthew Wiles193, Alison Lye193, Jayne Willson193, Gary Mills193, Sansha Harris193, Eleanor Hartill193. 13.1.144 Harefield Hospital, London, UK Anthony Barron194, Ciara Collins194, Sundeep Kaul194, Claire Nolan194, Oliver Polgar194, Claire Prendergast194, Paula Rogers194, Rajvinder Shokkar194, Meriel Woodruff194, Kanta Mahay194, Vicky Thwaites194, Anna Reed194, Hayley Meyrick194, Heather Passmore194, James Farwell194. 13.1.145 Cumberland Infirmary, Carlisle, UK Alison Brown195, Susan O’Connell195, Jane Gregory195, Luigi Barberis195, Rosemary Harper195, Tim Smith195, Diane Armstrong195. 83 13.1.146 Eastbourne District General Hospital, East Sussex, UK and Conquest Hospital, East Sussex, UK Angie Bowey196, Anne Cowley196, Andrew Corner196, Judith Highgate196, Claire Rutherfurd196, Jo-Anne Taylor196, Sarah Goodwin196, Claire Rutherford196. 13.1.147 Salisbury District Hospital, Salisbury, UK Beena Eapen197, Fiona Trim197, Phil Donnison197. 13.1.148 Airedale General Hospital, Keighley, UK Lisa Armstrong198, Hayley Bates198, Emma Dooks198, Fiona Farquhar198, Amy Kitching198, Chantal McParland198, Sophie Packham198, Brigid Hairsine198. 13.1.149 Leicester Royal Infirmary, Leicester, UK Premetie Andreou199, Dawn Hales199, Megha Mathews199, Rekha Patel199, Peter Barry199, Neil Flint199, Jessica Hailstone199, Navneet Ghuman199, Bethany Leonard199, Rachel Lees199. 13.1.150 Peterborough City Hospital, Peterborough, UK and Hinchingbrooke Hospital, Huntingdon, UK Deborah Butcher200, Katy Leng200, Nicola Butterworth-Cowin200, Susie O’Sullivan200. 13.1.151 Colchester General Hospital, Colchester, UK Alison Ghosh201, Emma Williams201. 13.1.152 Princess Royal Hospital, Telford and Royal Shrewsbury Hospital, Shrewsbury, UK Colene Adams202, Anita Agasou202, Tracie Arden202, Mandy Beekes202, Amy Bowes202, Pauline Boyle202, Heather Button202, Mandy Carnahan202, Anne Carter202, Danielle Childs202, Jane Gaylard202, Fran Hurford202, Yasmin Hussain202, Ayesha Javaid202, James Jones202, Michael Leigh202, Terry Martin202, Helen Millward202, Nichola Motherwell202, Dee Mullan202, Julie Newman202, Rachel Rikunenko202, Jo Stickley202, Julie Summers202, Louise Ting202, Helen Tivenan202, Denise Donaldson202, Nigel Capps202, Emily Cale202, Sanal Jose202, Wendy Osbourne202, Susie Pajak202, Jayne Rankin202, Louise Tonks202. 13.1.153 University Hospital Monklands, Airdrie, UK Tracy Baird203, Margaret Harkins203, Jim Ruddy203, Joe West203. 13.1.154 Wrexham Maelor Hospital, Wrexham, Wales Joseph Duffield204, Lewis Mallon204, Oliver Smith204, Sara Smuts204, Andy Campbell204, Cate Davies204, Sarah Davies204, Rachel Hughes204, Lisa Jobes204, Victoria Whitehead204, Clare Watkins204. 13.1.155 Royal Hospital for Children, Glasgow, UK Fiona Bowman27, Barry Milligan27, Colin Begg27, Liane McPherson27. 13.1.156 New Cross Hospital, Wolverhampton, UK Stella Metherell205, Nichola Harris205, Victoria Lake205, Elizabeth Radford205, Andy Smallwood205, Shameer Gopal205, Katherine Vassell205. 13.1.157 University Hospital Hairmyres, East Kilbride, UK Dina Bell206, Rosalind Boyle206, Katie Douglas206, Lynn Glass206, Liz Lennon206, Austin Rattray206, Claire Beith206, Emma Lee206. 13.1.158 Warwick Hospital, Warwick, UK Danielle Jones207, Penny Parsons207, Ben Attwood207, Paul Jefferson207, Mohan Ranganathan207, Inderjit Atwal207, Bridget Campbell207, Angela Day207, Camilla Stagg207. 84 13.1.159 Sandwell General Hospital and City Hospital, Birmingham, UK Emma Haynes208, Cecilia Ahmed208, Sarah Clamp208, Julie Colley208, Risna Haq208, Anne Hayes208, Sibet Joseph208, Zahira Maqsood208, Samia Hussain208, Jonathan Hulme208, Patience Domingos208, Rita Kumar208, Manjit Purewal208, Becky Taylor208. 13.1.160 Royal Manchester Children’s Hospital, Manchester, UK Lara Bunni209, Monica Latif209, Claire Jennings209, Shilu Jose209, Rebecca Marshall209, Aleksandra Metryka209, Gayathri Subramanian209. 13.1.161 Gloucestershire Royal Hospital, Gloucester, UK Adam Burgoyne210, Susan O’Connell210, Amanda Tyler210, Joanne Waldron210, Paula Hilltout210, Jayne Evitts210. 13.1.162 University Hospitals Coventry & Warwickshire NHS Trust, Coventry, UK Geraldine Ward211, Pamela Bremmer211, Carl Hawkins211, Sophie Jackman211, Michal Ogorek211. 13.1.163 Torbay Hospital, Torquay, UK Kylie Ashby212, Lorraine Thornton212, Pauline Mercer212, Matthew Halkes212, Adam Revill212. 13.1.164 Pilgrim Hospital, Lincoln, UK Bryony Saint213, Jo Fletcher213, Kimberley Netherton213, Manish Chablani213, Amy Kirkby213, Amanda Roper213, Kinga Szymiczek213. 13.1.165 Prince Philip Hospital, Lianelli, UK Isobel Sutherland214, Linda O’Brien214, Igor Otahal214, Joanne Connell214, Kim Davies214, Tracy Lewis214, Zohra Omar214, Emma Perkins214. 13.1.166 Princess of Wales Hospital, Llantrisant, UK Lisa Roche215, Sonia Sathe215, Ellie Davies215. 13.1.167 Northampton General Hospital NHS Trust, Northampton, UK Alex Lyon216, Isheunesu Mapfunde216, Charlotte Willis216, Rachael Hitchcock216, Kathryn Hall216, Christopher King216. 13.1.168 The Christie NHS Foundation Trust, Manchester, UK Andrew Fagan217, Roonak Nazari217, Lucy Worsley217, Suzanne Allibone217, Vidya Kasipandian217, Amit Patel217, Parisa Cutting217, Roman Genetu217, Ainhi Mac217, Anthony Murphy217, Sinead Ward217, Fatima Butt217. 13.1.169 James Paget University Hospital NHS Trust, Great Yarmouth, UK Amanda Ayers218, Wendy Harrison218, Katherine Mackintosh218, Julie North218. 13.1.170 Birmingham Children’s Hospital, Birmingham, UK Lydia Ashton219, Rehana Bi219, Samantha Owen219, Helen Winmill219, Barney Scholefield219. 13.1.171 Withybush General Hospital, Pembrokeshire, Wales Hannah Blowing220, Erin Williams220, Michaela Duskova220, Michelle Edwards220, Alun Rees220, Helen Thomas220, Rachel Hughes220, Igor Otahal220, Jolene Brooks220, Janet Phipps220, Suzanne Brooks220. 13.1.172 Northwick Park Hospital, London, UK Catherine Dennis221, Vicki Parris221, Sinduya Srikaran221, Anisha Sukha221, Alistair McGregor221, Ger- lynn Tiongson221. 85 13.1.173 North Devon District Hospital, Barnstaple, UK Katie Adams222, Benedict Andrew222, Adam Brayne222, Sasha Carter222, Louise Findlay222, Emma Fisher222, Peter Jackson222, Duncan Kaye222, Juliet Parkin222, Victoria Tuckey222, Jane Hunt222, Nicholas Love222, Lynne van Koutrick222, Ashley Hanson222. 13.1.174 Scunthorpe General Hospital, Scunthorpe, UK Kathy Dent223, Elizabeth Horsley223, Sandra Pearson223, Sue Spencer223, Dorothy Hutchinson223, Jas- mine Player223, Dorota Potoczna223, Muhammad Nauman Akhtar223, Lisa-Jayne Cottam223, Kirsty Nauyokas223, Jack Sanders223. 13.1.175 Royal Free Hospital, London, UK Sara Mingo Garcia224, Glykeria pakou224, Cynthia Diaba224, Helder Filipe224, Lincy John224, Amitaa Maharajh224, Mark de Neef224, Daniel Martin224, Christine Eastgate224, Poh Choo Teoh224. 13.1.176 Raigmore Hospital, Inverness, UK Fiona Barrett225, Clare Bradley225, Avril Donaldson225, Mairi Mascarenhas225, Marianne O’Hara225, Laura Okeefe225, Noreen Clarke225, Jonathan Whiteside225, Rachael Campbell225, Joanna Matheson225, Deborah McDonald225, Donna Patience225. 13.1.177 West Cumberland Hospital, Whitehaven, UK Polly Rice226, Tim Smith226, Melanie Clapham226, Rachel Mutch226, Luigi Barberis226, Rosemary Harper226, Hannah Craig226, Una Poultney226. 13.1.178 Furness General Hospital, Barrow-in-Furness, UK Karen Burns227, Andrew Higham227. 13.1.179 Liverpool Heart and Chest Hospital, Liverpool, UK Sophie Twiss228, Janet Barton228, Linsha George228, Clare Harrop228, Sherly Mathew228, David Justin Wright228. 13.1.180 Scarborough General Hospital, Scarborough, UK Rachel Harrison229, Jordan Toohie229, Ben Chandler229, Alison Turnbull229, Janine Mallinson229, Kerry Elliott229. 13.1.181 Bronglais General Hospital, Aberystwyth, UK Rebecca Wolf-Roberts230, Helen Tench230, Igor Otahal230, Maria Hobrok230, Ronda Loosley230, Heather McGuinness230, Tanya Sims230. 13.1.182 Alder Hey Children’s Hospital, Liverpool, UK Deborah Afolabi231, Kathryn Sian Allison231, Taya Anderson231, Rachael Dore231, Dawn Jones231, Naomi Rogers231, Paula Saunderson231, Jennifer Whitbread231, Laura O’Malley231, Laura Rad231, Daniel Hawcutt231. 13.1.183 Borders General Hospital, Melrose, UK Jonathan Aldridge232, Melanie Tolson232, Sweyn Garrioch232. 13.1.184 Leighton Hospital, Cheshire, UK Joanne Tomlinson233, Michael Grosdenier233. 13.1.185 Kent & Canterbury Hospital, Canterbury, UK David Loader234, Ritoo Kapoor234, Gemma Hector234. 86 13.1.186 Harrogate and District NHS Foundation Trust, Harrogate, UK Joslan Scherewode235, Chunda Sri-Chandana235, Lorraine Stephenson235, Sarah Marsh235. 13.1.187 The Royal Marsden Hospital, London, UK Arnold Dela Rosa236, Shaman Jhanji236, Thomas Bemand236, Ryan Howle236, Ravishankar Rao Baikady236, Benjamin Thomas236, Ethel Black236, Kate Tatham236. 13.1.188 Ealing Hospital, Southall, UK Sambasivarao Gurram237, Ekaterina Watson237, Vicki Parris237, Sheena Quaid237, Alistair McGregor237. 13.1.189 St John’s Hospital Livingston, Livingston, UK Anne Saunderson238, Rachel O’Brien238, Sam Moultrie238, Jen Service238, Clare Cheyne238, Miranda Odam238, Alison Wiliams238. 13.1.190 Wexham Park Hospital, Slough, UK Nicky Barnes239, Peter Csabi239, Joana Da Rocha239, Louika Glynou239. 13.1.191 Sheffield Children’s Hospital, Sheffield, UK Amy Huffenberger240, Jade Bryant240, Amy Pickard240, Nicholas Roe240, Arianna Bellini240, An- ton Mayer240, Amy Burrow240, Natalie Colley240, Jayne Evans240, Alex Howlett240, Zeinab Khalifeh@nhs.net240. 13.1.192 Homerton University Hospital Foundation NHS Trust, London UK Jerldine Pryce241, Claire Gorman241, Amy Easthope241, Rebecca Brady241, Elizabeth Timlick241, Pierre Antoine241, Abhinhav Gupta241. 13.1.193 National Hospital for Neurology and Neurosurgery, London, UK John Hardy242, Henry Houlden242, Eleanor Moncur242, Arianna Tucci242, Eamon Raith242, Ambreen Tariq242, David Brealey242. 13.1.194 The Royal Alexandra Children’s Hospital, Brighton, UK Emma Tagliavini243, Becky Ramsay243, Katy Fidler243, Kevin Donnelly243, Rebecca Hollis243. 13.1.195 Golden Jubilee National Hospital, Clydebank, UK Jocelyn Barr244, Elizabeth Boyd244, Val Irvine244, Ben Shelley244, Julie Buckley244, Charlene Hamilton244, Kathryn Valdeavella244. 49 NIHR Clinical Research Network (CRN), North West London Core Team, 3rd Floor Administrative Block South, Clock Tower, Hammersmith Hospital, Du Cane Road, London W12 0HS 50 Cambridge University Hospitals NHS Foundation Trust, Hills Road, Cambridge, CB2 0QQ, UK 51 Biostatistics Group, State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou, China 52 Department of Infectious Diseases, Leiden University Medical Center, Leiden, The Netherlands 53 Guys and St Thomas’ Hospital, London, UK 54 James Cook University Hospital, Middlesbrough, UK 55 Barts Health NHS Trust, London, UK 56 Royal Stoke University Hospital, Staffordshire, UK 57 North Middlesex University Hospital NHS trust, London, UK 58 King’s College Hospital, London, UK 59 Charing Cross Hospital, St Mary’s Hospital and Hammersmith Hospital, London, UK 60 The Royal Liverpool University Hospital, Liverpool, UK 61 John Radcliffe Hospital, Oxford, UK 62 Addenbrooke’s Hospital, Cambridge, UK 63 Nottingham University Hospital, Nottingham, UK 64 St George’s Hospital, London, UK 65 BHRUT (Barking Havering) - Queens Hospital and King George Hospital, Essex, UK 66 Royal Infirmary of Edinburgh, Edinburgh, UK 67 Kingston Hospital, Surrey, UK 68 Queen Alexandra Hospital, Portsmouth, UK 69 Royal Gwent Hospital, Newport, UK 70 Royal Blackburn Teaching Hospital, Blackburn, UK 71 Stepping Hill Hospital, Stockport, UK 72 Northumbria Healthcare NHS Foundation Trust, North Shields, UK 73 Countess of Chester Hospital, Chester, UK 74 Pinderfields General Hospital, Wakefield, UK 87 75 Ninewells Hospital, Dundee, UK 76 Croydon University Hospital, Croydon, UK 77 Morriston Hospital, Swansea, UK 78 Queen Elizabeth University Hospital, Glasgow, UK 79 Broomfield Hospital, Chelmsford, UK 80 Heartlands Hospital, Birmingham, UK 81 Royal Sussex County Hospital, Brighton, UK 82 York Hospital, York, UK 83 Queen Elizabeth Hospital, Birmingham, UK 84 Royal Glamorgan Hospital, Pontyclun, UK 85 Barnet Hospital, London, UK 86 Wythenshawe Hospital, Manchester, UK 87 Medway Maritime Hospital, Gillingham, UK 88 Royal Berkshire NHS Foundation Trust, Berkshire, UK 89 Whiston Hospital, Prescot, UK 90 The Royal Oldham Hospital, Manchester, UK 91 Chesterfield Royal Hospital Foundation Trust, Chesterfield, UK 92 Aberdeen Royal Infirmary, Aberdeen, UK 93 Royal Devon and Exeter Hospital, Exeter, UK 94 Glasgow Royal Infirmary, Glasgow, UK 95 Blackpool Victoria Hospital, Blackpool, UK 96 Southampton General Hospital, Southampton, UK 97 Ashford and St Peter’s Hospital, Surrey, UK 98 Derriford Hospital, Plymouth, UK 99 East Surrey Hospital, Redhill, UK 100 Poole Hospital, Poole, UK 101 Royal Alexandra Hospital, Paisley, UK 102 St James’s University Hospital and Leeds General Infirmary, Leeds, UK 103 Bedford Hospital, Bedford, UK 104 Southport and Formby District General Hospital, Ormskirk, UK 105 The Tunbridge Wells Hospital and Maidstone Hospital, Kent, UK 106 Queen Elizabeth Hospital, Woolwich, London, UK 107 North Manchester General Hospital, Manchester, UK 108 Royal Victoria Infirmary, Newcastle Upon Tyne, UK 109 Hull Royal Infirmary, Hull, UK 110 Manchester Royal Infirmary, Manchester, UK 111 Royal Derby Hospital, Derby, UK 112 Aintree University Hospital, Liverpool, UK 113 Fairfield General Hospital, Bury, UK 114 Norfolk and Norwich University hospital (NNUH), Norwich, UK 115 Milton Keynes University Hospital, Milton Keynes, UK 116 Good Hope Hospital, Birmingham, UK 117 Queen Elizabeth Hospital Gateshead, Gateshead, UK 118 Royal Bolton Hospital, Bolton, UK 119 Tameside General Hospital, Ashton Under Lyne, UK 120 Salford Royal Hospital, Manchester, UK 121 Great Ormond St Hospital and UCL Great Ormond St Institute of Child Health NIHR Biomedical Research Centre, London, UK 122 Southmead Hospital, Bristol, UK 123 William Harvey Hospital, Ashford, UK 124 Arrowe Park Hospital, Wirral, UK 125 Royal Hampshire County Hospital, Hampshire, UK 126 Bradford Royal Infirmary, Bradford, UK 127 Glan Clwyd Hospital, Bodelwyddan, UK 128 Royal Bournemouth Hospital, Bournemouth, UK 129 Bristol Royal Infirmary, Bristol, UK 130 University Hospital North Durham, Darlington, UK and Darlington Memorial Hospital, Darlington, UK 131 Basildon Hospital, Basildon, UK 132 University College Hospital, London, UK 133 Whittington Hospital, London, UK 134 Western General Hospital, Edinburgh, UK 135 Ipswich Hospital, Ipswich, UK 136 Hereford County Hospital, Hereford, UK 137 Sunderland Royal Hospital, Sunderland, UK 138 Queens Hospital Burton, Burton-On-Trent, UK 139 Musgrove Park Hospital, Taunton, UK 140 The Royal Papworth Hospital, Cambridge, UK 141 University Hospital Lewisham, London, UK 142 The Princess Alexandra Hospital, Harlow, UK 143 University Hospital of Wales, Cardiff, UK 144 West Middlesex Hospital, Isleworth, UK 145 Royal Albert Edward Infirmary, Wigan, UK 146 Stoke Mandeville Hospital, Buckinghamshire, UK 147 Royal Lancaster Infirmary, Lancaster, UK 148 Basingstoke and North Hampshire Hospital, Basingstoke, UK 149 Worthing Hospital, Worthing, UK and St Richard’s Hospital, Chichester, UK 150 The Alexandra Hospital, Redditch and Worcester Royal Hospital, Worcester, UK 151 Royal Cornwall Hospital, Truro, UK 152 Watford General Hospital, Watford, UK 153 Macclesfield District General Hospital, Macclesfield, UK 154 Royal Surrey County Hospital, Guildford, UK 155 Rotherham General Hospital, Rotherham, UK 156 Craigavon Area Hospital, County Armagh, NI 157 King’s Mill Hospital, Nottingham, UK 158 Dumfries and Galloway Royal Infirmary, Dumfries, UK 159 Prince Charles Hospital, Merthyr Tydfil, UK 160 Ysbyty Gwynedd, Bangor, UK 161 Royal Preston Hospital, Preston, UK 162 The Great Western Hospital, Swindon, UK 163 Lincoln County Hospital, Lincoln, UK 164 University Hospital of North Tees, Stockton on Tees, UK 165 Glangwili General Hospital, Camarthen, UK 88 166 Southend University Hospital, Westcliff-on-Sea, UK 167 Lister Hospital, Stevenage, UK 168 Diana Princess of Wales Hospital, Grimsby, UK 169 West Suffolk Hospital, Bury St Edmunds, UK 170 Victoria Hospital, Kirkcaldy, UK 171 Calderdale Royal Hospital, Halifax, UK and Huddersfield Royal Infirmary, Huddersfield, UK 172 Dorset County Hospital, Dorchester, UK 173 Russell’s Hall Hospital, Dudley, UK 174 Royal United Hospital, Bath, UK 175 St Mary’s Hospital, Newport, UK 176 George Eliot Hospital NHS Trust, Nuneaton, UK 177 Yeovil Hospital, Yeovil, UK 178 Forth Valley Royal Hospital, Falkirk, UK 179 Frimley Park Hospital, Surrey, UK 180 Chelsea & Westminster NHS Foundation Trust, London, UK 181 Queen Elizabeth the Queen Mother Hospital, Margate, UK 182 Royal Brompton Hospital, London, UK 183 Darent Valley Hospital, Dartford, UK 184 University Hospital Crosshouse, Kilmarnock, UK 185 University Hospital Wishaw, Wishaw, UK 186 University College Dublin, St Vincent’s University Hospital, Dublin, Ireland 187 The Queen Elizabeth Hospital, King’s Lynn, UK 188 Walsall Manor Hospital, Walsall, UK 189 Princess Royal Hospital, Brighton, UK 190 Barnsley Hospital, Barnsley, UK 191 Warrington General Hospital, Warrington, UK 192 Royal Victoria Hospital, Belfast, NI 193 Royal Hallamshire Hospital and Northern General Hospital, Sheffield, UK 194 Harefield Hospital, London, UK 195 Cumberland Infirmary, Carlisle, UK 196 Eastbourne District General Hospital, East Sussex, UK and Conquest Hospital, East Sussex, UK 197 Salisbury District Hospital, Salisbury, UK 198 Airedale General Hospital, Keighley, UK 199 Leicester Royal Infirmary, Leicester, UK 200 Peterborough City Hospital, Peterborough, UK and Hinchingbrooke Hospital, Huntingdon, UK 201 Colchester General Hospital, Colchester, UK 202 Princess Royal Hospital, Telford and Royal Shrewsbury Hospital, Shrewsbury, UK 203 University Hospital Monklands, Airdrie, UK 204 Wrexham Maelor Hospital, Wrexham, Wales 205 New Cross Hospital, Wolverhampton, UK 206 University Hospital Hairmyres, East Kilbride, UK 207 Warwick Hospital, Warwick, UK 208 Sandwell General Hospital and City Hospital, Birmingham, UK 209 Royal Manchester Children’s Hospital, Manchester, UK 210 Gloucestershire Royal Hospital, Gloucester, UK 211 University Hospitals Coventry & Warwickshire NHS Trust, Coventry, UK 212 Torbay Hospital, Torquay, UK 213 Pilgrim Hospital, Lincoln, UK 214 Prince Philip Hospital, Lianelli, UK 215 Princess of Wales Hospital, Llantrisant, UK 216 Northampton General Hospital NHS Trust, Northampton, UK 217 The Christie NHS Foundation Trust, Manchester, UK 218 James Paget University Hospital NHS Trust, Great Yarmouth, UK 219 Birmingham Children’s Hospital, Birmingham, UK 220 Withybush General Hospital, Pembrokeshire, Wales 221 Northwick Park Hospital, London, UK 222 North Devon District Hospital, Barnstaple, UK 223 Scunthorpe General Hospital, Scunthorpe, UK 224 Royal Free Hospital, London, UK 225 Raigmore Hospital, Inverness, UK 226 West Cumberland Hospital, Whitehaven, UK 227 Furness General Hospital, Barrow-in-Furness, UK 228 Liverpool Heart and Chest Hospital, Liverpool, UK 229 Scarborough General Hospital, Scarborough, UK 230 Bronglais General Hospital, Aberystwyth, UK 231 Alder Hey Children’s Hospital, Liverpool, UK 232 Borders General Hospital, Melrose, UK 233 Leighton Hospital, Cheshire, UK 234 Kent & Canterbury Hospital, Canterbury, UK 235 Harrogate and District NHS Foundation Trust, Harrogate, UK 236 The Royal Marsden Hospital, London, UK 237 Ealing Hospital, Southall, UK 238 St John’s Hospital Livingston, Livingston, UK 239 Wexham Park Hospital, Slough, UK 240 Sheffield Children’s Hospital, Sheffield, UK 241 Homerton University Hospital Foundation NHS Trust, London UK 242 National Hospital for Neurology and Neurosurgery, London, UK 243 The Royal Alexandra Children’s Hospital, Brighton, UK 244 Golden Jubilee National Hospital, Clydebank, UK 13.2 SCOURGE Consortium Javier Abellan304,305, René Acosta-Isaac306, Jose María Aguado307,308,309,310, Carlos Aguilar311, Sergio Aguilera-Albesa312,313, Abdolah Ahmadi Sabbagh314, Jorge Alba315, Sergiu Albu316,317,318, Karla A.M. Alcalá-Gallardo319, Julia Alcoba-Florez320, Sergio Alcolea Batres321, Holmes Rafael Algarin-Lara322,323, Virginia Almadana324, Julia Almeida325,326,327,328, Berta Almoguera37,329, María R. Alonso330, Nuria Alvarez330, Yady Álvarez-Benítez322,323, Felipe Álvarez-Navia331,332, Rodolfo Alvarez-Sala Walther321, Ál- varo Andreu-Bernabeu309,333, Maria Rosa Antonijoan334, Eunate Arana-Arri335,336, Carlos Aranda337,338, 89 Celso Arango309,333,339, Carolina Araque340,341, Nathalia K. Araujo342, Izabel M.T. Araujo343, Ana C. Arcanjo344,345,346, Ana Arnaiz33,34,35, Francisco Arnalich Fernández347, María J. Arranz348, José Ramon Arribas Lopez347, Maria-Jesus Artiga349, Yubelly Avello-Malaver350, Carmen Ayuso37,329, Ana María Baldion350, Belén Ballina Martín314, Raúl C. Baptista-Rosas351,352,353, Andrea Barranco-Díaz323, María Barreda- Sánchez354,355, Viviana Barrera-Penagos350, Moncef Belhassen-Garcia332,356, Enrique Bernal354, David Bernal-Bello357, Joao F. Bezerra358, Marcos A.C. Bezerra359, Natalia Blanca-López360, Rafael Blancas361, Lucía Boix-Palop362, Alberto Borobia363, Elsa Bravo364, María Brion365,366, Óscar Brochado- Kith310,367, Ramón Brugada366,368,369,370, Matilde Bustos371, Alfonso Cabello372, Juan J. Caceres- Agra373, Esther Calbo374, Enrique J. Calderón375,376,377, Shirley Camacho378, Marcela C. Campos344, Yolanda Cañadas338, Cristina Carbonell331,332, Servando Cardona-Huerta36, Antonio Augusto F. Carioca379, Maria Sanchez Carpintero337,338, Carlos Carpio Segura321, Thássia M.T. Carratto380, José An- tonio Carrillo-Avila381, Maria C.C. Carvalho382, Carlos Casasnovas37,383,384, Luis Castano37,335,385,386,387, Carlos F. Castaño337,338, Jose E. Castelao388, Aranzazu Castellano Candalija389, María A. Castillo378, Francisco C. Ceballos367, Jessica G. Chaux341, Walter G. Chaves- Santiago341,390, Sylena Chiquillo- Gómez322,323, Marco A. Cid-Lopez319, Oscar Cienfuegos-Jimenez36, Rosa Conde-Vicente391, M. Lour- des Cordero-Lorenzana392, Dolores Corella393,394, Almudena Corrales30,31, Jose L. Cortes-Sanchez36,395, Marta Corton37,329, Tatiana X. Costa396, Raquel Cruz37,44,45,397, Marina S. Cruz342, Luisa Cuesta398, Gabriela C.R. Cunha399, Gabriela V. da Silva343, David Dalmau374,400, Raquel C.S. Dantas-Komatsu342, M. Teresa Darnaude401, Raimundo de Andrés402, Jéssica N.G. de Araújo403, Carmen de Juan404, Juan De la Cruz Troca376,405,406, Carmen de la Horra377, Ana B. de la Hoz335, Alba De Martino-Rodríguez407,408, Julianna Lys de Sousa Alves Neri409, Victor del Campo-Pérez410, Juan Delgado-Cuesta411, Covadonga M. Diaz-Caneja309,333,339, Anderson Díaz-Pérez323, Aranzazu Diaz de Bustamante401, Beatriz Dietl374, Silvia Diz-de Almeida37,44, Manoella do Monte Alves412,413, Elena Domínguez-Garrido414, Katiusse A. dos Santos382, Alice M. Duarte343, Jose Echave-Sustaeta415, Rocío Eiros416, César O. Enciso- Olivera340,341, Gabriela Escudero417, Pedro Pablo España418, Gladys Mercedes Estigarribia Sanabria419, María Carmen Fariñas33,34,35, Marianne R. Fernandes420,421, Ramón Fernández33,422, Lidia Fernandez- Caballero37,329, Ana Fernández-Cruz423, María J. Fernandez-Nestosa424, Uxía Fernández-Robelo425, Amanda Fernández-Rodríguez310,367, Marta Fernández-Sampedro33,34,35, Ruth Fernández-Sánchez37,329, Tania Fernández-Villa426, Silvia Fernández Ferrero314, Yolanda Fernández Martínez314, Carmen Fer- néndez Capitán389, Patricia Flores-Pérez427, Vicente Friaza376,377, Lácides Fuenmayor-Hernández323, Marta Fuertes Núñez314, Victoria Fumadó428, Ignacio Gadea429, Lidia Gagliardi337,338, Manuela Gago- Domínguez45,46, Natalia Gallego38, Cristina Galoppo430, Inés García37,329, Mercedes García337,338, Leticia García337,338, Carlos Garcia-Cerrada304,305,431, Aitor García-de-Vicuña335,385, Josefina Garcia- García354, Irene García-García363, Carmen García-Ibarbia33,34,35, Andrés C. García-Montero432, Ana García-Soidán433, Elisa García-Vázquez354, María Carmen García Torrejón305,434, Emiliano Garza- Frias36, Angela Gentile430, Belén Gil-Fournier435, Javier Gómez-Arrue407,408, Mario Gómez-Duque341,390, Luis Gómez Carrera321, María Gómez García397, Ángela Gómez Sacristán436, Anna González-Neira330, Javier González-Peñas309,333,339, Manuel Gonzalez-Sagrado391, Beatriz González Álvarez407,408, Fer- nan Gonzalez Bernaldo de Quirós437, Hugo Gonzalo Benito438, Oscar Gorgojo-Galindo439, Miguel Górgolas372, Florencia Guaragna430, Genilson P. Guegel440, Beatriz Guillen-Guio30, Encarna Guillen- Navarro354,441,442,443, Pablo Guisado-Vasco415, Juan F. Gutiérrez-Bautista444, Luz D. Gutierrez- Castañeda341,445, Sarah Heili-Frades446, Estefania Hernandez447, Luis D. Hernandez-Ortega353,448, Guillermo Hernández-Pérez331, Rebeca Hernández-Vaquero449, Cristina Hernández Moro314, Belen Herraez330, M. Teresa Herranz354, María Herrera337,338, María José Herrero450,451, Antonio Herrero- Gonzalez452, Juan P. Horcajada310,317,453,454,455, Natale Imaz-Ayo335, Maider Intxausti-Urrutibeaskoa456, María Íñiguez457, Rafael H. Jacomo458, Rubén Jara354, Perez Maria Jazmin430, Ángel Jiménez337,338, Pilar Jiménez444, Ignacio Jiménez-Alfaro459, María A. Jimenez-Sousa310,367, Iolanda Jordan376,460,461, Rocío Laguna-Goya462,463, Daniel Laorden321, María Lasa-Lazaro462,463, María Claudia Lattig378,464, Ailen Lauriente430, Anabel Liger Borja465, Lucía Llanos466, Amparo López-Bernús331,332, Esther Lopez- Garcia376,405,406,467, Rosario Lopez-Rodriguez37,329, Miguel A. López-Ruz468,469,470, Eduardo López Granados37,471,472, Leonardo Lorente473, José E. Lozano474, María Lozano-Espinosa465, Andre D. Luchessi475, Ignacio Mahillo31,476,477, Esther Mancebo462,463, Carmen Mar418, Cristina Marcelo Calvo389, Miguel Marcos331,332, Alba Marcos-Delgado478, Alicia Marín Candon363, Pablo Mariscal Aguilar321, María M. Martín479, María Dolores Martín480, Vicente Martín376,478, Marta Martin-Fernandez481, Caridad Martín-López465, José-Ángel Martín-Oterino331,332, Laura Martin-Pedraza360, María Martín- Vicente367, Amalia Martinez482, Ricardo Martínez447, Juan José Martínez37,384, Silvia Martínez33,35, Eleno Martínez-Aquino483, Óscar Martínez-González361, Iciar Martinez-Lopez484,485, Oscar Martinez- Nieto350,464, Pedro Martinez-Paz438, Angel Martinez-Perez486, Andrea Martínez-Ramas37,329, Michel F. Martinez-Resendez36, Violeta Martínez Robles314, Laura Marzal37,329, Juliana F. Mazzeu487,488,489, Jeane F.P. Medeiros342, Kelliane A. Medeiros490,491, Francisco J. Medrano375,376,377, Xose M. Meijome492,493, Natalia Mejuto-Montero494, Ana Méndez-Echevarria347, Humberto Mendoza Charris323,364, Eleuterio 90 Merayo Macías495, Fátima Mercadillo496, Arieh R. Mercado-Sesma353,448, Pablo Minguez37,329, Anto- nio J J. Molina376,478, Elena Molina-Roldán497, Juan José Montoya447, Vitor M.S. Moraes380, Pa- tricia Moreira-Escriche404, Xenia Morelos-Arnedo323,364, Antonio Moreno-Docón354, Junior Moreno- Escalante323, Victor Moreno Cuerda304,305, Alberto Moreno Fernández389, Rubén Morilla377,498, Patri- cia Muñoz García31,309,499, Pablo Neira430, Julian Nevado37,38,500, Israel Nieto-Gañán433, Joana F.R. Nunes344, Rocio Nuñez- Torres330, Antònia Obrador-Hevia501,502, J. Gonzalo Ocejo-Vinyals33,35, Vir- ginia Olivar430, Silviene F. Oliveira487,488,489,503,504, Lorena Ondo37,329, Alberto Orfao325,326,327,328, Luis Ortega505, Eva Ortega-Paino349, Fernando Ortiz-Flores33,35, Rocio Ortiz-Lopez36,506, José A. Oteo315,457, Harry Pachajoa507,508, Manuel Pacheco447, Fredy Javier Pacheco-Miranda323, Irene Padilla Conejo314, Sonia Panadero-Fajardo381, Mara Parellada309,333,339, Roberto Pariente-Rodríguez433, Es- tela Paz-Artal462,463,509, Germán Peces-Barba31,510, Miguel S. Pedromingo Kus511, Celia Perales429, Patricia Perez512, César Pérez513, Gustavo Perez-de-Nanclares335,385, Felipe Pérez-García514,515, Pa- tricia Pérez-Matute457, Alexandra Pérez-Serra366,368, M. Elena Pérez-Tomás354, Teresa Perucho516, Lisbeth A. Pichardo314, Susana M.T. Pinho490,517,518, Mel·lina Pinsach-Abuin366,368, Luz Adriana Pinzón341,390, Guillermo Pita330, Francesc Pla-Junca37,519, Laura Planas-Serra37,384, Ericka N. Pompa- Mera520, Gloria L. Porras-Hurtado447, Aurora Pujol37,384,521, María Eugenia Quevedo Chávez322,323, Maria Angeles Quijada334,522, Inés Quintela397, Diana Ramirez-Montaño523, Soraya Ramiro León435, Pedro Rascado Sedes449, Delia Recalde407,408, Emma Recio-Fernández457, Salvador Resino310,367, Adri- ana P. Ribeiro490,491,518, Carlos S. Rivadeneira-Chamorro341, Diana Roa-Agudelo350, Montserrat Ro- belo Pardo449, Marilyn Johanna Rodriguez341, Fernando Rodriguez-Artalejo376,405,406,467, Marena Rodríguez-Ferrer323, Carlos Rodriguez-Gallego32,524, José A. Rodriguez-Garcia314, María A. Rodriguez- Hernandez371, Antonio Rodriguez-Nicolas444, Agustí Rodriguez-Palmero384,525, Emilio Rodríguez- Ruiz45,449, Paula A. Rodriguez-Urrego350, Belén Rodríguez Maya304, German Ezequiel Rodriguez Novoa430, Federico Rojo328,526, Andrea Romero-Coronado323, Filomeno Rondón García314, Lidia S. Rosa527, Antonio Rosales-Castillo528, Cladelis Rubio529,530, María Rubio Olivera337,338, Montserrat Ruiz37,384, Francisco Ruiz-Cabello444,469,531, Eva Ruiz-Casares516, Juan J. Ruiz-Cubillan33,35, Javier Ruiz-Hornillos338,532,533, Pablo Ryan534,535,536, Hector D. Salamanca340,341, Lorena Salazar-García378, Giorgina Gabriela Salgueiro Origlia389, Pedro-Luis Sánchez332,416, Clara Sánchez-Pablo416, Olga Sánchez- Pernaute537, Antonio J. Sánchez López538, María Concepción Sánchez Prados321, Javier Sánchez Real314, Jorge Sánchez Redondo304,539, Cristina Sancho- Sainz456, Anna Sangil362, Arnoldo Santos513, Ney P.C. Santos420, Agatha Schlüter37,384, Sonia Segovia519,540,541, Alex Serra-Llovich400, Fernando Sevil Puras311, Marta Sevilla Porras37,38, Miguel A. Sicolo542,543, Vivian N. Silbiger475, Nayara S. Silva403, Fabi- ola T.C. Silva344, Cristina Silván Fuentes37, Jordi Solé-Violán31,544,545, José Manuel Soria486, Jose V. Sorlí393,394, Renata R. Sousa487, Juan Carlos Souto306, Karla S.C. Souza382, Vanessa S. Souza399, John J. Sprockel341,390, José Javier Suárez-Rama397, David A. Suarez-Zamora350, Xiana Taboada-Fraga494, Eduardo Tamayo439,546, Alvaro Tamayo-Velasco547, Juan Carlos Taracido-Fernandez452, Nathali A.C. Tavares548, Carlos Tellería407,408, Jair Antonio Tenorio Castaño37,38,500, Alejandro Teper430, Juan Torres- Macho549, Lilian Torres-Tobar341, Ronald P. Torres Gutiérrez511, Jesús Troya534, Miguel Urioste496, Juan Valencia-Ramos550, Agustín Valido324,551, Juan Pablo Vargas Gallo552,553, Belén Varón554, Romero H.T. Vasconcelos548, Tomas Vega555, Santiago Velasco-Quirce556, Valentina Vélez-Santamaría383,384, Vir- ginia Víctor337,338, Julia Vidán Estévez314, Miriam Vieitez-Santiago33,35, Carlos Vilches557, Lavinia Villalobos314, Felipe Villar510, Judit Villar-Garcia558,559,560, Cristina Villaverde37,329, Pablo Villoslada- Blanco457, Ana Virseda-Berdices367, Zuleima Yáñez323, Antonio Zapatero-Gaviria561, Ruth Zarate562, Sandra Zazo526, Miguel López de Heredia37, Ingrid Mendes37, Rocío Moreno37, Esther Sande37,44,45, Car- los Flores29,30,31,32, José A. Riancho33,34,35, Augusto Rojas-Martinez36, Pablo Lapunzina37,38,500, Angel Carracedo37,44,45,46,397. 304 Hospital Universitario Mostoles, Medicina Interna, Madrid, Spain 305 Universidad Francisco de Vitoria, Madrid, Spain 306 Haemostasis and Thrombosis Unit, Hospital de la Santa Creu i Sant Pau, IIB Sant Pau, Barcelona, Spain 307 Unit of Infectious Diseases, Hospital Universitario 12 de Octubre, Instituto de Investigación Sanitaria Hospital 12 de Octubre (imas12), Madrid, Spain 308 Spanish Network for Research in Infectious Diseases (REIPI RD16/0016/0002), Instituto de Salud Carlos III, Madrid, Spain 309 School of Medicine, Universidad Complutense, Madrid, Spain 310 Centro de Investigación Biomédica en Red de Enfermedades Infecciosas (CIBERINFEC), Instituto de Salud Carlos III, Madrid, Spain 311 Hospital General Santa Bárbara de Soria, Soria, Spain 312 Pediatric Neurology Unit, Department of Pediatrics, Navarra Health Service Hospital, Pamplona, Spain 313 Navarra Health Service, NavarraBioMed Research Group, Pamplona, Spain 314 Complejo Asistencial Universitario de León, León, Spain 315 Hospital Universitario San Pedro, Infectious Diseases Department, Logroño, Spain 316 Fundación Institut Guttmann, Institut Universitari de Neurorehabilitació adscrit a la UAB, Hospital de Neurorehabilitació, Barcelona, Spain 317 Universitat Autònoma de Barcelona (UAB), Barcelona, Spain 318 Fundació Institut d’Investigació en Ciències de la Salut Germans Trias i Pujol, Barcelona, Spain 319 Hospital General de Occidente, Guadalajara, Mexico 320 Microbiology Unit, Hospital Universitario N. S. de Candelaria, Santa Cruz de Tenerife, Spain 321 Hospital Universitario La Paz-IDIPAZ, Servicio de Neumología, Madrid, Spain 322 Camino Universitario Adelita de Char, Mired IPS, Barranquilla, Colombia 91 323 Universidad Simón Bolívar, Facultad de Ciencias de la Salud, Barranquilla, Colombia 324 Hospital Universitario Virgen Macarena, Neumología, Seville, Spain 325 Departamento de Medicina, Universidad de Salamanca, Salamanca, Spain 326 Centro de Investigación del Cáncer (IBMCC) Universidad de Salamanca - CSIC, Salamanca, Spain 327 Biomedical Research Institute of Salamanca (IBSAL) Salamanca, Spain 328 Centre for Biomedical Network Research on Cancer (CIBERONC), Instituto de Salud Carlos III, Madrid, Spain 329 Department of Genetics & Genomics, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Uni- versidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 330 Spanish National Cancer Research Centre, Human Genotyping-CEGEN Unit, Madrid, Spain 331 Hospital Universitario de Salamanca-IBSAL, Servicio de Medicina Interna, Salamanca, Spain 332 Universidad de Salamanca, Salamanca, Spain 333 Department of Child and Adolescent Psychiatry, Institute of Psychiatry and Mental Health, Hospital General Universitario Gregorio Marañón (IiSGM), Madrid, Spain 334 Clinical Pharmacology Service, Hospital de la Santa Creu i Sant Pau, IIB Sant Pau, Barcelona, Spain 335 Biocruces Bizkai HRI, Barakaldo, Bizkaia, Spain 336 Cruces University Hospital, Osakidetza, Barakaldo, Bizkaia, Spain 337 Hospital Infanta Elena, Valdemoro, Madrid, Spain 338 Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 339 Centre for Biomedical Network Research on Mental Health (CIBERSAM), Instituto de Salud Carlos III, Madrid, Spain 340 Fundación Hospital Infantil Universitario de San José, Bogotá, Colombia 341 Fundación Universitaria de Ciencias de la Salud, Bogotá, Colombia 342 Universidade Federal do Rio Grande do Norte, Programa de Pós-graduação em Ciências da Saúde, Natal, Brazil 343 Universidade Federal do Rio Grande do Norte, Departamento de Medicina Clínica, Natal, Brazil 344 Departamento de Genética e Morfologia, Instituto de Ciências Biológicas, Universidade de Brasília, Brasilia, Brazil 345 Colégio Marista de Brasilia, Brazil 346 Associação Brasileira de Educação e Cultura, Brazil 347 Hospital Universitario La Paz-IDIPAZ, Servicio de Medicina Interna, Madrid, Spain 348 Fundació Docència I Recerca Mutua Terrassa, Barcelona, Spain 349 Spanish National Cancer Research Center, CNIO Biobank, Madrid, Spain 350 Fundación Santa Fe de Bogota, Departamento Patologia y Laboratorios, Bogotá, Colombia 351 Hospital General de Occidente, Zapopan, Jalisco, Mexico 352 Centro Universitario de Tonalá, Universidad de Guadalajara, Tonalá, Jalisco, Mexico 353 Centro de Investigación Multidisciplinario en Salud, Universidad de Guadalajara, Guadalajara, Mexico 354 Instituto Murciano de Investigación Biosanitaria (IMIB-Arrixaca), Murcia, Spain 355 Universidad Católica San Antonio de Murcia (UCAM), Murcia, Spain 356 Hospital Universitario de Salamanca-IBSAL, Servicio de Medicina Interna-Unidad de Enfermedades Infecciosas, Salamanca, Spain 357 Hospital Universitario de Fuenlabrada, Department of Internal Medicine, Madrid, Spain 358 Escola Tecnica de Saúde, Laboratorio de Vigilancia Molecular Aplicada, Pará, Brazil 359 Federal University of Pernambuco, Genetics Postgraduate Program, Recife, PE, Brazil 360 Hospital Universitario Infanta Leonor, Servicio de Alergia, Madrid, Spain 361 Hospital Universitario del Tajo, Servicio de Medicina Intensiva, Toledo, Spain 362 Hospital Universitario Mutua Terrassa, Barcelona, Spain 363 Hospital Universitario La Paz-IDIPAZ, Servicio de Farmacología, Madrid, Spain 364 Alcaldía de Barranquilla, Secretaría de Salud, Barranquilla, Colombia 365 Instituto de Investigación Sanitaria de Santiago (IDIS), Xenética Cardiovascular, Santiago de Compostela, Spain 366 Centre for Biomedical Network Research on Cardiovascular Diseases (CIBERCV), Instituto de Salud Carlos III, Madrid, Spain 367 Unidad de Infección Viral e Inmunidad, Centro Nacional de Microbiología (CNM), Instituto de Salud Carlos III (ISCIII), Madrid, Spain 368 Cardiovascular Genetics Center, Institut d’Investigació Biomèdica Girona (IDIBGI), Girona, Spain 369 Medical Science Department, School of Medicine, University of Girona, Girona, Spain 370 Hospital Josep Trueta, Cardiology Service, Girona, Spain 371 Institute of Biomedicine of Seville (IBiS), Consejo Superior de Investigaciones Científicas (CSIC)- University of Seville- Virgen del Rocio University Hospital, Seville, Spain 372 Division of Infectious Diseases, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 373 Intensive Care Unit, Hospital Universitario Insular de Gran Canaria, Las Palmas de Gran Canaria, Spain 374 Hospital Universitario Mutua Terrassa, Terrassa, Spain 375 Departemento de Medicina, Hospital Universitario Virgen del Rocío,Universidad de Sevilla, Seville, Spain 376 Centre for Biomedical Network Research on Epidemiology and Public Health (CIBERESP), Instituto de Salud Carlos III, Madrid, Spain 377 Instituto de Biomedicina de Sevilla, Seville, Spain 378 Universidad de los Andes, Facultad de Ciencias, Bogotá, Colombia 379 University of Fortaleza (UNIFOR), Department of Nutrition. Fortaleza, Brazil 380 Departamento de Química, Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo, Brazil 381 Andalusian Public Health System Biobank, Granada, Spain 382 Universidade Federal do Rio Grande do Norte, Programa de Pós-Graduação em Ciências Farmacêuticas, Natal, Brazil 383 Neuromuscular Unit, Neurology Department, Hospital Universitari de Bellvitge, L’Hospitalet de Llobregat (Barcelona), Spain 384 Bellvitge Biomedical Research Institute (IDIBELL), Neurometabolic Diseases Laboratory, L’Hospitalet de Llobregat, Spain 385 Osakidetza, Cruces University Hospital, Barakaldo, Bizkaia, Spain 386 Centre for Biomedical Network Research on Diabetes and Metabolic Associated Diseases (CIBERDEM), Instituto de Salud Carlos III, Madrid, Spain 387 University of Pais Vasco, UPV/EHU, Bizkaia, Spain 388 Oncology and Genetics Unit, Instituto de Investigacion Sanitaria Galicia Sur, Xerencia de Xestion Integrada de Vigo-Servizo Galego de Saúde, Vigo, Spain 389 Hospital Universitario La Paz, Hospital Carlos III, Madrid, Spain 390 Hospital de San José, Sociedad de Cirugía de Bogota, Bogotá, Colombia 391 Hospital Universitario Río Hortega, Valladolid, Spain 392 Servicio de Medicina intensiva, Complejo Hospitalario Universitario de A Coruña (CHUAC), Sistema Galego de Saúde (SER- GAS), A Coruña, Spain 393 Valencia University, Preventive Medicine Department, Valencia, Spain 394 Centre for Biomedical Network Research on Physiopatology of Obesity and Nutrition (CIBEROBN), Instituto de Salud Carlos III, Madrid, Spain 395 Otto von Guericke University, Departament of Microgravity and Translational Regenerative Medicine, Magdeburg, Germany 396 Maternidade Escola Janário Cicco, Natal, Brazil 397 Centro Nacional de Genotipado (CEGEN), Universidade de Santiago de Compostela, Santiago de Compostela, Spain 398 Institute of Psychiatry and Mental Health, Hospital General Universitario Gregorio Marañón (IiSGM), Madrid, Spain 399 Programa de Pós Graduação em Ciências da Saúde, Faculdade de Medicina, Universidade de Brasília, Brasilia, Brazil 400 Fundació Docència I Recerca Mutua Terrassa, Terrassa, Spain 401 Hospital Universitario Mostoles, Unidad de Genética, Madrid, Spain 402 Internal Medicine Department, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad 92 Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 403 Universidade Federal do Rio Grande do Norte, Pós-graduação em Biotecnologia - Rede de Biotecnologia do Nordeste (Renorbio), Natal, Brazil 404 Hospital Universitario Severo Ochoa, Servicio de Medicina Interna, Madrid, Spain 405 Department of Preventive Medicine and Public Health, School of Medicine, Universidad Autónoma de Madrid, Madrid, Spain 406 IdiPaz (Instituto de Investigación Sanitaria Hospital Universitario La Paz), Madrid, Spain 407 Instituto Aragonés de Ciencias de la Salud (IACS), Zaragoza, Spain 408 Instituto Investigación Sanitaria Aragón (IIS-Aragon), Zaragoza, Spain 409 Universidade Federal do Rio Grande do Norte, Programa de Pós Graduação em Nutrição, Natal, Brazil 410 Preventive Medicine Department, Instituto de Investigacion Sanitaria Galicia Sur, Xerencia de Xestion Integrada de Vigo- Servizo Galego de Saúde, Vigo, Spain 411 Hospital Universitario Virgen del Rocío, Servicio de Medicina Interna, Seville, Spain 412 Universidade Federal do Rio Grande do Norte, Departamento de Infectologia, Natal, Brazil 413 Hospital de Doenças Infecciosas Giselda Trigueiro, Rio Grande do Norte, Natal, Brazil 414 Unidad Diagnóstico Molecular. Fundación Rioja Salud, La Rioja, Spain 415 Hospital Universitario Quironsalud Madrid, Madrid, Spain 416 Hospital Universitario de Salamanca-IBSAL, Servicio de Cardiología, Salamanca, Spain 417 Hospital Universitario Puerta de Hierro, Servicio de Medicina Interna, Majadahonda, Spain 418 Biocruces Bizkaia Health Research Institute, Galdakao University Hospital, Osakidetza, Bizkaia, Spain 419 Instituto Regional de Investigación en Salud-Universidad Nacional de Caaguazú, Caaguazú, Paraguay 420 Universidade Federal do Pará, Núcleo de Pesquisas em Oncologia, Belém, Pará, Brazil 421 Hospital Ophir Loyola, Departamento de Ensino e Pesquisa, Belém, Pará, Brazil 422 Fundación Asilo San Jose, Santander, Spain 423 Unidad de Enfermedades Infecciosas, Servicio de Medicina Interna, Hospital Universitario Puerta de Hierro, Instituto de Inves- tigación Sanitaria Puerta de Hierro - Segovia de Arana, Madrid, Spain 424 Universidad Nacional de Asunción, Facultad de Politécnica, Paraguay 425 Urgencias Hospitalarias, Complejo Hospitalario Universitario de A Coruña (CHUAC), Sistema Galego de Saúde (SERGAS), A Coruña, Spain 426 Grupo de Investigación en Interacciones Gen-Ambiente y Salud (GIIGAS) - Instituto de Biomedicina (IBIOMED), Universidad de León, León, Spain 427 Hospital Universitario Niño Jesús, Pediatrics Department, Madrid, Spain 428 Unitat de Malalties Infeccioses i Importades, Servei de Pediatría, Infectious and Imported Diseases, Pediatric Unit, Hospital Universitari Sant Joan de Deú, Barcelona, Spain 429 Microbiology Department, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 430 Hospital de Niños Ricardo Gutierrez, Buenos Aires, Argentina 431 Centre for Biomedical Network Research on Rare Diseases (CIBERER), Instituto de Salud Carlos III, Madrid, Spain Universidad Francisco de Vitoria, Madrid,Spain 432 University of Salamanca, Biomedical Research Institute of Salamanca (IBSAL), Salamanca, Spain 433 Department of Immunology, IRYCIS, Hospital Universitario Ramón y Cajal, Madrid, Spain 434 Hospital Infanta Elena, Servicio de Medicina Intensiva, Valdemoro, Madrid, Spain 435 Hospital Universitario de Getafe, Servicio de Genética, Madrid, Spain 436 Pneumology Department, Hospital General Universitario Gregorio Marañón (iiSGM), Madrid, Spain 437 Ministerio de Salud Ciudad de Buenos Aires, Buenos Aires, Argentina 438 Hospital Clinico Universitario de Valladolid, Unidad de Apoyo a la Investigación, Valladolid, Spain 439 Universidad de Valladolid, Departamento de Cirugía, Valladolid, Spain 440 Secretaria Municipal de Saude de Apodi, Natal, Brazil 441 Sección Genética Médica - Servicio de Pediatría, Hospital Clínico Universitario Virgen de la Arrixaca, Servicio Murciano de Salud, Murcia, Spain 442 Departamento Cirugía, Pediatría, Obstetricia y Ginecología, Facultad de Medicina, Universidad de Murcia (UMU), Murcia, Spain 443 Grupo Clínico Vinculado, Centre for Biomedical Network Research on Rare Diseases (CIBERER), Instituto de Salud Carlos III, Madrid, Spain 444 Hospital Universitario Virgen de las Nieves, Servicio de Análisis Clínicos e Inmunología, Granada, Spain 445 Hospital Universitario Centro Dermatológico Federico Lleras Acosta, Bogotá, Colombia 446 Intermediate Respiratory Care Unit, Department of Pneumology, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 447 Clinica Comfamiliar Risaralda, Pereira, Colombia 448 Centro Universitario de Tonalá, Universidad de Guadalajara, Guadalajara, Mexico 449 Unidad de Cuidados Intensivos, Hospital Clínico Universitario de Santiago (CHUS), Sistema Galego de Saúde (SERGAS), Santiago de Compostela, Spain 450 IIS La Fe, Plataforma de Farmacogenética, Valencia, Spain 451 Universidad de Valencia, Departamento de Farmacología, Valencia, Spain 452 Data Analysis Department, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 453 Hospital del Mar, Infectious Diseases Service, Barcelona, Spain 454 Institut Hospital del Mar d’Investigacions Mèdiques (IMIM), Barcelona, Spain 455 CEXS-Universitat Pompeu Fabra, Spanish Network for Research in Infectious Diseases (REIPI), Barcelona, Spain 456 Biocruces Bizkaia Health Research Institute, Basurto University Hospital, Osakidetza, Bizkaia, Spain 457 Infectious Diseases, Microbiota and Metabolism Unit, Center for Biomedical Research of La Rioja (CIBIR), Logroño, Spain 458 Sabin Medicina Diagnóstica, Brazil 459 Opthalmology Department, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 460 Hospital Sant Joan de Deu,Pediatric Critical Care Unit, Barcelona, Spain 461 Paediatric Intensive Care Unit, Agrupación Hospitalaria Clínic-Sant Joan de Déu, Esplugues de Llobregat, Barcelona, Spain 462 Hospital Universitario 12 de Octubre, Department of Immunology, Madrid, Spain 463 Instituto de Investigación Sanitaria Hospital 12 de Octubre (imas12), Transplant Immunology and Immunodeficiencies Group, Madrid, Spain 464 SIGEN Alianza Universidad de los Andes - Fundación Santa Fe de Bogotá, Bogotá, Colombia 465 Hospital General de Segovia, Medicina Intensiva, Segovia, Spain 466 Clinical Trials Unit, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 467 IMDEA-Food Institute, CEI UAM+CSIC, Madrid, Spain 468 Hospital Universitario Virgen de las Nieves, Servicio de Enfermedades Infecciosas, Granada, Spain 469 Instituto de Investigación Biosanitaria de Granada (ibs GRANADA), Granada, Spain 470 Universidad de Granada, Departamento de Medicina, Granada, Spain 471 Hospital Universitario La Paz-IDIPAZ, Servicio de Inmunología, Madrid, Spain 472 La Paz Institute for Health Research (IdiPAZ), Lymphocyte Pathophysiology in Immunodeficiencies Group, Madrid, Spain 473 Intensive Care Unit, Hospital Universitario de Canarias, La Laguna, Spain 474 Dirección General de Salud Pública, Consejería de Sanidad, Junta de Castilla y León, Valladolid, Spain 475 Universidade Federal do Rio Grande do Norte, Departamento de Analises Clinicas e Toxicologicas, Natal, Brazil 93 476 Fundación Jiménez Díaz, Epidemiology, Madrid, Spain 477 Universidad Autónoma de Madrid, Department of Medicine, Madrid, Spain 478 Instituto de Biomedicina (IBIOMED), Universidad de León, León, Spain 479 Intensive Care Unit, Hospital Universitario N. S. de Candelaria, Santa Cruz de Tenerife, Spain 480 Preventive Medicine Department, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universi- dad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 481 Universidad de Valladolid, Departamento de Medicina, Valladolid, Spain 482 Hospital Universitario Infanta Leonor, Servicio de Medicina Intensiva, Madrid, Spain 483 Servicio de Medicina Interna, Sanatorio Franchin, Buenos Aires, Argentina 484 Unidad de Genética y Genómica Islas Baleares, Islas Baleares, Spain 485 Hospital Universitario Son Espases, Unidad de Diagnóstico Molecular y Genética Clínica, Islas Baleares, Spain 486 Genomics of Complex Diseases Unit, Research Institute of Hospital de la Santa Creu i Sant Pau, IIB Sant Pau, Barcelona, Spain 487 Faculdade de Medicina, Universidade de Brasília, Brasilia, Brazil 488 Programa de Pós-Graduação em Ciências Médicas, Universidade de Brasília, Brasilia, Brazil 489 Programa de Pós-Graduação em Ciências da Saúde, Universidade de Brasília, Brasilia, Brazil 490 Hospital das Forças Armadas, Brazil 491 Exército Brasileiro, Brazil 492 Hospital El Bierzo, Gerencia de Asistencia Sanitaria del Bierzo (GASBI), Gerencia Regional de Salud (SACYL), Ponferrada, Spain 493 Grupo INVESTEN, Instituto de Salud Carlos III, Madrid, Spain 494 Unidad de Cuidados Intensivos, Complejo Universitario de A Coruña (CHUAC), Sistema Galego de Saúde (SERGAS), A Coruña, Spain 495 Hospital El Bierzo, Unidad Cuidados Intensivos, León, Spain 496 Spanish National Cancer Research Centre, Familial Cancer Clinical Unit, Madrid, Spain 497 Instituto de Investigación Sanitaria San Carlos (IdISSC), Hospital Clínico San Carlos (HCSC), Madrid, Spain 498 Universidad de Sevilla, Departamento de Enfermería, Seville, Spain 499 Hospital General Universitario Gregorio Marañón (IiSGM), Madrid, Spain 500 ERN-ITHACA-European Reference Network 501 Unidad de Genética y Genómica Islas Baleares, Unidad de Diagnóstico Molecular y Genética Clínica, Hospital Universitario Son Espases, Islas Baleares, Spain 502 Instituto de Investigación Sanitaria Islas Baleares (IdISBa), Islas Baleares, Spain 503 Programa de Pós-Graduação em Biologia Animal, Universidade de Brasília, Brasília, Brazil 504 Programa de Pós-Graduação Profissional em Ensino de Biologia, Universidade de Brasília, Brasília, Brazil 505 Anatomía Patológica, Instituto de Investigación Sanitaria San Carlos (IdISSC), Hospital Clínico San Carlos (HCSC), Madrid, Spain 506 Tecnológico de Monterrey, Monterrey, Mexico 507 Centro de Investigación en Anomalías Congénitas y Enfermedades Raras (CIACER), Universidad Icesi 508 Departamento de Genetica, Fundación Valle del Lili 509 Universidad Complutense de Madrid, Department of Immunology, Ophthalmology and ENT, Madrid, Spain 510 Department of Neumology, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 511 Hospital Nuestra Señora de Sonsoles, Ávila, Spain 512 Inditex, A Coruña, Spain 513 Intensive Care Department, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 514 Hospital Universitario Príncipe de Asturias, Servicio de Microbiología Clínica, Madrid, Spain 515 Universidad de Alcalá de Henares, Departamento de Biomedicina y Biotecnología, Facultad de Medicina y Ciencias de la Salud, Madrid, Spain 516 GENYCA, Madrid, Spain 517 Marinha do Brasil, Brazil 518 Universidade de Brasília, Brasilia, Brazil 519 Neuromuscular Diseases Unit, Department of Neurology, Hospital de la Santa Creu i Sant Pau, Universitat Autònoma de Barcelona, Barcelona, Spain 520 Instituto Mexicano del Seguro Social (IMSS), Centro Médico Nacional Siglo XXI, Unidad de Investigación Médica en Enfer- medades Infecciosas y Parasitarias, Mexico City, Mexico 521 Catalan Institution of Research and Advanced Studies (ICREA), Barcelona, Spain 522 Drug Research Centre, Institut d’Investigació Biomèdica Sant Pau, IIB-Sant Pau, Barcelona, Spain 523 Departamento de Genetica, Clinica imbanaco 524 Department of Immunology, Hospital Universitario de Gran Canaria Dr. Negrín, Las Palmas de Gran Canaria, Spain 525 University Hospital Germans Trias i Pujol, Pediatrics Department, Badalona, Spain 526 Department of Pathology, Biobank, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Univer- sidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 527 Faculdade de Ciências da Saúde, Universidade de Brasília, Brasilia, Brazil 528 Hospital Universitario Virgen de las Nieves, Servicio de Medicina Interna, Granada, Spain 529 Fundación Universitaria de Ciencias de la Salud, Grupo de Ciencias Básicas en Salud (CBS), Bogotá, Colombia 530 Sociedad de Cirugía de Bogotá, Hospital de San José, Bogotá, Colombia 531 Universidad de Granada, Departamento Bioquímica, Biología Molecular e Inmunología III, Granada, Spain 532 Hospital Infanta Elena, Allergy Unit, Valdemoro, Madrid, Spain 533 Faculty of Medicine, Universidad Francisco de Vitoria, Madrid, Spain 534 Hospital Universitario Infanta Leonor, Madrid, Spain 535 Complutense University of Madrid, Madrid, Spain 536 Gregorio Marañón Health Research Institute (IiSGM), Madrid, Spain 537 Reumathology Service, Instituto de Investigación Sanitaria-Fundación Jiménez Díaz University Hospital - Universidad Autónoma de Madrid (IIS-FJD, UAM), Madrid, Spain 538 Biobank, Puerta de Hierro-Segovia de Arana Health Research Institute, Madrid, Spain 539 Universidad Rey Juan Carlos, Madrid, Spain 540 The John Walton Muscular Dystrophy Research Centre, Newcastle University and Newcastle Hospitals NHS Foundation Trust, Newcastle upon Tyne, UK 541 Neuromuscular Unit, Neuropediatrics Department, Institut de Recerca Sant Joan de Déu, Hospital Sant Joan de Déu, Spain 542 Casa de Saúde São Lucas, Natal, Brazil 543 Hospital Rio Grande, Rio Grande do Norte, Natal, Brazil 544 Intensive Care Unit, Hospital Universitario de Gran Canaria Dr. Negrín, Las Palmas de Gran Canaria, Spain 545 Universidad Fernando Pessoa Canarias, Las Palmas de Gran Canaria, Spain 546 Hospital Clinico Universitario de Valladolid, Servicio de Anestesiologia y Reanimación, Valladolid, Spain 547 Hospital Clinico Universitario de Valladolid, Servicio de Hematologia y Hemoterapia, Valladolid, Spain 548 Hospital Universitario Lauro Wanderley, Brazil 549 Hospital Universitario Infanta Leonor, Servicio de Medicina Interna, Madrid, Spain 550 University Hospital of Burgos, Burgos, Spain 551 Universidad de Sevilla, Seville, Spain 552 Fundación Santa Fe de Bogota, Instituto de servicios medicos de Emergencia y trauma, Bogotá, Colombia 553 Universidad de los Andes, Bogotá, Colombia 94 554 Quironprevención, A Coruña, Spain 555 Junta de Castilla y León, Consejería de Sanidad, Valladolid, Spain 556 Gerencia Atención Primaria de Burgos, Burgos, Spain 557 Immunogenetics-Histocompatibility group, Servicio de Inmunología, Instituto de Investigación Sanitaria Puerta de Hierro - Segovia de Arana, Madrid, Spain 558 Hospital del Mar, Department of Infectious Diseases, Barcelona, Spain 559 IMIM (Hospital del Mar Medical Research Institute, Institut Hospital del Mar d’Investigacions Mediques), Barcelona, Spain 560 Universitat Autònoma de Barcelona, Department of Medicine, Spain 561 Consejería de Sanidad, Comunidad de Madrid, Madrid, Spain 562 Centro para el Desarrollo de la Investigación Científica, Asunción, Paraguay 13.3 23andMe Investigators Janie F. Shelton1, Anjali J. Shastri1, Chelsea Ye1, Catherine H. Weldon1, Teresa Filshtein-Sonmez1, Daniella Coker1, Antony Symons1, Jorge Esparza-Gordillo2, Stella Aslibekyan1, Adam Auton1 *These authors contributed equally to this work. 1. 23andMe Inc., 223 N Mathilda Ave, Sunnyvale, CA 94086 2. Human genetics - R&D, GSK Medicines Research Centre, Target Sciences-R&D, Stevenage, UK 13.3.1 23andMe Contributors We thank the 23andMe research participants who made this study possible. We would also like to thank Altovise Ewing, Aaron Petrakovitz, Anne Park, Anne Silk, Aushawna Collins, Becky Macintosh, Carolyn Kao, Courtney Ball, Christine Pai, David Hinds, Devyn Parry, Elo Ratcliff, Emily Bullis, Eric Hall, Farwa Alam, Jacquie Haggarty, Jess Christenson, Jim Lawrence, Jimmy Chau, Josie Shaw, Joe Cackler, Karl Heilbron, Katelyn Kukar, Katie Watson, Marianna Frendo, Olivia Valenti, Ryan Workman, Rachel Lopatin, Robert Bell, Rose Eckert, Sam Rodgers, Sarah Rys, Shawna Averbeck, Shirin Fuller, Vanessa Lane, and Yunxuan Jiang for contributions and insights. We also thank the 23andMe Research Team: Barry Hicks, Chao Tian, Devika Dhamija, Elizabeth Ba- balola, Elizabeth S. Noblin, Ethan M. Jewett, G. David Poznik, Gabriel Cuellar Partida, Jared O’Connell, Jingchunzi Shi, Joanna L. Mountain, Joyce Y. Tung, Katarzyna Bryc, Karen E. Huber, Keng-Han Lin, Kimberly F. McManus, Kipper Fletez-Brant, Marie K. Luff, Matthew H. McIntyre, Maya Lowe, Meghan E. Moreno, Peter Wilton, Pierre Fontanillas, Priyanka Nandakumar, Sahar V. Mozaffari, Sarah L. Elson, Sayantan Das, Steven J. Micheletti, Suyash Shringarpure, Vinh Tran, Wei Wang, Will Freyman, and Xin Wang. Members of the 23andMe COVID-19 Team are: Adam Auton, Adrian Chubb, Alison Fitch, Alison Kung, Amanda Altman, Andy Kill, Anjali Shastri, Catherine Weldon, Chelsea Ye, Daniella Coker, Janie Shelton, Jason Tan, Jeff Pollard, Jennifer McCreight, Jess Bielenberg, John Matthews, Johnny Lee, Lindsey Tran, Michelle Agee, Monica Royce, Nate Tang, Pooja Gandhi, Raffaello d’Amore, Ruth Tennen, Scott Dvorak, Scott Hadly, Stella Aslibekyan, Sungmin Park, Taylor Morrow, Teresa Filshtein Sonmez, Trung Le, and Yiwen Zheng. 13.4 ISARIC4C Investigators 13.4.1 Co-Investigators J Kenneth Baillie1,2,3,11, Peter JM Openshaw12,26, Malcolm G Semple16,17, Beatrice Alex245, Pet- ros Andrikopoulos246,247, Benjamin Bach245, Wendy S Barclay248, Debby Bogaert18, Meera Chand249, Kanta Chechi246,250, Graham S Cooke251, Ana da Silva Filipe252, Thushan de Silva253, Annemarie B Docherty11,254, Gonçalo dos Santos Correia255,256, Marc-Emmanuel Dumas246,247,257,258, Jake Dunning12,259, Tom Fletcher260, Christopher A Green261, William Greenhalf262, Julian Griffin246, Rishi K Gupta263, Ewen M Harrison254, Antonia YW Ho252,264, Karl Holden265, Peter W Horby21, Samreen Ijaz266, Say Khoo267, Paul Klenerman268,269, Andrew Law3, Matthew Lewis255,256, So- nia Liggi246, Wei Shen Lim270, Lynn Maslen255,256, Alexander J Mentzer271,272, Laura Merson273, Alison M Meynert2, Shona C Moore274, Mahdad Noursadeghi275, Michael Olanipekun246,247, An- thonia Osagie246,247, Massimo Palmarini252, Carlo Palmieri276,277, William A Paxton274,278, Geor- gios Pollakis274,278, Nicholas Price279,280, Andrew Rambaut281, David L Robertson252, Clark D Russell18, Vanessa Sancho-Shimizu282, Caroline Sands255,256, Janet T Scott252,283, Louise Sigfrid273, Tom Solomon16,284, Shiranee Sriskandan251,285, David Stuart8, Charlotte Summers19, Olivia V Swann286, Zoltan Takats246,287, Panteleimon Takis255,256, Richard S Tedder288,289,290, AA Roger Thompson291, Emma C Thomson252, Ryan S Thwaites12, Lance CW Turtle16,292, Maria Zambon259, Gail Carson273. 95 13.4.2 Data analysis team Thomas M Drake254, Cameron J Fairfield254, Stephen R Knight254, Kenneth A Mclean254, Derek Murphy254, Lisa Norman254, Riinu Pius254, Catherine A Shaw254. 13.4.3 Data architecture team Marie Connor293, Jo Dalton293, Carrol Gamble293, Michelle Girvan293, Sophie Halpin293, Janet Harrison293, Clare Jackson293, Laura Marsh293, Stephanie Roberts293, Egle Saviciute293, Sara Clohisey3, Ross Hendry3, Susan Knight295, Eva Lahnsteiner295, Andrew Law3, Gary Leeming296, Lucy Norris297, James Scott-Brown245, Sarah Tait295, Murray Wham2. 13.4.4 Data analysis and management team James Lee294, Daniel Plotkin294, Seán Keating11. 13.4.5 Project administration team Cara Donegan301, Rebecca G Spencer301. 13.4.6 Project management team Chloe Donohue293, Fiona Griffiths3, Hayley Hardwick16, Wilna Oosthuyzen3. 245 School of Informatics, University of Edinburgh, Edinburgh, UK 246 Section of Biomolecular Medicine, Division of Systems Medicine, Department of Metabolism, Digestion and Reproduction, Sir Alexander Fleming Building, Exhibition Rd, London SW7 2AZ, UK 247 Section of Genomic and Environmental Medicine, Respiratory Division, National Heart and Lung Institute, Guy Scadding building, Dovehouse St, London SW3 3LY, UK 248 Section of Molecular Virology, Imperial College London, London, UK 249 Antimicrobial Resistance and Hospital Acquired Infection Department, Public Health England, London, UK 250 Department of Epidemiology and Biostatistics, School of Public Health, Faculty of Medicine, Imperial College London, 2 Norfolk St, W2 1PG, UK 251 Department of Infectious Disease, Imperial College London, London, UK 252 MRC-University of Glasgow Centre for Virus Research, 464 Bearsden Road, Glasgow, UK 253 The Florey Institute for Host-Pathogen Interactions, Department of Infection, Immunity and Cardiovascular Disease, University of Sheffield, Sheffield, UK 254 Centre for Medical Informatics, The Usher Institute, University of Edinburgh, Edinburgh, UK 255 National Phenome Centre, Department of Metabolism, Digestion and Reproduction, Imperial College London, London W12 0NN, United Kingdom 256 Section of Bioanalytical Chemistry, Department of Metabolism, Digestion and Reproduction, Imperial College London, London SW7 2AZ, United Kingdom 257 European Genomic Institute for Diabetes, CNRS UMR 8199, INSERM UMR 1283, Institut Pasteur de Lille, Lille University Hospital, University of Lille, 59045 Lille, France 258 McGill University and Genome Quebec Innovation Centre, 740 Doctor Penfield Avenue, Montréal, QC, H3A 0G1, Canada 259 National Infection Service, Public Health England, London, UK 260 Liverpool School of Tropical Medicine, Liverpool, UK 261 Institute of Microbiology and Infection, University of Birmingham, Birmingham, UK 262 Department of Molecular and Clinical Cancer Medicine, University of Liverpool, Liverpool, UK 263 Institute for Global Health, University College London, London, UK 264 Department of Infectious Diseases, Queen Elizabeth University Hospital, Glasgow, UK 265 University of Liverpool 266 Virology Reference Department, National Infection Service, Public Health England, Colindale Avenue, London, United Kingdom 267 Department of Pharmacology, University of Liverpool, Liverpool, UK 268 Nuffield Department of Medicine, Peter Medawar Building for Pathogen Research, University of Oxford, UK 269 Translational Gastroenterology Unit, Nuffield Department of Medicine, University of Oxford, UK 270 Nottingham University Hospitals NHS Trust: Nottingham 271 Nuffield Department of Medicine, John Radcliffe Hospital, Oxford, United Kingdom 272 Department of Microbiology/Infectious Diseases, Oxford University Hospitals NHS Foundation Trust, John Radcliffe Hospital, Oxford, United Kingdom 273 ISARIC Global Support Centre, Centre for Tropical Medicine and Global Health, Nuffield Department of Medicine, University of Oxford, Oxford, UK 274 Institute of Infection, Veterinary and Ecological Sciences, University of Liverpool, Liverpool, UK 275 Division of Infection and Immunity, University College London, UK 276 Molecular and Clinical Cancer Medicine, Institute of Systems, Molecular and Integrative Biology, University of Liverpool 277 Clatterbridge Cancer Centre NHS Foundation Trust, Liverpool, L7 8YA 278 NIHR Health Protection Research Unit in Emerging and Zoonotic Infections, Liverpool, UK 279 Centre for Clinical Infection and Diagnostics Research, Department of Infectious Diseases, School of Immunology and Microbial Sciences, King’s College London, London, UK 280 Department of Infectious Diseases, Guy’s and St Thomas’ NHS Foundation Trust, London, UK 281 Institute of Evolutionary Biology, University of Edinburgh, Edinburgh, UK 282 Department of Pediatrics and Virology, St Mary’s Medical School Bldg, Imperial College London, London, UK 283 NHS Greater Glasgow & Clyde, Glasgow, UK 284 Walton Centre NHS Foundation Trust, Liverpool, UK 285 MRC Centre for Molecular Bacteriology and Infection, Imperial College London, London, 286 Department of Child Life and Health, University of Edinburgh, Edinburgh, UK 287 National Phenome Centre, Division of Systems Medicine, Department of Metabolism, Digestion and Reproduction, Imperial College London, London W12 0NN, UK 288 Blood Borne Virus Unit, Virus Reference Department, National Infection Service, Public Health England, London, UK 289 Transfusion Microbiology, National Health Service Blood and Transplant, London, UK 290 Department of Medicine, Imperial College London, London, UK 291 Department of Infection, Immunity and Cardiovascular Disease, University of Sheffield, Sheffield, UK 292 Tropical & Infectious Disease Unit, Royal Liverpool University Hospital, Liverpool, UK 293 Liverpool Clinical Trials Centre, University of Liverpool, Liverpool, UK 96 294 ISARIC, Global Support Centre, COVID-19 Clinical Research Resources, Epidemic diseases Research Group, Oxford (ERGO), University of Oxford 295 Public Health Scotland 296 Centre for Health Informatics, Division of Informatics, Imaging and Data Science, School of Health Sciences, Faculty of Biology, Medicine and Health, University of Manchester, Manchester Academic Health Science Centre, Manchester, UK 297 EPCC, University of Edinburgh, Edinburgh, UK 301 Institute of Infection, Veterinary and Ecological Sciences, Faculty of Health and Life Sciences, University of Liverpool, Liverpool, UK 13.4.6.1 Local Principal Investigators Kayode Adeniji, Daniel Agranoff, Ken Agwuh, Dhiraj Ail, Erin L. Aldera, Ana Alegria, Sam Allen, Brian Angus, Abdul Ashish, Dougal Atkinson, Shahedal Bari, Gavin Barlow, Stella Barnass, Nicholas Barrett, Christopher Bassford, Sneha Basude, David Baxter, Michael Beadsworth, Jolanta Bernatoniene, John Berridge, Colin Berry, Nicola Best, Pieter Bothma, Robin Brittain-Long, Naomi Bulteel, Tom Burden, Andrew Burtenshaw, Vikki Caruth, David Chadwick, David Chadwick, Duncan Chambler, Nigel Chee, Jenny Child, Srikanth Chukkambotla, Tom Clark, Paul Collini, Catherine Cosgrove, Jason Cupitt, Maria-Teresa Cutino-Moguel, Paul Dark, Chris Dawson, Samir Dervisevic, Phil Donnison, Sam Douthwaite, Andrew Drummond, Ingrid DuRand, Ahilanadan Dushianthan, Tristan Dyer, Cariad Evans, Chi Eziefula, Chrisopher Fegan, Adam Finn, Duncan Fuller- ton, Sanjeev Garg, Sanjeev Garg, Atul Garg, Effrossyni Gkrania-Klotsas, Jo Godden, Arthur Goldsmith, Clive Graham, Tassos Grammatikopoulos69,70, Elaine Hardy, Stuart Hartshorn, Daniel Harvey, Peter Havalda, Daniel B Hawcutt, Maria Hobrok, Luke Hodgson, Anil Hormis, Joanne Howard, Michael Ja- cobs, Susan Jain, Paul Jennings, Agilan Kaliappan, Vidya Kasipandian, Stephen Kegg, Michael Kelsey, Jason Kendall, Caroline Kerrison, Ian Kerslake, Oliver Koch, Gouri Koduri, George Koshy, Shondipon Laha, Steven Laird, Susan Larkin, Tamas Leiner, Patrick Lillie, James Limb, Vanessa Linnett, Jeff Lit- tle, Mark Lyttle, Michael MacMahon, Emily MacNaughton, Ravish Mankregod, Huw Masson, Elijah Matovu, Katherine McCullough, Ruth McEwen, Manjula Meda, Gary Mills, Jane Minton, Kavya Mo- handas, Quen Mok, James Moon, Elinoor Moore, Patrick Morgan, Craig Morris, Katherine Mortimore, Samuel Moses, Mbiye Mpenge, Rohinton Mulla, Michael Murphy, Thapas Nagarajan, Megan Nagel, Mark Nelson, Lillian Norris, Matthew K. O’Shea, Marlies Ostermann, Igor Otahal, Mark Pais, Carlo Palmieri31,71, Selva Panchatsharam, Danai Papakonstantinou, Padmasayee Papineni, Hassan Paraiso, Brij Patel, Natalie Pattison, Justin Pepperell, Mark Peters, Mandeep Phull, Stefania Pintus, Tim Planche, Frank Post, David Price, Rachel Prout, Nikolas Rae, Henrik Reschreiter, Tim Reynolds, Neil Richardson, Mark Roberts, Devender Roberts, Alistair Rose, Guy Rousseau, Bobby Ruge, Brendan Ryan, Taranprit Saluja, Sarah Cole, Matthias L Schmid, Aarti Shah, Manu Shankar-Hari, Prad Shanmuga, Anil Sharma, Anna Shawcross, Jagtur Singh Pooni, Jeremy Sizer, Richard Smith, Catherine Snelson, Nick Spittle, Nikki Staines, Tom Stambach, Richard Stewart, Pradeep Subudhi, Tamas Szakmany, Kate Tatham, Jo Thomas, Chris Thompson, Robert Thompson, Ascanio Tridente, Darell Tupper-Carey, Mary Twagira, Nick Vallotton, Rama Vancheeswaran, Rachel Vincent, Lisa Vincent-Smith, Shico Visuvanathan, Alan Vuylsteke, Sam Waddy, Rachel Wake, Andrew Walden, Ingeborg Welters, Tony Whitehouse, Paul Whit- taker, Ashley Whittington, Meme Wijesinghe, Martin Williams, Lawrence Wilson, Stephen Winchester, Martin Wiselka, Adam Wolverson, Daniel G Wootton, Andrew Workman, Bryan Yates, Peter Young. 69 Paediatric Liver, GI & Nutrition Centre and MowatLabs, King’s College Hospital, London, UK 70 Institute of Liver Studies, King’s College London, London, UK 31 University of Liverpool 71 Clatterbridge Cancer Centre NHS Foundation Trust 13.4.6.2 Outbreak Laboratory Staff and Volunteers 13.4.6.2.1 Outbreak Laboratory Staff and Volunteers Katie A. Ahmed. Jane A Armstrong, Milton Ashworth, Innocent G Asiimwe, Siddharth Bakshi, Samantha L Barlow, Laura Booth, Benjamin Brennan, Katie Bullock, Nicola Carlucci, Emily Cass, Benjamin WA Catterall, Jordan J Clark, Emily A Clarke, Sarah Cole, Louise Cooper, Helen Cox, Christopher Davis, Oslem Dincarslan, Alejandra Doce Carracedo, Chris Dunn, Philip Dyer, Angela Elliott, Anthony Evans, Lorna Finch, Lewis WS Fisher, Lisa Flaherty, Terry Foster, Isabel Garcia-Dorival, Philip Gunning, Catherine Hartley, Anthony Holmes, Rebecca L Jensen, Christopher B Jones, Trevor R Jones, Shadia Khandaker, Katharine King, Robyn T. Kiy, Chrysa Koukorava, Annette Lake, Suzannah Lant, Diane Latawiec, Lara Lavelle-Langham, Daniella Lefteri, Lauren Lett, Lucia A Livoti, Maria Mancini, Hannah Massey, Nicole Maziere, Sarah McDonald, Laurence McEvoy, John McLauchlan, Soeren Metelmann, Nahida S Miah, Joanna Middleton, Joyce Mitchell, Shona C Moore, Ellen G Murphy, Rebekah Penrice-Randal, Jack Pilgrim, Tessa Prince, Will Reynolds, P. Matthew Ridley, Debby Sales, Victoria E Shaw, Rebecca K Shears, Benjamin Small, Krishanthi S Subramaniam, Agnieska Szemiel, Aislynn Taggart, Jolanta Tanianis-Hughes, Jordan Thomas, Erwan Trochu, Libby van Tonder, Eve Wilcock, J. Eunice Zhang. 97 References 1. Pereira, A. C. et al. Genetic risk factors and COVID-19 severity in Brazil: results from BRA- COVID study. Human Molecular Genetics 31, 3021–3031 (2022). 2. Cruz, R. et al. Novel genes and sex differences in COVID-19 severity. Human Molecular Genetics 31, 3789–3806 (2022). 3. Kousathanas, A. et al. Whole-genome sequencing reveals host factors underlying critical COVID- 19. Nature 607, 97–103 (2022). 4. Niemi, M. E. K. et al. Mapping the human genetic architecture of COVID-19. Nature 600, 472–477 (2021). 5. Ellinghaus, D. et al. Genomewide association study of severe covid-19 with respiratory failure. The New England journal of medicine 383, 1522–1534 (2020). 6. Pairo-Castineira, E. et al. Genetic mechanisms of critical illness in COVID-19. Nature 591, 92–98 (2021). 7. Pathak, G. A. et al. A first update on mapping the human genetic architecture of COVID-19. Nature 608, E1–E10 (2022). 8. Degenhardt, F. et al. Detailed stratified GWAS analysis for severe COVID-19 in four european populations. Human molecular genetics 31, 3945–3966 (2022). 9. Kanai, M. et al. Meta-analysis fine-mapping is often miscalibrated at single-variant resolution. Cell Genomics 0, (2022). 10. Mineta, K. A. G., Katsuhiko AND Goto. Population structure of indigenous inhabitants of arabia. PLOS Genetics 17, 1–18 (2021). 11. COVID-19 Host Genetics Initiative. Mapping the human genetic architecture of COVID-19. Na- ture (2021) doi:10.1038/s41586-021-03767-x. 12. Shelton, J. F. et al. Trans-ancestry analysis reveals genetic and nongenetic associations with COVID-19 susceptibility and severity. Nature Genetics 53, 801–808 (2021). 98