Science of the Total Environment 874 (2023) 162406
Contents lists available at ScienceDirect
Science of the Total Environment
j ourna l homepage: www.e lsev ie r .com/ locate /sc i totenvNeurotoxicity and endocrine disruption caused by polystyrene nanoparticles
in zebrafish embryoMónica Torres-Ruiz a, Mercedes de Alba González a, Mónica Morales b, Raquel Martin-Folgar b,
Mª. Carmen González a, Ana I. Cañas-Portilla a,⁎, Antonio De la Vieja c,⁎⁎
a Environmental Toxicology Unit, Centro Nacional de Sanidad Ambiental (CNSA), Instituto de Salud Carlos III (ISCIII), Ctra. Majadahonda-Pozuelo Km. 2,2., Majadahonda, Madrid 28220, Spain
b Grupo de Biología y Toxicología Ambiental, Departamento de FísicaMatemática y de Fluidos, Facultad de Ciencias, UNED, UrbanizaciónMonte Rozas, Avda. Esparta s/n, Ctra. de Las Rozas al Escorial Km5,
28232 Las Rozas, Madrid, Spain
c Endocrine Tumor Unit, Unidad Funcional de Investigación en Enfermedades Crónicas (UFIEC), Instituto de Salud Carlos III (ISCIII), Ctra. Majadahonda-Pozuelo Km. 2,2., Majadahonda, Madrid 28220, SpainH I G H L I G H T S G R A P H I C A L A B S T R A C T⁎ Correspondence to: A.I. Cañas-Portilla, Centro Nacional d
Spain.
⁎⁎ Correspondence to: A. De la Vieja, Endocrine Tumor Un
Pozuelo Km. 2,2., Majadahonda, Madrid 28220, Spain.
E-mail addresses: mtorres@isciii.es (M. Torres-Ruiz), aca
http://dx.doi.org/10.1016/j.scitotenv.2023.162406
Received 4 December 2022; Received in revised form
Available online 23 February 2023
0048-9697/© 2023 The Authors. Published by Elsevi• Polystyrene NP neurotoxicity and endo-
crine disruption studied in zebrafish em-
bryos.
• NP accumulated in brain and sensory or-
gans.
• NP altered behavior: effects on activity and
anxiety but not learning.
• NP altered neuroendocrine gene expression
and neurotransmitter metabolism (AchE).
• NP adverse outcome pathway for neurotox-
icity and endocrine disruption is proposed.A B S T R A C TA R T I C L E I N F OEditor: Henner Hollert
Keywords:
Nanomaterial
Plastic
Development
Toxicity
Behavior
HormonesNanoplastics (NP) are present in aquatic and terrestrial ecosystems. Humans can be exposed to them through contam-
inated water, food, air, or personal care products. Mechanisms of NP toxicity are largely unknown and the Zebrafish
embryo poses an ideal model to investigate them due to its high homology with humans. Our objective in the present
study was to combine a battery of behavioral assays with the study of endocrine related gene expression, to further ex-
plore potential NP neurotoxic effects on animal behavior. Polystyrene nanoplastics (PSNP) were used to evaluate NP
toxicity. Our neurobehavioral profiles include a tail coiling assay, a light/dark activity assay, two thigmotaxis anxiety
assays (auditory and visual stimuli), and a startle response - habituation assay in response to auditory stimuli. Results
show PSNP accumulated in eyes, neuromasts, brain, and digestive system organs. PSNP inhibited acetylcholinesterase
and altered endocrine-related gene expression profiles both in the thyroid and glucocorticoid axes. At thewhole organ-
ism level, we observed altered behaviors such as increased activity and anxiety at lower doses and lethargy at a higher
dose, which could be due to a variety of complex mechanisms ranging from sensory organ and central nervous system
effects to others such as hormonal imbalances. In addition, we present a hypothetical adverse outcome pathway re-
lated to these effects. In conclusion, this study provides new understanding into NP toxic effects on zebrafish embryo,
emphasizing a critical role of endocrine disruption in observed neurotoxic behavioral effects, and improving our un-
derstanding of their potential health risks to human populations.e SanidadAmbiental (CNSA), Instituto de SaludCarlos III (ISCIII), Ctra.Majadahonda-PozueloKm. 2,2.,Majadahonda,Madrid 28220,
it, Unidad Funcional de Investigación en Enfermedades Crónicas (UFIEC), Instituto de Salud Carlos III (ISCIII), Ctra. Majadahonda-
nas@isciii.es (A.I. Cañas-Portilla), adelavieja@isciii.es (A. De la Vieja).
5 February 2023; Accepted 18 February 2023
er B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 1624061. IntroductionPlastic production has increased exponentially and by 2018, total
humanplastic waste amounted to 6900million tons (Letcher, 2020). Plastic
reaches aquatic, terrestrial and atmospheric environments (Rhodes, 2018;
Zhang et al., 2020b) and suffers physical and chemical degradation result-
ing inmicroplastic (MP) (< 5mm) and nanoplastic (NP) (< 0.001mm) gen-
eration (Andrady, 2017; Gigault et al., 2018). Humans are exposed to NP
mainly by consuming contaminated food (marine and terrestrial organ-
isms) and drinking water, but also by inhalation and dermal contact
(Chang et al., 2020). Even though detection of NP in human matrices has
not been technically possible so far, MP have been found in human blood,
lung tissue, gastrointestinal tract, and placenta (Gruber et al., 2022;
Jenner et al., 2022; Leslie et al., 2022; Ragusa et al., 2021; Schwabl et al.,
2019). Nevertheless, in vitro and in vivo experiments have demonstrated
that NP have the potential to penetrate different biological barriers includ-
ing gastrointestinal and brain blood barriers, and have been detected in
many important organs such as brains, the circulation system, and livers
of model animals (Deville et al., 2015; Hwang et al., 2022; Peng et al.,
2020; Walczak et al., 2015).
In recent years, the potential toxic effects of nanoplastics have been
studied in a variety of aquatic and terrestrial organisms, and these have
been shown to range from metabolism disruption to developmental, fertil-
ity, and behavioral problems (Chae and An, 2020; Chae and An, 2017; Li
et al., 2022; Liu et al., 2021b; Liu et al., 2019; Matthews et al., 2021;
Ullah et al., 2023). In vitro effects in human tissue cultures have also
been reported, such as oxidative stress, and inflammation in lung, skin,
and gastrointestinal cells (Lehner et al., 2019). Neurodevelopmental effects
of NP have been shown in rodents, with molecular and functional alter-
ations in the central nervous system (CNS) and cognitive deficits (Jeong
et al., 2022). However, other studies have found no behavioral alterations
in mice exposed to small size (~ 20 nm) NP (Estrela et al., 2021).
The zebrafish (ZF) embryo (Danio rerio) has been recommended as an
inexpensive, quick, and easy model to assess NP toxicity (Torres-Ruiz
et al., 2021). This fish is a small cyprinid with many advantages for toxico-
logical research such as transparency of the embryo, a completely
sequenced genome, high egg production and no major rearing difficulties
(Bourdineaud et al., 2013). Moreover, it shares a high genetic sequence ho-
mology with humans, with 71.4 % of total genes and 84 % of human-
disease genes having a human orthologue (Howe et al., 2013). ZF have be-
come an excellent vertebratemodel for neurotoxicity research because they
retain neurological systems very similar to those of mammals (d’Amora and
Giordani, 2018). Therefore, this fish is the perfect model to study both en-
vironmental and human health effects of NP.
Indeed, in the last few years, there has been an increase in studies eval-
uating effects of NP on the ZF embryo development (Bhagat et al., 2020).
For the most part, results show NP accumulate in several ZF organs and
can cause behavioral neurotoxic effects, together with general downregula-
tion of central nervous system and sensory genes (Torres-Ruiz et al., 2021).
NP have been observed to alter larvae locomotion, although degree and
direction of effects are still unclear (Brun et al., 2019; Chen et al., 2017;
Liu et al., 2022; Manuel et al., 2022; Pedersen et al., 2020; Pitt et al.,
2018; Teng et al., 2022). Most studies have used the light/dark locomotion
assay and both hyperactivity, hypoactivity, and no alterations have been
reported, regardless of NP size or concentration (Torres-Ruiz et al., 2021).
However, we have found no study evaluating other important potential
effects on behaviors such as anxiety or habituation. In addition, little is
known so far about the effect of NP on embryo tail coiling, a behavior indi-
cating early motor activity generated bymuscle innervation (Kimmel et al.,
1974).
Different mechanisms of NP toxicity have been proposed and include
oxidative stress (Chen et al., 2017), immune responses (Brun et al.,
2018), and alterations in energy metabolism (Trevisan et al., 2019). How-
ever, other processes could play a role, considering the variety of behavioral
responses observed (Torres-Ruiz et al., 2021). Of special interest is the role
of NP as potential endocrine disruptors. Although very few data exist on the2matter, some authors have shown NP can affect thyroid-regulating
hormones (Amereh et al., 2019; Zhao et al., 2020). Since it is well known
that endocrine disruption can affect CNS development (Seralini and
Jungers, 2021) and cause behavioral alterations (Repouskou et al., 2020;
Tao et al., 2022), this is an essential toxicity pathway to explore.
There is clearly a need to advance in the knowledge of NP potential
toxicity mechanisms, including endocrine-related neurotoxicity, and
how this could translate into changes in development and behavior.
Therefore, our objective in the present study was to combine a battery
of behavioral assays with the study of endocrine related gene expres-
sion, to further explore potential NP effects on animal behavior. Our
neurobehavioral profiles include the tail coiling assay, the light/dark
activity assay, two thigmotaxis anxiety assays (auditory and visual stim-
uli), and a startle response - habituation assay in response to auditory
stimuli. To the best of our knowledge, our study is the first to combine
these assays to evaluate behavioral alterations in response to NP expo-
sure and potential role of endocrine disruption.
2. Materials and methods
2.1. Nanoplastics concentrations
Polystyrene nanoplastics (PSNP) were used as representatives of plastic
particles due to their commercial availability in a well characterized spe-
cific size and shape, and the possibility of purchasing fluorescently labelled
particles. In addition, polystyrene is one of the main plastic types used for
many commonly used items such as insulating styrofoam, toys, food con-
tainers, etc., and its degradation into nanoparticles has been observed
under laboratory conditions (Kik et al., 2020). Fluorescently labelled
(Firefli™ Fluorescent Green) and pristine polystyrene particles with a
mean diameter of 30 nm were purchased from Fisher Scientific (Madrid,
Spain), catalogue number Thermo Scientific™G25 and 5003A respectively.
PSNP of 1.05 g/cm3 density were provided as a 1 % and 10 % solution in
water respectively, both with <2 % anionic surfactant (proprietary, similar
to SDS) to prevent agglomeration, and <0.05 % the antibacterial agent
NaN3 (only fluorescently labelled particles). Stock solutions were prepared
to working concentrations in embryo medium and thus the additives were
diluted enough not to cause effects in embryos (Wang et al., 2015; Pedersen
et al., 2020). As per manufacturer instructions, stock solutions were shaken
and sonicated for 1min prior to use. In addition, every time ZFmediumwas
changed, solutions were shaken and sonicated for 3–5 min prior to use.
PSNP working concentrations were chosen carefully, after a pilot study,
to better appreciate effects (unpublished work), and reflect possible envi-
ronmentally relevant concentrations (up to 9 mg/L; see Gallego-Urrea
et al., 2010, Torres-Ruiz et al., 2021, and Materić et al., 2022c). In this
prior study, embryos were exposed to solutions of 0.2, 1, and 5 mg/L of
fluorescently labelled particles (for 120 h) to observe mortality, skeletal
abnormalities (lordosis), and location of PSNP accumulation in the em-
bryos. Since 60 % mortality was observed at 5 mg/L, concentrations for
sub-lethal toxicity evaluations with pristine particles were chosen to be
0.1, 0.5, and 3 mg/L.
2.2. Nanoplastics characterization
PSNP solutions in embryowater at the concentrations used for exposure
were characterized by observation under a transmission electron micro-
scope (TEM) FEC Tecnai 12 operated at 120 kV. Briefly, samples were son-
icated for 3–5min, then incubated on copper grids for 10min, washedwith
MQH2O and then dyedwith 2%uranyl acetate before observation. To assess
particle size distribution in embryo medium, PSNP solutions were charac-
terized using nanoparticle tracking analysis (NTA). For this we have used
the NanoSight NS3000 (Malvern Instruments GmbH, United Kingdom)
equipped with a high sensitivity sCMOS camera. Three replicates for each
PSNP assay concentration (0.1, 0.5, and 3 mg/L) were introduced automat-
ically and videos of 30 s were recorded at 30 frames per second. Software
NTA 3.0 was used to monitor individual particles. In addition, particle z
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 162406potential in the same solutions was determined with the Zetasizer Nano SZ
(Malvern Instruments GmbH, United Kingdom).
2.3. Zebrafish husbandry
Adult wild type zebrafish (Danio rerio) from Instituto de Salud Carlos III
(Majadahonda-Madrid, Spain) animal facility were maintained in glass
recirculating aquariums at 25–26 °C, pH between 7 and 7.5, oxygen levels
6–6.5mg/L, and conductivity 500–600 μS/cm.Water for fish was prepared
using deionized water from a MilliQ system (Merck RiOsTM Essential 24)
and a mixture of salts: Cl2Ca.2H2O (294 mg/L), MgSO4.7H2O
(123 mg/L), NaHCO3 (64.7 mg/L), and KCl (5.8 mg/L). Fish tanks were
gently cleaned and water was renewed three times a week to ensure suit-
able NH4, NO2, and NO3 levels (< 0.05 mg/L for the first two; < 5 mg/L
for nitrate). Nitrogen compounds, oxygen, conductivity, and pHwere mea-
sured once a week. Fish were maintained in a light/dark cycle of 14:10 h
and they were fed twice a day with frozen brine shrimp (Artemia salina,
Ocean NutritionTM, Belgium), shell free brine shrimp eggs (Ocean
NutritionTM, Belgium) or Tropica Basic fish flakes (Dajana®, Czech
Republic). Our fish laboratory adheres to directive 2010/63/EU on the
welfare of animals.
2.4. Embryo culture and Nanoplastic exposure
Embryos were obtained by placing a breeding tank inside the aquarium.
Fish bred after the onset of light (at 8 am) and embryos were collected
within 1 h of oviposition. Embryos were washed with embryo water
(same as fish water, see above) and placed in large Petri dishes. Eggs
were observed under a stereoscope (Olympus) and fertilized eggs were
placed in 24 well plates for PSNP exposure within 2 h of oviposition.
PSNP solutions were renovated every 24 h and the exposure lasted until
120 hpf. For fluorescently labelled particles (pilot study), one plate per
PSNP concentration and one for negative control (embryo water) were
used, with 2mL solution per well. In themain study using pristine particles,
three plates (24 wells) per PSNP concentration and negative controls (em-
bryowater) were used for a total of 72 embryos per treatment/control. Spe-
cific number of embryos for endpoint is as follows: mortality and hatching
72; tail-coiling 48; biometry: 24; locomotion: 48.
Plates were kept in an incubator (Nuaire) at 28 °C until the end of the
study (120 hpf) and medium was renewed every 24 h. Mortality was
assessed every 24 h and dead embryos were removed.
2.5. Nanoplastic bioaccumulation observation
Zebrafish larvae (treated with 0.1 and 0.5 mg/L) were observed
for fluorescent PSNP accumulation in different organs at 24, 48, and
72 hpf, after being rinsed with embryo water to avoid background fluo-
rescence. Larvae were photographed using a Stelaris 8 confocal fluores-
cent microscope (Leica Microsystems) using objective HC PL APO 20×/
0.75 CS2. In all experiments, digitalized images were captured using
Leica LasX v. 4.5 software.
2.6. Zebrafish behavioral analysis
Tail bursting of embryos (non-dechorionated) was assessed at 24 ±
2hpf, a timewhen tail coiling is constant (De Oliveira et al. 2021). Embryos
of each treatment were transferred to a large petri dish (100 mm) with em-
bryo water and 2× 1min videos (5 frames per second - fps) were recorded
(AxioCam 208 coupled with Discovery V12 stereoscope, Carl Zeiss,
Germany) at constant room light and temperature, andwithout embryo dis-
turbance. To minimize time out of the incubator, videos were done in
groups of 24 embryos at a time. Later these videos were analyzed using
the Danioscope software (Noldus Information Technology, Netherlands)
and tail activity was assessed by the following parameters: % burst activity
(percent time embryo's tail is moving),mean burst duration (mean of all tail3coiling durations), and burst count per minute (number of tail coils
per minute).
At 120 hpf larvae were assessed for swimming activity in a light/dark
locomotor response test using a DanioVision Observation Chamber (Noldus
Information Technology, Netherlands), using the DanioVision Temperature
Control Unit (Noldus Information Technology, Netherlands) to ensure a
constant temperature at 28 °C. Larvae (in 24-well plates) were conditioned
in the dark for 10 min, followed by 3 cycles of light stimulus (5 min under
white light/5 min in the dark), and ending with 5 min in the dark. Videos
were taken at 25 fps using an infrared sensitive camera and analyzed
using the software Ethovision XT® (v.15, Noldus Information Technology,
The Netherlands) for total distance moved (mm) and velocity (mm/s) in
each condition (light or dark periods).
In addition, a vibration startle response (tapping) and habituation
experiment was performed at 120 hpf using the DanioVision Observation
Chamber coupled with a tapping device, in the dark and at a constant
temperature of 28 °C. Larvae were conditioned for 5 min and a first cycle
of 30 taps, with 1 tap per second, at the loudest noise level (intensity =
8), was followed by 15 min of quiet time. Immediately after, larvae were
subjected to a second tapping interval, with the same regime as the first
one (30 taps, 1/s) and the experiment ended with a 1-min quiet time
(Faria et al., 2019). Caution was taken to prevent any loud ambient noises
from occurring during this experiment. Later, videos (25 fps) recordedwere
analyzed using the Ethovision XT 15 software for distance moved by larvae
during 1min prior to tapping, during thefirst tapping episode (30 s), during
1min before the second tapping interval, and during the second tapping in-
terval (30 s). Distance moved was calculated in 1-s intervals. To compare
habituation velocity between treatments, we calculated the slope of the
line that resulted from plotting distance traveled vs. time during both tap-
ping periods.
Larvae anxiety-like behavior in response to visual (light) and auditory
(tapping) stimuli was studied by investigating thigmotaxis (wall-hugging)
behavior. For this, videos recorded for the light/dark or tapping experi-
mentswere re-analyzed using a different arena settings option in Ethovision
software. Each arena (each well area) was separated into two zones, the
“center”, comprised of a circle of 10 mm in diameter drawn in the center,
and the “edge”, comprised of the area between the inner circle and the
well borders (4 mm width). The use of a 24-well plate allows for both
zones to cover equivalent spatial areas and thus prevent the bias of zone
size differences (Schnörr et al., 2012). Thigmotaxis was assessed by evalu-
ating percent time spent by larvae in the center vs. the edge of the wells
using light/dark or tapping stimuli.
2.7. Zebrafish biometry
Larvae length (front part of the head to end of last somite), and areas
representing head, eye, pericardium, and yolk sizes were measured in
each larvae/treatment at 72 hpf. Each larva was photographed at 20×
magnification using a Zeiss stereoscope and an Axiocam 208 camera
(Carl Zeiss, Germany). Larvae were anesthetized with MS-222 (tricaine
methanesulfonate) 0.1 mg/mL before photographing. The Danioscope soft-
ware (Noldus, The Netherlands) was used to calculate lengths and areas in
pixels that were converted to mm using a calibration ruler photographed at
the same magnification as larvae. Larvae used for biometry were later
discarded and not used in locomotion experiments.
2.8. RNA isolation and quantitative real-time polymerase chain reaction
(qRT-PCR)
Total RNA extraction from 30 larvae (n= 3 replicates) was performed
using easy-RED™ Total RNA Extraction Kit (iNtRON-Biotechnology) follow-
ing manufacturer instruction. Reverse transcription (RT-PCR) was per-
formed using M-MuLV Reverse Transcriptase (New England Biolabs Inc.)
to obtain cDNA, and amplified by polymerase chain reaction (PCR) using
LinusTaq Master Mix Ready to Load with 7.5 mM MgCl2 (cmb) kit in a
thermocycler (Biometra). The amplified product was separated in 1 %
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 162406agarose gel and identified using GelRed® Nucleic Acid Gel Stain
(Biotium) in a UV system (Analytik Jena, Fisher scientific). Quantitative
real-time PCR was done on a LightCycler 480II (Roche) using SYBR
Green PCR kit (Takara Biochemicals). qRT-PCR reactions were con-
ducted with the following parameters: initiated at 95 °C for 30 s, and
40 cycles of 5 s at 95 °C, 30 s at 60 °C, and 10 s at 72 °C. All samples
were repeated in triplicates. Primers for the target genes and the refer-
ence gene applied in this study were designed or prepared according
to other references (Table 1). Each expression of target genes was nor-
malized to the housekeeping gene ribosomal protein L8 (rpl8) and
then normalized to the control. A dissociation curve and a negative con-
trol of qRT-PCR without template were also conducted to ensure the
specificity of the primer pairs and that the cDNA was not contaminated.
The changes in the relative mRNA expression of target genes were quan-
tified with 2-ΔΔCT method.
2.9. Acetylcholinesterase assay
The acetylcholinesterase (AchE) assay was done according to Küster
(2005) with few modifications. Briefly, at 120 hpf, three replicates of
7 embryos each per PSNP concentration (0.1, 0.5, and 3 mg/L) were
placed on ice in Eppendorf tubes, washed twice with MQH2O and twice
with cold homogenization phosphate buffer (0.1 M NaH2PO4·7H2O
with 0.1 % v/v Triton-X; pH 7.5). Larvae were then resuspended in
0.5 mL phosphate buffer and homogenized using glass tissue grinders.
Homogenate was then centrifuged at 4 °C for 15 min at 12500 rpm
and larvae supernatant was transferred to two Eppendorf tubes that
were then frozen at−80 °C until analysis.Table 1
Oligonucleotides sequences used for gene expression analysis.
Gene Name Accession nº
metsyS
enircodnE
trh
H
yp
ot
ha
la
m
us
-p
itu
ita
ry
-th
yr
oi
d 
ax
is
E
n
d
o
cr
in
e-
th
y
ro
id
 d
is
ru
p
ti
o
n
Thyrotropin releasing 
hormone
NM_001012365.2
trhr Trh receptor NM_001114688.1
tshb Thyroid stimulating 
hormone beta subunit
XM_021476792.1
tshr Tsh receptor NM_001145763.2
tra Thyroid receptor alpha NM_131396.1
ugt1ab Glucuronosyl 
transferase
NM_213422.2
crha
H
yp
ot
ha
la
m
us
-p
itu
ita
ry
-
in
te
rr
en
al
 a
xi
s
E
n
d
o
cr
in
e-
an
x
ie
ty
 d
is
ru
p
ti
o
n
Corticotropin releasing 
hormone a
XM_009298729.3
crhb Corticotrophin releasing 
hormone b
NM_001007379.1
acthb Adrenocorticotropic 
hormone
NM_001083051.1
crhbp crh binding protein NM_001003459.1
suovrenlartne
C
sy
st
em
th1
C
N
S
 s
y
st
em
Tyrosine hydroxylase NM_131149.1
drd2a Dopamine receptor D2a NM_183068.1
drd2b Dopamine receptor D2b XM_021476029.1
rpl8 HK
 
g
en
e
Ribosomal protein 8 NM_200713.1
4Colorimetric determination of AchE was done in triplicate for
each sample replicate and AchE assay controls (phosphate buffer) in
96-well plates. Each well was filled first with 100 μL 5,5’-Dithiobis-(2-
Nitrobenzoic Acid) (DTNB) 0.4 mg/mL, 80 μL phosphate buffer (0.1 M
NaH2PO4·7H2O, pH 7.5), and 20 μL larvae supernatant. After 10 min in-
cubation at room temperature (24 °C) to correct non-specific spontane-
ous hydrolysis of DTNB, the reaction was started with the addition of
100 μL acetyltiocholine iodide (1.35 mM). Kinetic measurements of
mean slope optical density per minute were registered at 412 nm for
10 min using a Spark® spectrophotometer (TECAN, Austria) and the
software Sparkcontrol v2.2.
Enzyme activity was corrected for protein content. Concentration of
protein was determined using the commercial kit QuantiPro™ BCA Assay
(Merck, Spain) at 562 nm in triplicate for each sample replicate and blanks
(phosphate buffer) using 25 μL of diluted embryo supernatant (1:20 in
phosphate buffer). AchE activity inhibition was expressed as the percent
of activity levels of exposed animals to the activity in controls.2.10. Statistical analysis
All data were checked for normality and homoscedasticity using
the Kolmogorov-Smirnov and Levene tests prior to analyses using the on-
line free softwares https://www.socscistatistics.com/tests/kolmogorov/
default.aspx and https://www.statskingdom.com/230var_levenes.html.
Significant differences between control and each PSNP treatment were
assessed by a two-tailed Student's t-test, using an a priori probability of a
type I error of≤0.05. Data are presented as means ± SE.bp Reference
F: GCTCTCTCCGTCGGTCTGTT
57 Chu S. et al. (2020)
R: GCGAGATCCGTGCTGATGA
F: CAGTGCCATCAACCCTCTGA
55 Chu S. et al. (2020)
R: GGCAGCGCGGAACTTCT
F1: TAATGAAGGTTGCCGTGCCT
157
This study
R1: AAACGAGGACCCACCAACTC
F2: AATCCAGACCCTCCAGACAGA
105
R2: CATAGGCACGGCAACCTTCA
F3: CACCTACCCAGTGGCACTTA
128
R3: TCTCCTCGGGGTACAGATGA
F: GCGCCAACCCTTTTCTGTAT
182 Chu S. et al. (2020)
R: CTCGTTTGCTCCTGTTTGCT
F: AAGTGGATATAATCCGAACATAGGC
196 Chu S. et al. (2020)
R: ACGCCAATGCCACTTCCTT
F: CCACCAAGTCTTTCCGTGTT
168 Zhai W et al (2014)
R: GCAGTCCTTCACAGGCTTTC
F: ATTTAGTCGAACCGCAGCCA
155 Chu S. et al. (2020)
R: ATCTCAGTCGGTGTCCTCCA
F: TTCGGGAAGTAACCACAAGC 
161 Tu X. et al (2020)
R: CTGCACTCTATTCGCCTTCC
F: TATCGCATGACCCACTTCCG
91 Tu X. et al (2020)
R: GGGGTTTGTGGGATTCGTCT
F: TCATCGGCGAACCTACTGAC
105 Tu X. et al (2020)
R: CCTTCATCACCCAGCCATCA
F: AGCGAGCAGATCGTGTTTGA
178 Tu X. et al (2020)
R: CCTCCAAGCCATCCTTTGGT
F: TGCTCTCTGTGTGATTGCGA
151 Tu X. et al (2020)
R: GCATGTGCGTTTGGTGTTGA
F: TGTGGGGATGGAAATGGTGG
134 Tu X. et al (2020)
R: TGGACTGATATTCGGCGTGG
F: TTGTTGGTGTTGTTGCTGGT
136 Chu S. et al. (2020)
R: GGATGCTCAACAGGGTTCAT
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 1624063. Results
3.1. Nanoplastic characterization
Nanoplastics were characterized by TEM and individual particle
size was confirmed to be 25 ± 0.6 nm in size. However, even though
solutions were sonicated prior to analysis, aggregation of PSNP was
observed at all tested concentrations (Fig. 1a). Particle aggregation
was also evaluated by NTA. Aggregates had a mean particle size of
105.1 ± 27.4 nm (0.1 mg/L), 111.1 ± 40.8 (0.5 mg/L), and 134.4 ±
47.2 (3 mg/L) (Fig. A.1). Particle z potential had a mean of−13.6 ±
0.06 (0.1 mg/L), −16.1 ± 1.76 (0.5 mg/L), and − 17.3 ± 0.21
(3 mg/L) (Fig. A.1).3.2. PSNP accumulation
Nanoplastics accumulation was studied through the observation of
fluorescent PSNP in ZF embryo. Pictures taken at 24 and 48 hpf show
larvae start to accumulate PSNP inside the chorion but mostly in the
yolk (Fig. 1 b, c). Pictures taken at 72 hpf show uptake in specific tissues
that was dose dependent, with larvae exposed to 0.5 mg/L and higher
(not shown) exhibiting overall background fluorescence suggesting
whole body distribution (Fig. 1d). However, certain organs accumu-
lated PSNP preferentially. The organ with the most fluorescence
(PSNP accumulation) was the yolk, followed by the digestive tract, in
particular the intestine, pancreas, and liver (Fig. 1e, h). The eyes
showed substantial PSNP uptake (Fig. 1f) and other important organs
such as the brain and neuromasts of the lateral line also showed PSNP
buildup (Fig. 1f, g). No preferential PSNP accumulation was observed
in the heart (Fig. 1h) and no PSNP fluorescence was observed in bone
tissue (Fig. A.2).Fig. 1. Accumulation of fluorescent NP in zebrafish larvae. (a) Electron microscope ima
chorion accumulation after 24 and 48 hpf at 0.5 mg/L. Panels (d) and (e) show PSNP a
combined fluorescent and bright field way (d) or only fluorescent view (e). Close-up
system (h).
53.3. Morphological abnormalities and mortality
Exposure to fluorescent PSNP for the preliminary study had an effect
on mortality (60 %) and a 30 % lordosis rate only at the highest concen-
tration (5 mg/L, data not shown). In the main study, no mortality was
observed in animals exposed to pristine particles (highest concentration
of 3 mg/L), but some morphological abnormalities were confirmed. Eye
size was decreased significantly (6–11 %) in all treatments with respect
to control with larvae treated at 3 mg/L having smaller eyes than larvae
in the 0.1 and 0.5 mg/L treatments (Fig. 2a). Head size was decreased in
a similar manner at all concentrations (~5 %; Fig. 2b), and pericardial
area was significantly increased only at the highest concentration by
9 % (Fig. 2c). No effect was observed for yolk size (Fig. 2d), otolith di-
ameter (Fig. 2e), or body length (Fig. 2f).
3.4. Effects on activity/behavior
Animals exposed to PSNP showed significant alterations in activity pat-
terns (Fig. 3). At 24 hpf, tail activity (bursts/min) increased significantly in
a concentration dependent manner with increases of 33, 51, and 55 % for
larvae exposed to 0.1, 0.5, and 3 mg/L respectively (Fig. 3a). Interestingly,
despite increase number of bursts per minute, mean burst duration, which
denotes burst quality, decreased in all treatments, being significant for
0.5 mg/L (−18 %) and 3 mg/L (−14 %) (Fig. 3b).
Larvae swimming activity in alternating light/dark transitions at
120 hpf also showed an effect of PSNP exposure. During the dark interval,
there was an increase in larvae activity at 0.1 and 0.5 mg/L but that was
only significant for the later (6% and 29% respectively). However, activity
decreased by 4 % for larvae exposed to 3 mg/L (Fig. 3c). During the light
period there was a decrease in movement for larvae at 0.1 mg/L (−11 %)
and an increase at 0.5 mg/L (37%) and 3mg/L (11%) that was only signif-
icant for the intermediate concentration.ges of nanoparticles in embryo water after sonication. Panels (b) and (c) depict in-
ccumulation in control, 0.1 and 0.5 mg/L exposed larvae after 72 hpf viewed in a
of accumulation in eyes and brain (f), neuromasts (lateral line) (g), and digestive
Fig. 2. Eye size (a), head size (b), pericardial area (c), yolk size (d), otolith diameter (e), and body length (f) of larvae exposed to 0.1, 0.5, and 3 mg/L PSNP. Measurements
were taken at 72 hpf. Data are presented as means ± SE. Red asterisk above bar denotes significant difference between treatment and control (p < 0.05); black asterisk
denotes significant difference among treatments (p < 0.05).
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 162406Anxiety-like behavior evaluation through the study of thigmotaxis
behavior during visual stimulation (dark and light periods) showed
that during dark periods (Fig. 4a), larvae exhibited increased anxiety
at 0.1 and 0.5 mg/L with less time in the well center (−17 and
−30 % respectively) and more time at the edge (8 and 15 %). This
trend was also true for the light period although not as pronounced,
with less time in the well center (−9 and 10 % respectively) and more
near the edge (5 and 6 %) (Fig. 4b). These differences only showed sig-
nificance for at 0.5 mg/L during the dark period. On the other hand, lar-
vae exposed to the highest PSNP concentration of 3 mg/L showed an
opposite trend. During both light and dark periods these larvae spent
more time at the well center (~15 %) and less at the edge (~9 %)
than controls which denotes a decrease in anxiety (Figs. 4a and b). Al-
though not significant against controls, 3 mg/L exposed larvae spent sig-
nificantly more time at the center than the edge than larvae exposed to
the two lower concentrations. Interestingly, effects of PSNP on anxietyFig. 3. Embryo (24 hpf) tail bursts per minute (bpm) (a) and burst duration (b); and larv
Burst activity wasmeasured in the dark. Distancewasmeasured during dark (solid colum
above bar denotes significant difference between treatment and control (p < 0.05).
6caused by auditory stimulation (tapping noises) showed a concentration
dependent pattern of anxiolytic effects. Larvae exposed to 0.5 and
3 mg/L exhibited more time in well centers (23 and 40 % respectively;
Fig. 4c) and less at the edge (−12 and −21 %), although significant
only at 3 mg/L.
In response to a first loud auditory stimulus, larvae exposed to 0.1
and 0.5 mg/L PSNP, presented a significant increase reaction (more dis-
tance traveled) during the first jump (~ 26 % more than controls for
both; Fig. 5 a, b). However, when exposed to a second “first” stimulus
after a 15 min pause, the jump was similar to that of controls. On the
other hand, larvae exposed to 3 mg/L exhibited a less intense reaction
as they traveled less distance than controls for both “first” tapping
noises (−7 and –10 % respectively; Fig. 5c). Interestingly, PSNP did
not appear to have an effect on larvae habituation to a series of tapping
noises as habituation slopes did not differ at any concentration with re-
spect to controls (Fig. 5).ae (120 hpf) total distance traveled (c) after exposure to 0.1, 0.5, and 3 mg/L PSNP.
ns) and light (striped columns) intervals. Data are presented asmeans±SE. Asterisk
Fig. 4. Seconds spent by 120 hpf larvae in well center (solid columns) and well edge (striped columns) during visual test dark (a) and light (b) periods, and during auditory
tapping test (c) after exposure to 0.1, 0.5, and 3 mg/L polystyrene NP. Data are presented as means ± SE. Red asterisk above bar denotes significant difference between
treatment and control (p < 0.05). Black asterisk denotes difference between treatments.
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 1624063.5. Molecular and enzymatic response after PSNP exposure
We have investigated changes in expression profiles of different genes
involved in endocrine related pathways (thyroid, adrenal, and dopamine)
in 120 hpf ZF embryos as a result of PSNP exposure. Results show that in
general pathways were affected in a dose-dependent manner but direction
and relative difference varied depending on each gene studied (Fig. 6).
Gene transcripts involved in the hypothalamic–pituitary- thyroid (HTA)
axis were affected (Fig. 6a), with significant concentration-dependent
downregulation of trh, trhr, and tshb, and significant dose-dependent up-
regulation of tshr, trα, and ugt1ab. With regards to gene transcripts from
the Hypothalamus-pituitary-interrenal (HPA) axis (Fig. 6b), we found
significant concentration-dependent upregulation for crha, crhpb, and
acthb, and a biphasic response for crhb, with significant upregulation
at 0.1 and 0.5mg/L that decreased at 3mg/L, but continued to be higher
than control. Gene transcripts involved in dopamine metabolism were
also affected (Fig. 6c), with significant concentration-dependent upreg-
ulation of th1, and a biphasic response for drd2a and drd2b, with signif-
icant upregulation with respect to control at all doses but with the
highest upregulation at 0.5 mg/L.
The acetylcholinesterase enzyme in 120 hpf ZF larvae was altered by
PSNP exposure, with an observed generalized decrease of enzymatic
activity (Fig. 7). This decrease was significant for all treatments and
followed a slight concentration dependent manner with 0.1, 0.5, and
3 mg/L exposed larvae having 18, 19, and 20 % less activity than con-
trols respectively (Fig. 7).4. Discussion
Nanoplastics are emergent contaminants that are predicted to
increase in concentration in all environmental compartments due
mainly to degradation of the vast amounts of macroplastics deposited
in oceans/landfills since the 1970s, but also by direct emissions of
NP in personal care and industrial products (Geyer et al., 2017;
Hernandez et al., 2017). Despite technical difficulties, NP have recently
been found in environmental compartments such as the ocean, coastal
areas, polar ice, freshwater bodies, and the atmosphere (Davranche
et al., 2020; Materić et al., 2022a; Materić et al., 2022b; Materić
et al., 2022c; Wahl et al., 2021). In a recent work Materić et al.
(2022c) found NP in Swedish lakes and streams with an average con-
centration of 0.56 mg/L. This confirms that NP concentrations used
for ZF exposure in the present work are indeed possible to encounter
in the environment.7Little is known about potential NP toxic effect mechanisms on aquatic
and terrestrial organisms, and human beings. Since MP have been found
in several human tissues such as blood, lungs, gastrointestinal tract, and
placenta (Gruber et al., 2022; Jenner et al., 2022; Leslie et al., 2022;
Ragusa et al., 2021; Schwabl et al., 2019), its only logical to assume NP
can be present in human bodies. However, due to analytical difficulties,
no data exist yet in this regard. If NP are able to cross the human placenta
and blood brain barrier as in vitro and in vivo studies suggest (Aghaei
et al., 2022; Hoelting et al., 2013; Hwang et al., 2022; Shan et al., 2022)
it is of the outmost importance to evaluate their possible early endocrine
and neurotoxic effects. Our study has used a broad battery of assays, from
molecular to physiological, including genetic effects, enzymatic, morpho-
logical and behavioral assays. Our results show clear PSNP accumulation
in most organs and deleterious effects ranging from the organism to
the molecular level that are in line with some of those previously
observed (Torres-Ruiz et al., 2021; Ullah et al., 2023).
4.1. Nanoplastic characterization
Most NP toxicity studies present the challenge of replicating howNP be-
have naturally when they are dispersed in different types of media (ocean
water, freshwater, etc.). In our case, PSNP characterization by TEM and
NTA showed individual particles had size in accordance with commercial
specifications (25.1 ± 4 nm) but particles agglomerated over time to a
mean size of 100 nm in all concentrations, in spite of thorough sonication
(Fig. 1a and Fig. A.1). No attemptwasmade to correct this particle behavior
as the addition of surfactants could confound toxicity measurements
(Bruinink et al., 2015; Summers et al., 2018). In addition, agglomeration
of particles better represents natural conditions (Alimi et al., 2018; Lins
et al., 2022) and it may alter their toxicity. For example, it has been
shown that non-agglomerated polystyrene particles were less toxic for
the invertebrate Daphnia magna (Vaz et al., 2021) but more toxic for
the rotifer Brachionus plicatilis (Manfra et al., 2017). Different treat-
ments such as sonication or addition of surfactant agents have been
used to decrease aggregation (Eitzen et al., 2020). However, agglomer-
ates are likely to be formed again in test mediumwith time and, once in-
side the model organism, particular agglomeration/de-agglomeration
mechanisms could be occurring in different organs or tissues that
could affect toxicity and clearance time (Bruinink et al., 2015). More-
over, the lack of correlation between degree of toxicity and PSNP parti-
cle size observed in a review of ZF embryo studies (Torres-Ruiz et al.,
2021) could be due to different patterns of agglomeration in different
test media. It is clear that future studies should monitor aggregation pat-
terns and include data on this issue in published articles.
Fig. 5. Distance traveled per second during tapping intervals by 120 hpf larvae exposed to 0.1 mg/L (a; green line), 0.5 mg/L (b; black line), and 3 mg/L (c; orange line)
polystyrene NP compared to controls (blue line). Each symbol along a line represents distance traveled in a one second interval. Tapping period starts at black arrow and
continues every second for 30 s. After a 15 min pause (x axis break), a second tapping interval starts (second black arrow). Data are presented as means. Slopes of
distance traveled/time for each tapping interval were calculated and presented as mC for control slope and mT for treatment slope. Asterisk above lines denotes significant
differences between treatment and control in specific time points (p < 0.05).
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 162406
8
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 1624064.2. Nanoparticle accumulation
PSNP were observed to accumulate in most organs (Fig. 1). Accumula-
tion started as soon as PSNP were added to the medium and increased
from 24 to 72 hpf (Fig. 1 b-d). Embryos protected by the chorion had less
overall PSNPfluorescence comparedwith hatched embryos. Thiswas unex-
pected since our PSNP size of 30 nm is well below the ZF chorion pore di-
ameter of ~200 nm (Van Pomeren et al., 2017). However, since electron
microscopy showed PSNP aggregation, and lumps of PSNP were observed
stuck to the chorion, it is clear that it is serving as a protective barrier
against PSNP penetration due to an increase in particle effective diameter
(Fig. 1c). Nevertheless, embryos at 48 hpf showed fluorescence mainly in
the yolk (Fig. 1c) and after hatching (72 hpf) we could observe an increase
in PSNP fluorescence in other organs as well (Fig. 1 d, e). As observed be-
fore, the yolk had the highest degree of PSNP accumulation, probably selec-
tively aggregating them due to its lipophilic nature. The manner in which
NP are able to penetrate the yolk sac epithelium deserves further study,
and the ZF is an excellent model as it shares several yolk characteristics
with humans over the first weeks of their development (Sant and Timme-
Laragy, 2018). NP probably travel from the yolk to the embryofirst through
the yolk syncytial layer (Osborne et al., 2013) and then through the circu-
latory system (Hwang et al., 2022) although the exact mechanisms for
this remain largely unknown.
The digestive tract was the secondmost affected by PSNP accumulation
(Fig. 2h), with particles observed mostly in the gut, liver, and pancreas, as
observed before (Brun et al., 2018; Brun et al., 2019). Accumulation in
these organs could come directly from the yolk but also by NP ingestion,
after 72 hpf, when embryos' mouths start to function (Van Pomeren et al.,
2017). In addition, larvae were observed ejecting PSNP from the anal
pore (Video A.1) but this discharge rate was not calculated and deserves
further study in order to better understand NP metabolism, toxicokinetics,
and clearance rates.
The brain and important sensory organs such as the eyes and lateral line
were also shown to accumulate PSNP (Fig. 1f, g). Few studies have shown
accumulation of NP in lateral line organs (Brun et al., 2018; Parenti et al.,
2019). However, eye accumulation has been frequently observed before
in larvae exposed to different PSNP sizes and concentrations (Van
Pomeren et al., 2017; Zhang et al., 2020a; Zhang and Goss, 2020). The pos-
sibility of NP affecting ZF visual capacity has seldom been studied specifi-
cally, although the expression of some eye pigment and retinal system
genes have been shown to be affected in exposed larvae (Zhang et al.,
2020a; Liu et al., 2022). Accumulation in the larval ZF brain was observed
by 44 % studies examining PSNP distribution, and genes and metabolites
related to CNS function have been shown to be affected as well (Zhang
et al., 2020a; Teng et al., 2022). Moreover, PSNP have been shown to in-
crease nervous system cell apoptosis and affect motor neuron development
(Teng et al., 2022; Zhang et al., 2022). Therefore, behavioral changes ob-
served in PSNP exposed larvae (see below) could be a result of PSNP accu-
mulation and disruption of both the central nervous system and sensory
organs.
4.3. Morphological and cardiac effects
Few studies have addressed morphological defects as a result of NP ex-
posure (Torres-Ruiz et al., 2021). In this study, body length, curvature, yolk
size, and otolith diameter were not affected by PSNP exposure (Fig. 2 d-f).
This is in agreement with other studies (Brun et al., 2019) but contrary to
others (Chen et al., 2017) using similar concentrations and particle size.
On the other hand, we observed a decrease in eye and head size (Fig. 2a,
b). Since whole body length was not affected, it is possible that head and
sensory organ are especially affected by PSNP exposure. Although head
size was only slightly affected, the range of eye size decrement observed
has been shown to be important for adaptation in other fish species
(Lisney et al., 2020). Potential mechanisms behind these effects could in-
clude disruption of neuronal and eye cell proliferation (Hill et al., 2003;
Huang et al., 2013) as a result of PSNP accumulation (Fig. 1f). This is9supported by previous ZF studies that have found downregulation of
CNS and eye pigment gene expression (Zhang et al., 2020a; Liu et al.,
2021a). Future work should consider this as a possible mechanisms un-
derlying NP neurotoxicity.
Another important observed malformation is an increase in heart
area with PSNP exposure at the highest concentration caused by cardiac
edema (Fig. 2c). However, even though we observed bradycardia due to
fluorescent PSNP exposure (Fig. A.3) we could not test this endpoint for
the present study due to technical difficulties. Nevertheless, cardiotoxic
effects (mainly bradycardia) have been observed before for PSNP ex-
posed ZF (Duan et al., 2020; Hu et al., 2020; Dai et al., 2023). Possible
explanations for cardiotoxicity include activation of the hydrocarbon
aryl receptor (Shankar et al., 2020), effects on vascular endothelial
growth factor system (Dai et al., 2023), or NP accumulation in sarcomeres
(Pitt et al., 2018) that elicit a decrease in cardiomyocite proliferation, as
both have been shown to be common cardiotoxicity mechanisms (Chen,
2013; Nguyen and Bradfield, 2008).
4.4. Behavioral effects
Neurotoxic effects of PSNP exposure were evaluated through a series
of behavioral endpoints. Our study confirms PSNP are neurotoxic but
specific adverse effects were dependent on the behavior studied and
development time.
ZF embryos develop a first motor response at about 24 hpf by spontane-
ous tail bursts generated by primal muscle innervation that have been
shown to be a first screen mechanism of developmental neurotoxicity (de
Oliveira et al., 2021; Saint-Amant and Drapeau, 1998). Our studymeasured
these coils at 24 hpf ± 1 h and so they can be considered representative.
Results show PSNP had an effect on tail coiling activity, with a concentra-
tion dependent increase in burst counts per minute but a decrease in
burst duration (Fig. 3a, b). Hyperactivity was also observed during the
light/dark locomotor response test at 120 hpf but only at the two lowest
concentrations, with a decrease of activity at 3 mg/L, showing that increas-
ing the duration of exposure caused larvae to switch activity patterns. Con-
sidering several genes, involving oxidative stress, cell death, and hormonal
balance were specially altered at this concentration at 120 hpf (Martin-
Folgar et al., 2023, Figs. 3, 5, 6), it is clear that this decrease in movement
implies a greater effect of PSNP toxicity. In addition, even though we did
not test higher concentrations for the present work, a preliminary study
done for dose-ranging (results not shown) revealed that a concentration
of 5 mg/L caused larvae to be practically immobile. Taken together, these
results suggest a gradual increase of activity at intermediate concentrations
that then progressively decreases to severe hypoactivity. This type of
hormetic response is typical of endocrine disruption (Martínez et al.,
2019) and could explain why both hypoactivity and hyperactivity have
been found in previous studies of NP effects (Torres-Ruiz et al., 2021;
Manuel et al., 2022). Alterations in carbohydrate and cortisol metabolism
caused by PSNP have been proposed as possible explanations for hyperac-
tivity (Brun et al., 2019; Faught and Vijayan, 2021) but disruption of
neuromotor control pathways could also play a role (Pedersen et al.,
2020; Zhang et al., 2022). On the other hand, the generalized hypoactivity
observed at the highest concentration could be due to increase brain PSNP
accumulation that could causemajor alterations at the molecular and cellu-
lar levels, causing overall cytotoxicity and brain cell apoptosis (Chen et al.,
2017; Hu et al., 2020; Teng et al., 2022). Further evidence of this is found in
our previous work (Martin-Folgar et al., 2023) in which we found genes
encoding for superoxide dismutase (sod 1 and 2), apoptotic genes (cas 1
and 8), and interleukin 1-β (il1β) were highly activated at the concentration
of 3 mg/L, suggesting overall increase in cellular stress at this concentra-
tion. A possible mechanism of toxicity influencing behavioral alterations
is acetylcholinesterase (AchE) inhibition. In this study (Fig. 7) and in a
previous gene expression study (Martin-Folgar et al., 2023) we have
found a decrease in AchE at all concentrations. Therefore, the decrease in
mRNA expression correlates with a decrease in protein activity. It is possi-
ble that, together with other molecular mechanisms, AchE inhibition is
Fig. 6. Expression profiles of genes related to the HPT axis (a), the HPA axis (b), and dopamine metabolism (c). Data are presented as mean fold difference with respect to
controls ± SE. Asterisk above bar denotes significant difference between treatment and control (p < 0.05).
Fig. 7. Acetylcholinesterase activity of 120 hpf larvae exposed to 0.1, 0.5, and
3 mg/L PSNP. Data are presented as mean percent with respect to controls ± SE.
Asterisk above bar denotes significant difference between treatment and control
(p < 0.05).
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 162406
10part of what is causing hyperactivity at lower concentrations. However, ef-
fects on AchE could be interacting with other possible mechanisms such as
disruption of dopamine metabolism. Dopamine agonists have been shown
to induce hyperactivity in mice and ZF, presenting a biphasic response
(Ek et al., 2016). Our results show upregulation of a gene involved in dopa-
mine production (th1) and the dopamine receptors drd2a and drd2b
(Fig. 6c), that could be contributing to the hyperactive phenotype. Alter-
ations in dopaminergic metabolites have been observed before in relation
to behavioral alterations in ZF embryos exposed to PSNP (Hwang et al.,
2022) but in this work no genetic changes were observed. In addition, con-
tribution of other factors such as hormone-related imbalances could also
play a role in the activity patterns observed (see below).
In regards to anxiety related effects, our study is the first to assess
consequences of PSNP exposure on thigmotaxis behavior in ZF larvae, in re-
sponse to visual and auditory stimuli. Thiswall hugging innate response is a
measure of anxiety and has been used extensively to study rodent response
to anxiolytic and anxiogenic drugs/toxicants (Estrela et al., 2021; Karl et al.,
2003; Prut and Belzung, 2003). Moreover, it has also been shown to be a re-
liable anxiety-like behavior measurement in the ZF embryomodel (Schnörr
et al., 2012), and recently also in humans (Gromer et al., 2021). The central
assumption for this endpoint is that larvae avoid the center of the well
(open space) due to an innate fear of predators and prefer to move along
the edges, especially during stress periods. Results from this study show
that response depended on type of stimulus. PSNP elicited an anxiogenic
effect in response to visual stimuli at low and intermediate concentrations
but anxiolytic effects at the highest concentration (Fig. 4a, b), contrary to
effects observed by Manuel et al. (2022) who observed a decrease in anxi-
ety at concentrations higher than 0.1 mg/L. This type of response has
been shown for some drugs with contrasting effects of visual thigmotaxis
depending on concentration. For example, the serotonergic drug 3,4-
methylenedioxymethamphetamine (MDMA) causes anxiogenic effects at
lower concentrations and anxiolytic effects at higher concentrations (Lin
et al., 1999). Moreover, these results are in line with results observed for
the light/dark locomotion assay, so it could be concluded that PSNP elicited
hyperactivity combined with increased anxiety at the lower concentrations
and hypoactivity and lower anxiety at the highest concentration. On the
Fig. 8. Proposed adverse outcome pathway for NP toxicity related to endocrine and neurotoxic effects. KE: key event. AO: adverse outcome. Events in italics were not tested
directly by authors.
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 162406other hand, in response to auditory stimuli, PSNP had an anxiolytic effect
that was dose dependent (Fig. 4c). Even though few studies have ever com-
pared thigmotaxis effects due to both visual and auditory cues, a study with
rats revealed this behavior can differ in response to different stimuli, with
rats exposed to noise spending less time in the center than rats exposed to
light only (Hirsjarvi and Junnila, 1986).
Another measure of anxiety is the startle response: This reflex behavior
is shared by all vertebrates and is related to activation of brainstem motor
neurons byMauthner cells in ZF or similar neurons in the caudal pontine re-
ticular formation in humans (Eaton et al., 2001; Weber et al., 2008). It has
been a model for sensorimotor response, anxiety, and attention in many
species due to its translational value (Fendt and Koch, 2013). Moreover,
its defects are related to human neurological disorders such as anxiety,
attention deficit or schizophrenia (Fetcho and McLean, 2009; Poli and
Angrilli, 2015). Our results show that larvae exposed to the two lower
PSNP concentrations had a higher startle response than controls (Fig. 5a,
b) whereas larvae exposed to the highest concentration had a dimin-
ished response (Fig. 5c). Therefore, at these two lower PSNP concentra-
tions, larvae that were more anxious, according to visual thigmotaxis
experiment, responded with a stronger startle. However, at the highest
concentration, 120 hpf larvae seem to have an overall decrease in move-
ment, anxiety, and startle response, and in this case PSNP are mimicking
a sedative more than an anxiolytic drug (Schallek and Schlosser, 1979).
Interestingly, when comparing startle behavior with thigmotaxis in
response to sound, the pattern is not similar for the two lower concen-
trations. Possible explanations include different neuronal pathways
controlling both responses that could be affected differentially by
PSNP. In addition, lateral line disruption by PSNP cannot be ruled out
due to particular accumulation in neuromasts observed (Fig. 1g).11Habituation is a form of early learning exhibited by all vertebrates, and
consists on reduced reaction to repeated stimuli (Roberts et al., 2016). In
ZF, habituation has been linked to theN-methyl-D-aspartate (NMDA) recep-
tor and protein synthesis, and toxicants can affect how larvae modulate this
response (Best et al., 2008; Roberts et al., 2011). In this study, we found no
evidence of PSNP effects on habituation (Fig. 5), despite disruption in loco-
motion and anxiety responses.
4.5. Hormone disruption effects
In order to assess possible endocrine disruption effects of PSNP we
have examined transcription of genes related to the HPT and HPA
axes. The HPT axis is an important feedback control in the neuroendo-
crine system responsible for the regulation of thyroid hormones that
in turn regulate metabolism and stress response (Hoermann et al.,
2015). On the other hand, the HPA axis regulates glucocorticoid, epi-
nephrine and norepinephrine production and thus is important in stress
control but also in other body processes such as digestion, immune sys-
tem, energy use, and sexuality (Rey et al., 2008). Our study shows that
both pathways were affected by PSNP exposure albeit in different de-
grees and directions depending on specific genes (Fig. 6a, b).
Genes related to thyroid function were affected by down regulation
at the level of hypothalamus (trh), and pituitary (trhr and tshb), and up
regulation at thyroid (tshr) and thyroid hormone metabolism in target
tissues (thrα, ugt1ab) levels (Fig. 6a). This implies an overall alteration
of the HPT axis that could result in an imbalance of thyroid hormone
metabolism similarly to those observed before in NP exposed ZF and
rats (Amereh et al., 2019; Zhao et al., 2020). In the present study, this
could be part of the reason for some of the observed phenotypes such
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 162406as decreased eye or head size (Baumann et al., 2016; Fang et al., 2022).
In addition, it could be contributing to altered behavioral phenotypes,
as hyperactivity has been shown before in ZF with unbalanced thyroid
hormone levels (Walter et al., 2019).
Genes related to the HPA axis were affected mainly by upregulation of
crha and crhb at the hypothalamus and upregulation of acthb at the pituitary
(Fig. 6b). In addition, we also observed upregulation of crhbp, thought to
regulate bioavailability of Corticotropin Releasing Hormone (CRH)
(Westphal and Seasholtz, 2006). These effects could be partly responsible
for hyperactivity and altered anxiety responses observed as increased
cortisol levels have been shown to induce hyperactive phenotypes in
NP exposed ZF (Amereh et al., 2019; Brun et al., 2019; Walter et al.,
2019). Future studies should consider the potential role of NP contami-
nation in the increase levels of anxiety and depression observed in the
overall human population in recent years as it has been proposed that
anxiety problems are related to environmental pollution and NP could
potentially be part of this problem (da Costa Araújo and Malafaia,
2021; Trushna et al., 2021).
4.6. NP adverse outcome pathway
Our study has been the first to combine a battery of behavioral assays
with endocrine disruption markers to assess potential NP toxicity. Our
present results clearly show that even in an aggregated form and at low con-
centrations, these toxicants can alter hormonal homeostasis that could re-
sult, in combination with neurotransmitter disturbances, in observed
hyperactive and anxious phenotypes at low concentrations. In combination
with our previous results (Martin-Folgar et al., 2023), we propose an ad-
verse outcome pathway (AOP) for NP toxicity (Fig. 8). Polystyrene NP
AOP would start with molecular initiating events such as the physical dis-
ruption of membranes that could cause organelle damage and of particular
importance, lysosome and mitochondrial damage (Matthews et al., 2021;
Yang and Wang, 2023). This would generate oxidative stress (i.e. ROS
production) that could induce the activation of antioxidant mechanisms
(i.e. SOD, catalases) and increased interleukin and caspase production
(i.e. interleukin 1-β, caspases 1 and 8) (Martin-Folgar et al., 2023). In addi-
tion, molecular events in the CNS could include an effect on neurotransmit-
ters (i.e. acetylcholine, dopamine, Figs. 6, 7) and brain-produced hormones
(i.e. TSH, CRH, Fig. 6). At the cellular level, this would translate in
increased inflammation and cell death by apoptosis (Teng et al., 2022),
neuronal dysfunction, and/or altered energy metabolism (Manuel et al.,
2022). At the organ/tissue level, the abovemechanisms could cause altered
brain or sensory organ development, hormonal imbalances, and heart ab-
normalities. In addition, other organs such as pancreas or liver could also
be affected considering PSNP accumulation (Fig. 1h) and previous litera-
ture findings of hepatic inflammation (Cheng et al., 2022). At the whole
organism level, the present study has observed altered behaviors such as in-
creased activity and anxiety at lower doses and lethargy at a high dose. The
effects on these behaviors could be due to a variety of complexmechanisms
ranging from sensory organ and CNS effects to others such as hormonal im-
balances or altered energy metabolism.
This predicted AOP is similar to others proposed for NP toxicity, espe-
cially in regards to ROS production as a molecular initiating event, activa-
tion of the immune system, and energy metabolism alterations (Hu and
Palić, 2020; Liu et al., 2021c). Whole organism effects in AOPs have been
proposed to range from growth inhibition to developmental abnormalities
(Liu et al., 2021c) to behavioral changes, such as the ones observed in the
present work and other works reviewed in Hu and Palić, 2020. However,
our study is the first to show endocrine disruption as part of potential mo-
lecular initiating events in PSNP induced adverse outcome.
Our study has shown that PSNP can have important toxic effects
even in an aggregated form. Considering the concentration of these tox-
icants are predicted to increase considerably in the next years (Lebreton
et al., 2019), it is crucial to continue investigating their mechanisms of
action and potential health effects. Even though this study centered in
endocrine-related and neurotoxic effects, it is clear that PSNP can12accumulate in other organs and could also affect them. Future studies
should consider their relation to important human diseases that have in-
creased in incidence in the last few years such as autism or hyperactivity
disorders, anxiety, depression, neurodegenerative processes, and meta-
bolic diseases, among others.
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.scitotenv.2023.162406.
CRediT authorship contribution statement
All authors contributed to the conception and design of the study.
Monica Torres-Ruiz: Conceptualization, methodology, formal analysis,
research, writing, preparation of the original draft, review and editing.
Mercedes de Alba: Methodology, formal analysis, research, review
and editing.
Monica Morales: Methodology, formal analysis, research, review
and editing.
Raquel Martín-Folgar: Methodology, formal analysis, research, review
and editing.
Ma. Carmen González: Methodology, formal analysis, research, review
and editing.
Ana I. Cañas-Portilla: Conceptualization, methodology, formal analysis,
research, writing, review, editing, and supervision.
Antonio De la Vieja: Conceptualization, methodology, formal analysis,
research, writing, review, editing, and supervision.
Data availability
Data will be made available on request.
Declaration of competing interest
The authors declare that they have no known competing financial inter-
ests or personal relationships that could have appeared to influence the
work reported in this paper.
Acknowledgments
We thank Mari Paz Lopez-Molina and Ana Montero Calle for laboratory
technical assistance and Diego Megias for confocal microscopy assistance.
Funding
This work was supported by the Joint Research Institute IMIENS
(Grant Number: IMIENS-2020-001-PIC), and the Spanish Government
(Grant Number: PID2021-125948OB-I00 from MCIN/AEI/10.13039/
501100011033/FEDER, UE to ADV).
References
Aghaei, Z., Sled, J.G., Kingdom, J.C., Baschat, A.A., Helm, P.A., Jobst, K.J., et al., 2022. Mater-
nal exposure to polystyrene micro-and nanoplastics causes fetal growth restriction in
mice. Environ. Sci. Technol. Lett. https://doi.org/10.1021/acs.estlett.2c00186.
Alimi, O.S., Farner, Budarz J., Hernandez, L.M., Tufenkji, N., 2018. Microplastics and
nanoplastics in aquatic environments: aggregation, deposition, and enhanced contami-
nant transport. Environ. Sci. Technol. 52, 1704–1724. https://doi.org/10.1021/acs.est.
7b05559.
Amereh, F., Eslami, A., Fazelipour, S., Rafiee, M., Zibaii, M.I., Babaei, M., 2019. Thyroid en-
docrine status and biochemical stress responses in adult male Wistar rats chronically ex-
posed to pristine polystyrene nanoplastics. Toxicol. Res. (Camb) 8, 953–963. https://doi.
org/10.1039/C9TX00147F.
Andrady, A.L., 2017. The plastic in microplastics: a review. Mar. Pollut. Bull. 119, 12–22.
https://doi.org/10.1016/j.marpolbul.2017.01.082.
Baumann, L., Ros, A., Rehberger, K., Neuhauss, S.C., Segner, H., 2016. Thyroid disruption in
zebrafish (Danio rerio) larvae: different molecular response patterns lead to impaired eye
development and visual functions. Aquat. Toxicol. 172, 44–55. https://doi.org/10.1016/
j.aquatox.2015.12.015.
Best, J.D., Berghmans, S., Hunt, J.J.F.G., Clarke, S.C., Fleming, A., Goldsmith, P., et al., 2008.
Non-associative learning in larval zebrafish. Neuropsychopharmacology 33, 1206–1215.
https://doi.org/10.1038/sj.npp.1301489.
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 162406Bhagat, J., Zang, L., Nishimura, N., Shimada, Y., 2020. Zebrafish: an emerging model to study
microplastic and nanoplastic toxicity. Sci. Total Environ. 728, 138707. https://doi.org/
10.1016/j.scitotenv.2020.138707.
Bourdineaud, J.P., Rossignol, R., Brèthes, D., 2013. Zebrafish: a model animal for analyzing
the impact of environmental pollutants onmuscle and brain mitochondrial bioenergetics.
Int. J. Biochem. Cell Biol. 45, 16–22. https://doi.org/10.1016/j.biocel.2012.07.021.
Bruinink, A., Wang, J., Wick, P., 2015. Effect of particle agglomeration in nanotoxicology.
Arch. Toxicol. 89, 659–675. https://doi.org/10.1007/s00204-015-1460-6.
Brun, N.R., Koch, B.E.V., Varela, M., Peijnenburg, W.J.G.M., Spaink, H.P., Vijver, M.G., 2018.
Nanoparticles induce dermal and intestinal innate immune system responses in zebrafish
embryos. Environ. Sci.Nano 5, 904–916. https://doi.org/10.1039/c8en00002f.
Brun, N.R., van Hage, P., Hunting, E.R., Haramis, A.G., Vink, S.C., Vijver, M.G., et al., 2019.
Polystyrene nanoplastics disrupt glucose metabolism and cortisol levels with a possible
link to behavioural changes in larval zebrafish. Commun. Biol. 2, 1–9. https://doi.org/
10.1038/s42003-019-0629-6.
Chae, Y., An, Y.J., 2017. Effects of micro- and nanoplastics on aquatic ecosystems: current re-
search trends and perspectives. Mar. Pollut. Bull. 124, 624–632. https://doi.org/10.
1016/j.marpolbul.2017.01.070.
Chae, Y., An, Y.J., 2020. Nanoplastic ingestion induces behavioral disorders in terrestrial
snails: trophic transfer effects via vascular plants. Environ. Sci. Nano 7, 975–983.
https://doi.org/10.1039/C9EN01335K.
Chang, X., Xue, Y., Li, J., Zou, L., Tang, M., 2020. Potential health impact of environmental
micro- and nanoplastics pollution. J. Appl. Toxicol. 40, 4–15. https://doi.org/10.1002/
jat.3915.
Chen, J., 2013. Impaired cardiovascular function caused by different stressors elicits a com-
mon pathological and transcriptional response in zebrafish embryos. Zebrafish 10,
389–400. https://doi.org/10.1089/zeb.2013.0875.
Chen, Q., Gundlach, M., Yang, S., Jiang, J., Velki, M., Yin, D., et al., 2017. Quantitative inves-
tigation of the mechanisms of microplastics and nanoplastics toward zebrafish larvae lo-
comotor activity. Sci. Total Environ. 584–585, 1022–1031. https://doi.org/10.1016/j.
scitotenv.2017.01.156.
Cheng, H., Duan, Z., Wu, Y., Wang, Y., Zhang, H., Shi, Y., et al., 2022. Immunotoxicity
responses to polystyrene nanoplastics and their related mechanisms in the liver of
zebrafish (Danio rerio) larvae. Environ. Int. 161, 107128. https://doi.org/10.
1016/j.envint.2022.107128.
da Costa Araújo, A.P., Malafaia, G., 2021. Microplastic ingestion induces behavioral
disorders in mice: a preliminary study on the trophic transfer effects via tadpoles
and fish. J. Hazard. Mater. 401, 123263. https://doi.org/10.1016/j.jhazmat.2020.
123263.
d’Amora, M., Giordani, S., 2018. The utility of zebrafish as a model for screening developmen-
tal neurotoxicity. Front. Neurosci. 12, 976. https://doi.org/10.3389/fnins.2018.00976.
Dai, L., Luo, J., Feng, M., Wang, M., Zhang, J., Cao, X., et al., 2023. Nanoplastics expo-
sure induces vascular malformation by interfering with the VEGFA/VEGFR pathway
in zebrafish (Danio rerio). Chemosphere 312, 137360. https://doi.org/10.1016/j.
chemosphere.2022.137360.
Davranche, M., Lory, C., Juge, C.L., Blancho, F., Dia, A., Grassl, B., et al., 2020. Nanoplastics
on the coast exposed to the North Atlantic gyre: evidence and traceability. NanoImpact
20, 100262. https://doi.org/10.1016/j.impact.2020.100262.
Deville, S., Penjweini, R., Smisdom, N., Notelaers, K., Nelissen, I., Hooyberghs, J., et al.,
2015. Intracellular dynamics and fate of polystyrene nanoparticles in A549 lung ep-
ithelial cells monitored by image (cross-) correlation spectroscopy and single parti-
cle tracking. Biochim. Biophys. Acta 1853, 2411–2419. https://doi.org/10.1016/j.
bbamcr.2015.07.004.
Duan, Z., Duan, X., Zhao, S., Wang, X., Wang, J., Liu, Y., et al., 2020. Barrier function of
zebrafish embryonic chorions against microplastics and nanoplastics and its impact on
embryo development. J. Hazard. Mater. 395, 122621. https://doi.org/10.1016/j.
jhazmat.2020.122621.
Eaton, R.C., Lee, R.K.K., Foreman, M.B., 2001. The mauthner cell and other identified neurons
of the brainstem escape network of fish. Prog. Neurobiol. 63, 467–485. https://doi.org/
10.1016/S0301-0082(00)00047-2.
Eitzen, L., Ruhl, A.S., Jekel, M., 2020. Particle size and pre-treatment effects on polystyrene
microplastic settlement in water: implications for environmental behavior and ecotoxico-
logical tests. Water 12, 3436. https://doi.org/10.3390/w12123436.
Ek, F., Malo, M., Åberg Andersson, M., Wedding, C., Kronborg, J., Svensson, P., et al.,
2016. Behavioral analysis of dopaminergic activation in zebrafish and rats reveals
similar phenotypes. ACS Chemical Neuroscience 7, 633–646. https://doi.org/10.
1021/acschemneuro.6b00014.
Estrela, F.N., Guimarães, A.T.B., Araújo, A.P.D.C., Silva, F.G., Luz, T.M.D., Silva, A.M., et al.,
2021. Toxicity of polystyrene nanoplastics and zinc oxide to mice. Chemosphere 271,
129476. https://doi.org/10.1016/j.chemosphere.2020.129476.
Fang, Y., Wan, J.-P., Zhang, R.-J., Sun, F., Yang, L., Zhao, S., et al., 2022. Thyroid Peroxidase
Knockout in Zebrafish Recapitulates the Clinical Manifestations of Congenital Hypothy-
roidism and Reveals Thyroid Hormone Function to Maintain Glucose Homeostasis.
https://doi.org/10.2139/ssrn.4021894 SSRN; 3988615.
Faria, M., Prats, E., Novoa-Luna, K.A., Bedrossiantz, J., Gómez-Canela, C., Gómez-Oliván,
L.M., et al., 2019. Development of a vibrational startle response assay for screening envi-
ronmental pollutants and drugs impairing predator avoidance. Sci. Total Environ. 650,
87–96. https://doi.org/10.1016/j.scitotenv.2018.08.421.
Faught, E., Vijayan, M., 2021. Coordinated action of CRH and cortisol shapes acute stress-
induced behavioural response in zebrafish. Neuroendocrinology 112, 74–87. https://
doi.org/10.1159/000514778.
Fendt, M., Koch, M., 2013. Translational value of startle modulations. Cell Tissue Res. 354,
287–295. https://doi.org/10.1007/s00441-013-1599-5.
Fetcho, J.R., McLean, D.L., 2009. Startle response. In: Squire, L.R. (Ed.), Encyclopedia of
Neuroscience. Academic Press, Oxford, pp. 375–379 https://doi.org/10.1016/
B978-008045046-9.01973-2.13Gallego-Urrea, J.A., Tuoriniemi, J., Pallander, T., Hassellöv, M., 2010. Measurements of
nanoparticle number concentrations and size distributions in contrasting aquatic en-
vironments using nanoparticle tracking analysis. Environ. Chem. 7, 67–81. https://
doi.org/10.1071/EN09114.
Geyer, R., Jambeck, J.R., Law, K.L., 2017. Production, use, and fate of all plastics ever made.
Sci. Adv. 3, e1700782. https://doi.org/10.1126/sciadv.1700782.
Gigault, J., Ter Halle, A., Baudrimont, M., Pascal, P.-Y., Gauffre, F., Phi, T.-L., et al.,
2018. Current opinion: what is a nanoplastic? Environ. Pollut. 235, 1030–1034.
https://doi.org/10.1016/j.envpol.2018.01.024.
Gromer, D., Kiser, D.P., Pauli, P., 2021. Thigmotaxis in a virtual human open field test. Sci.
Rep. 11, 6670. https://doi.org/10.1038/s41598-021-85678-5.
Gruber, E.S., Stadlbauer, V., Pichler, V., Resch-Fauster, K., Todorovic, A., Meisel, T.C., et al.,
2022. To waste or not to waste: questioning potential health risks of micro-and
nanoplastics with a focus on their ingestion and potential carcinogenicity. Expos. Health
1–19. https://doi.org/10.1007/s12403-022-00470-8.
Hernandez, L.M., Yousefi, N., Tufenkji, N., 2017. Are there nanoplastics in your personal care
products? Environ. Sci. Technol. Lett. 4, 280–285. https://doi.org/10.1021/acs.estlett.
7b00187.
Hill, A., Howard, C.V., Strahle, U., Cossins, A., 2003. Neurodevelopmental defects in zebrafish
(Danio rerio) at environmentally relevant dioxin (TCDD) concentrations. Toxicol. Sci. 76,
392–399. https://doi.org/10.1093/toxsci/kfg241.
Hirsjarvi, P.A., Junnila, M.A., 1986. Effects of light and noise test stimuli on the open-
field behavior of wistar rats. Scand. J. Psychol. 27, 311–319. https://doi.org/10.
1111/j.1467-9450.1986.tb01209.x.
Hoelting, L., Scheinhardt, B., Bondarenko, O., Schildknecht, S., Kapitza, M., Tanavde, V., et
al., 2013. A 3-dimensional human embryonic stem cell (hESC)-derived model to detect
developmental neurotoxicity of nanoparticles. Arch. Toxicol. 87, 721–733. https://doi.
org/10.1007/s00204-012-0984-2.
Hoermann, R., Midgley, J.E.M., Larisch, R., Dietrich, J.W., 2015. Homeostatic control of
the thyroid-pituitary Axis: perspectives for diagnosis and treatment. Front.
Endocrinol. (Lausanne) 6. https://doi.org/10.3389/fendo.2015.00177.
Howe, K., Clark, M.D., Torroja, C.F., Torrance, J., Berthelot, C., Muffato, M., et al., 2013. The
zebrafish reference genome sequence and its relationship to the human genome. Nature
496, 498–503. https://doi.org/10.1038/nature12111.
Hu, Q., Wang, H., He, C., Jin, Y., Fu, Z., 2020. Polystyrene nanoparticles trigger the activation
of p38 MAPK and apoptosis via inducing oxidative stress in zebrafish and macrophage
cells. Environ. Pollut. 269, 116075. https://doi.org/10.1016/j.envpol.2020.116075.
Huang, L., Wang, C., Zhang, Y., Wu, M., Zuo, Z., 2013. Phenanthrene causes ocular develop-
mental toxicity in zebrafish embryos and the possible mechanisms involved. J. Hazard.
Mater. 261, 172–180. https://doi.org/10.1016/j.jhazmat.2013.07.030.
Hwang, K.S., Son, Y., Kim, S.S., Shin, D.S., Lim, S.H., Yang, J.Y., et al., 2022. Size-
dependent effects of polystyrene nanoparticles (PS-NPs) on behaviors and endoge-
nous neurochemicals in zebrafish larvae. Int. J. Mol. Sci. 23. https://doi.org/10.
3390/ijms231810682.
Jenner, L.C., Rotchell, J.M., Bennett, R.T., Cowen, M., Tentzeris, V., Sadofsky, L.R., 2022. De-
tection of microplastics in human lung tissue using μFTIR spectroscopy. Sci. Total Envi-
ron. 831, 154907. https://doi.org/10.1016/j.scitotenv.2022.154907.
Jeong, B., Baek, J.Y., Koo, J., Park, S., Ryu, Y.K., Kim, K.S., et al., 2022. Maternal exposure to
polystyrene nanoplastics causes brain abnormalities in progeny. J. Hazard. Mater. 426,
127815. https://doi.org/10.1016/j.jhazmat.2021.127815.
Karl, T., Pabst, R., von Hörsten, S., 2003. Behavioral phenotyping of mice in pharmacological
and toxicological research. Exp. Toxicol. Pathol. 55, 69–83. https://doi.org/10.1078/
0940-2993-00301.
Kik, K., Bukowska, B., Sicińska, P., 2020. Polystyrene nanoparticles: sources, occurrence in the
environment, distribution in tissues, accumulation and toxicity to various organisms. En-
viron. Pollut. 262, 114297. https://doi.org/10.1016/j.envpol.2020.114297.
Kimmel, C.B., Patterson, J., Kimmel, R.O., 1974. The development and behavioral character-
istics of the startle response in the zebra fish. Dev. Psychobiol. 7, 47–60. https://doi.org/
10.1002/dev.420070109.
Küster, E., 2005. Cholin- and carboxylesterase activities in developing zebrafish embryos
(Danio rerio) and their potential use for insecticide hazard assessment. Aquat. Toxicol.
75, 76–85. https://doi.org/10.1016/j.aquatox.2005.07.005.
Lebreton, L., Egger, M., Slat, B., 2019. A global mass budget for positively buoyant
macroplastic debris in the ocean. Sci. Rep. 9, 12922. https://doi.org/10.1038/s41598-
019-49413-5.
Lehner, R., Weder, C., Petri-Fink, A., Rothen-Rutishauser, B., 2019. Emergence of nanoplastic
in the environment and possible impact on human health. Environ. Sci. Technol. 53,
1748–1765. https://doi.org/10.1021/acs.est.8b05512.
Leslie, H.A., van Velzen, M.J.M., Brandsma, S.H., Vethaak, A.D., Garcia-Vallejo, J.J., Lamoree,
M.H., 2022. Discovery and quantification of plastic particle pollution in human blood. En-
viron. Int. 163, 107199. https://doi.org/10.1016/j.envint.2022.107199.
Letcher, T.M., 2020. Plastic waste and recycling: environmental impact. Societal Issues, Pre-
vention, and Solutions. Academic Press https://doi.org/10.1016/C2018-0-01939-8.
Li, Y., Liu, Z., Jiang, Q., Ye, Y., Zhao, Y., 2022. Effects of nanoplastic on cell apoptosis and ion
regulation in the gills of Macrobrachium nipponense. Environ. Pollut. 300, 118989.
https://doi.org/10.1016/j.envpol.2022.118989.
Lin, H.Q., Burden, P.M., Christie, M.J., Johnston, G.A., 1999. The anxiogenic-like and
anxiolytic-like effects of MDMA on mice in the elevated plus-maze: a comparison with
amphetamine. Pharmacol. Biochem. Behav. 62, 403–408. https://doi.org/10.1016/
s0091-3057(98)00191-9.
Lins, T.F., O’Brien, A.M., Zargartalebi, M., Sinton, D., 2022. Nanoplastic state and fate in
aquatic environments: multiscale modeling. Environ. Sci. Technol. 56, 4017–4028.
https://doi.org/10.1021/acs.est.1c03922.
Lisney, T.J., Collin, S.P., Kelley, J.L., 2020. The effect of ecological factors on eye morphology
in the western rainbowfish, Melanotaenia australis. J. Exp. Biol. 223. https://doi.org/10.
1242/jeb.223644.
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 162406Liu, Z., Yu, P., Cai, M., Wu, D., Zhang, M., Huang, Y., et al., 2019. Polystyrene nanoplastic ex-
posure induces immobilization, reproduction, and stress defense in the freshwater cladoc-
eran Daphnia pulex. Chemosphere 215, 74–81. https://doi.org/10.1016/j.chemosphere.
2018.09.176.
Liu, Y., Wang, Y., Ling, X., Yan, Z., Wu, D., Liu, J., et al., 2021a. Effects of nanoplastics
and butyl methoxydibenzoylmethane on early zebrafish embryos identified by
single-cell RNA sequencing. Environ. Sci. Technol. 55, 1885–1896. https://doi.
org/10.1021/acs.est.0c06479.
Liu, Z., Li, Y., Pérez, E., Jiang, Q., Chen, Q., Jiao, Y., et al., 2021b. Polystyrene nanoplastic in-
duces oxidative stress, immune defense, and glycometabolism change in Daphnia pulex:
application of transcriptome profiling in risk assessment of nanoplastics. J. Hazard.
Mater. 402, 123778. https://doi.org/10.1016/j.jhazmat.2020.123778.
Liu, Z., Li, Y., Sepúlveda, M.S., Jiang, Q., Jiao, Y., Chen, Q., et al., 2021c. Development of an
adverse outcome pathway for nanoplastic toxicity in Daphnia pulex using proteomics.
Sci. Total Environ. 144249. https://doi.org/10.1016/j.scitotenv.2020.144249.
Liu, Y., Wang, Y., Li, N., Jiang, S., 2022. Avobenzone and nanoplastics affect the development
of zebrafish nervous system and retinal system and inhibit their locomotor behavior. Sci.
Total Environ. 806, 150681. https://doi.org/10.1016/j.scitotenv.2021.150681.
Manfra, L., Rotini, A., Bergami, E., Grassi, G., Faleri, C., Corsi, I., 2017. Comparative
ecotoxicity of polystyrene nanoparticles in natural seawater and reconstituted seawater
using the rotifer Brachionus plicatilis. Ecotoxicol. Environ. Saf. 145, 557–563. https://
doi.org/10.1016/j.ecoenv.2017.07.068.
Manuel, P., Almeida, M., Martins, M., Oliveira, M., 2022. Effects of nanoplastics on zebrafish
embryo-larval stages: a case study with polystyrene (PS) and polymethylmethacrylate
(PMMA) particles. Environ. Res. 213, 113584. https://doi.org/10.1016/j.envres.2022.
113584.
Martínez, R., Herrero-Nogareda, L., Van Antro, M., Campos, M.P., Casado, M., Barata, C., et
al., 2019. Morphometric signatures of exposure to endocrine disrupting chemicals in
zebrafish eleutheroembryos. Aquat. Toxicol. 214, 105232. https://doi.org/10.1016/j.
aquatox.2019.105232.
Martin-Folgar, R., Torres-Ruiz, M., de Alba, M., Cañas-Portilla, A.I., González, M.C., Morales,
M., 2023. Molecular effects of polystyrene nanoplastics toxicity in zebrafish embryos
(Danio rerio). Chemosphere 312, 137077. https://doi.org/10.1016/j.chemosphere.
2022.137077.
Materić, D., Holzinger, R., Niemann, H., 2022a. Nanoplastics and ultrafine microplastic in the
dutchWadden Sea – the hidden plastics debris? Sci. Total Environ. 846, 157371. https://
doi.org/10.1016/j.scitotenv.2022.157371.
Materić, D., Kjær, H.A., Vallelonga, P., Tison, J.-L., Röckmann, T., Holzinger, R., 2022b.
Nanoplastics measurements in northern and southern polar ice. Environ. Res. 208,
112741. https://doi.org/10.1016/j.envres.2022.112741.
Materić, D., Peacock, M., Dean, J., Futter, M., Maximov, T., Moldan, F., et al., 2022c. Presence
of nanoplastics in rural and remote surface waters. Environ. Res. Lett. 17, 054036.
https://doi.org/10.1088/1748-9326/ac68f7.
Matthews, S., Mai, L., Jeong, C.-B., Lee, J.-S., Zeng, E.Y., Xu, E.G., 2021. Key mechanisms of
micro- and nanoplastic (MNP) toxicity across taxonomic groups. Comp. Biochem. Phys-
iol. C: Toxicol. Pharmacol. 247, 109056. https://doi.org/10.1016/j.cbpc.2021.109056.
Nguyen, L.P., Bradfield, C.A., 2008. The search for endogenous activators of the aryl hy-
drocarbon receptor. Chem. Res. Toxicol. 21, 102–116. https://doi.org/10.1021/
tx7001965.
de Oliveira, A.A.S., Brigante, T.A.V., Oliveira, D.P., 2021. Tail coiling assay in zebrafish
(Danio rerio) embryos: stage of development, promising positive control candidates,
and selection of an appropriate organic solvent for screening of developmental neurotox-
icity (DNT). Water 13, 119. https://doi.org/10.3390/w13020119.
Osborne, O.J., Johnston, B.D., Moger, J., Balousha, M., Lead, J.R., Kudoh, T., et al., 2013. Ef-
fects of particle size and coating on nanoscale ag and TiO2 exposure in zebrafish (Danio
rerio) embryos. Nanotoxicology 7, 1315–1324. https://doi.org/10.3109/17435390.
2012.737484.
Parenti, C.C., Ghilardi, A., Della, Torre C., Magni, S., Del Giacco, L., Binelli, A., 2019. Evalua-
tion of the infiltration of polystyrene nanobeads in zebrafish embryo tissues after short-
term exposure and the related biochemical and behavioural effects. Environ. Pollut.
254, 112947. https://doi.org/10.1016/j.envpol.2019.07.115.
Pedersen, A.F., Meyer, D.N., Petriv, A.V., Soto, A.L., Shields, J.N., Akemann, C., et al., 2020.
Nanoplastics impact the zebrafish (Danio rerio) transcriptome: associated developmental
and neurobehavioral consequences. Environ. Pollut. 266, 115090. https://doi.org/10.
1016/j.envpol.2020.115090.
Peng, L., Fu, D., Qi, H., Lan, C.Q., Yu, H., Ge, C., 2020. Micro- and nano-plastics in marine en-
vironment: source, distribution and threats— a review. Sci. Total Environ. 698, 134254.
https://doi.org/10.1016/j.scitotenv.2019.134254.
Pitt, J.A., Kozal, J.S., Jayasundara, N., Massarsky, A., Trevisan, R., Geitner, N., et al., 2018.
Uptake, tissue distribution, and toxicity of polystyrene nanoparticles in developing
zebrafish (Danio rerio). Aquat. Toxicol. 194, 185–194. https://doi.org/10.1016/j.
aquatox.2017.11.017.
Poli, E., Angrilli, A., 2015. Greater general startle reflex is associated with greater anxiety
levels: a correlational study on 111 young women. Front. Behav. Neurosci. 9. https://
doi.org/10.3389/fnbeh.2015.00010.
Prut, L., Belzung, C., 2003. The open field as a paradigm to measure the effects of drugs on
anxiety-like behaviors: a review. Eur. J. Pharmacol. 463, 3–33. https://doi.org/10.
1016/S0014-2999(03)01272-X.
Ragusa, A., Svelato, A., Santacroce, C., Catalano, P., Notarstefano, V., Carnevali, O., et al.,
2021. Plasticenta: first evidence of microplastics in human placenta. Environ. Int. 146,
106274. https://doi.org/10.1016/j.envint.2020.106274.
Repouskou, A., Papadopoulou, A.-K., Panagiotidou, E., Trichas, P., Lindh, C., Bergman,
Å., et al., 2020. Long term transcriptional and behavioral effects in mice develop-
mentally exposed to a mixture of endocrine disruptors associated with delayed
human neurodevelopment. Sci. Rep. 10, 9367. https://doi.org/10.1038/s41598-
020-66379-x.14Rey, A.D., Chrousos, G., Besedovsky, H., 2008. The Hypothalamus-Pituitary-Adrenal Axis:
Elsevier Science. https://www.elsevier.com/books/the-hypothalamus-pituitary-
adrenal-axis/del-rey/978-0-444-53040-0.
Rhodes, C.J., 2018. Plastic pollution and potential solutions. Sci. Prog. 101, 207–260. https://
doi.org/10.3184/003685018X15294876706211.
Roberts, A.C., Reichl, J., Song, M.Y., Dearinger, A.D., Moridzadeh, N., Lu, E.D., et al., 2011.
Habituation of the C-start response in larval zebrafish exhibits several distinct phases
and sensitivity to NMDA receptor blockade. PLoS One 6, e29132. https://doi.org/10.
1371/journal.pone.0029132.
Roberts, A.C., Pearce, K.C., Choe, R.C., Alzagatiti, J.B., Yeung, A.K., Bill, B.R., et al., 2016.
Long-term habituation of the C-start escape response in zebrafish larvae. Neurobiol.
Learn. Mem. 134, 360–368. https://doi.org/10.1016/j.nlm.2016.08.014.
Saint-Amant, L., Drapeau, P., 1998. Time course of the development of motor behaviors in the
zebrafish embryo. J. Neurobiol. 37, 622–632. https://doi.org/10.1002/(SICI)1097-4695
(199812)37:4<622::AID-NEU10>3.0.CO;2-S.
Sant, K.E., Timme-Laragy, A.R., 2018. Zebrafish as a model for toxicological perturbation of
yolk and nutrition in the early embryo. Current Environ. Health Reports 5, 125–133.
https://doi.org/10.1007/s40572-018-0183-2.
Schallek, W., Schlosser, W., 1979. Neuropharmacology of sedatives and anxiolytics. Mod.
Probl. Pharmacopsychiatry 14, 157–173. https://doi.org/10.1159/000401211.
Schnörr, S.J., Steenbergen, P.J., Richardson, M.K., Champagne, D.L., 2012. Measuring
thigmotaxis in larval zebrafish. Behav. Brain Res. 228, 367–374. https://doi.org/
10.1016/j.bbr.2011.12.016.
Schwabl, P., Köppel, S., Königshofer, P., Bucsics, T., Trauner, M., Reiberger, T., et al., 2019.
Detection of various microplastics in human stool. Ann. Intern. Med. 171, 453–457.
https://doi.org/10.7326/M19-0618.
Seralini, G.-E., Jungers, G., 2021. Endocrine disruptors also function as nervous disruptors and
can be renamed endocrine and nervous disruptors (ENDs). Toxicol. Rep. 8, 1538–1557.
https://doi.org/10.1016/j.toxrep.2021.07.014.
Shan, S., Zhang, Y., Zhao, H., Zeng, T., Zhao, X., 2022. Polystyrene nanoplastics penetrate
across the blood-brain barrier and induce activation of microglia in the brain of mice.
Chemosphere 298, 134261. https://doi.org/10.1016/j.chemosphere.2022.134261.
Shankar, P., Dasgupta, S., Hahn, M.E., Tanguay, R.L., 2020. A review of the functional roles of
the zebrafish aryl hydrocarbon receptors. Toxicolical Sciences 178, 215–238. https://doi.
org/10.1093/toxsci/kfaa143.
Summers, S., Henry, T., Gutierrez, T., 2018. Agglomeration of nano- andmicroplastic particles
in seawater by autochthonous and de novo-produced sources of exopolymeric substances.
Mar. Pollut. Bull. 130, 258–267. https://doi.org/10.1016/j.marpolbul.2018.03.039.
Tao, Y., Li, Z., Yang, Y., Jiao, Y., Qu, J., Wang, Y., et al., 2022. Effects of common envi-
ronmental endocrine-disrupting chemicals on zebrafish behavior. Water Res. 208,
117826. https://doi.org/10.1016/j.watres.2021.117826.
Teng, M., Zhao, X., Wu, F., Wang, C., Wang, C., White, J.C., et al., 2022. Charge-specific
adverse effects of polystyrene nanoplastics on zebrafish (Danio rerio) development and
behavior. Environ. Int. 163, 107154. https://doi.org/10.1016/j.envint.2022.107154.
Torres-Ruiz, M., De la Vieja, A., de Alba Gonzalez, M., Lopez, M.E., Calvo, A.C., Portilla, A.I.C.,
2021. Toxicity of nanoplastics for zebrafish embryos, what we know and where to go
next. Sci. Total Environ. 149125. https://doi.org/10.1016/j.scitotenv.2021.149125.
Trevisan, R., Voy, C., Chen, S., Di Giulio, R.T., 2019. Nanoplastics decrease the toxicity of a
complex PAH mixture but impair mitochondrial energy production in developing
zebrafish. Environ. Sci. Technol. 53, 8405–8415. https://doi.org/10.1021/acs.est.
9b02003.
Trushna, T., Dhiman, V., Raj, D., Tiwari, R.R., 2021. Effects of ambient air pollution on
psychological stress and anxiety disorder: a systematic review and meta-analysis of
epidemiological evidence. Rev. Environ. Health 36, 501–521. https://doi.org/10.
1515/reveh-2020-0125.
Ullah, R., Tsui, M.T.-K., Chow, A., Chen, H., Williams, C., Ligaba-Osena, A., 2023. Micro
(nano)plastic pollution in terrestrial ecosystem: emphasis on impacts of polystyrene on
soil biota, plants, animals, and humans. Environ. Monit. Assess. 195, 252. https://doi.
org/10.1007/s10661-022-10769-3.
Van Pomeren, M., Brun, N., Peijnenburg, W., Vijver, M., 2017. Exploring uptake and biodistri-
bution of polystyrene (nano) particles in zebrafish embryos at different developmental
stages. Aquat. Toxicol. 190, 40–45. https://doi.org/10.1016/j.aquatox.2017.06.017.
Vaz, V.P., Nogueira, D.J., Vicentini, D.S., Matias, W.G., 2021. Can the sonication of poly-
styrene nanoparticles alter the acute toxicity and swimming behavior results for
Daphnia magna? Environ. Sci. Pollut. Res. 28, 14192–14198. https://doi.org/10.
1007/s11356-021-12455-2.
Wahl, A., Le Juge, C., Davranche, M., El Hadri, H., Grassl, B., Reynaud, S., et al., 2021.
Nanoplastic occurrence in a soil amended with plastic debris. Chemosphere 262,
127784. https://doi.org/10.1016/j.chemosphere.2020.127784.
Walczak, A.P., Kramer, E., Hendriksen, P.J., Tromp, P., Helsper, J.P., van der Zande, M., et al.,
2015. Translocation of differently sized and charged polystyrene nanoparticles in in vitro
intestinal cell models of increasing complexity. Nanotoxicology 9, 453–461. https://doi.
org/10.3109/17435390.2014.944599.
Walter, K.M., Miller, G.W., Chen, X., Harvey, D.J., Puschner, B., Lein, P.J., 2019. Changes in
thyroid hormone activity disrupt photomotor behavior of larval zebrafish.
Neurotoxicology 74, 47–57. https://doi.org/10.1016/j.neuro.2019.05.008.
Wang, Y., Zhang, Y., Li, X., Sun, M., Wei, Z., Wang, Y., Gao, A., Chen, D., Zhao, X., Feng, X.,
2015. Exploring the effects of different types of surfactants on zebrafish embryos and lar-
vae. Sci. Rep. 5, 10107. https://doi.org/10.1038/srep10107.
Weber, M., Schmitt, A., Wischmeyer, E., Döring, F., 2008. Excitability of pontine startle
processing neurones is regulated by the two-pore-domain K+ channel TASK-3
coupled to 5-HT2C receptors. Eur. J. Neurosci. 28, 931–940. https://doi.org/10.
1111/j.1460-9568.2008.06400.x.
Westphal, N.J., Seasholtz, A.F., 2006. CRH-BP: the regulation and function of a phyloge-
netically conserved binding protein. Front. Biosci. 11, 1878–1891. https://doi.org/
10.2741/1931.
M. Torres-Ruiz et al. Science of the Total Environment 874 (2023) 162406Yang, M., Wang, W.-X., 2023. Recognition and movement of polystyrene nanoplastics in fish
cells. Environ. Pollut. 316, 120627. https://doi.org/10.1016/j.envpol.2022.120627.
Zhang, Y., Goss, G.G., 2020. Potentiation of polycyclic aromatic hydrocarbon uptake in
zebrafish embryos by nanoplastics. Environ. Sci. Nano 7, 1730–1741. https://doi.org/
10.1039/D0EN00163E.
Zhang, R., Silic, M.R., Schaber, A., Wasel, O., Freeman, J.L., Sepulveda, M.S., 2020a. Exposure
route affects the distribution and toxicity of polystyrene nanoplastics in zebrafish. Sci.
Total Environ. 724, 138065. https://doi.org/10.1016/j.scitotenv.2020.138065.
Zhang, Y., Kang, S., Allen, S., Allen, D., Gao, T., Sillanpää, M., 2020b. Atmospheric
microplastics: a review on current status and perspectives. Earth Sci. Rev. 203, 103118.
https://doi.org/10.1016/j.earscirev.2020.103118.15Zhang, Y., Zhang, X., Yan, Q., Xu, C., Liu, Q., Shen, Y., et al., 2022. Melatonin attenuates
polystyrene microplastics induced motor neurodevelopmental defect in zebrafish
(Danio rerio) by activating nrf2 - isl2a Axis. Ecotoxicol. Environ. Saf. 241, 113754.
https://doi.org/10.1016/j.ecoenv.2022.113754.
Zhao, H.J., Xu, J.K., Yan, Z.H., Ren, H.Q., Zhang, Y., 2020. Microplastics enhance the devel-
opmental toxicity of synthetic phenolic antioxidants by disturbing the thyroid function
and metabolism in developing zebrafish. Environ. Int. 140, 105750. https://doi.org/10.
1016/j.envint.2020.105750.