CR4CR5 domain ScaRNA domain Pseudoknot/template domain CR7 aptamer CR4CR5 aptamer AA aptamer P6.1 P8 P5 P6 b Figure S1. Aptamer design. (a) Zebrafish terc secondary structure highlighting aptamers position inside the CR4/CR5 domain and showing the mutation involved in aplastic anemia (G194A). (b) Zebrafish terc tertiary RNA structure highlighting aptamer localization. (c) Aptamer sequence in zebrafish, mouse and human and their length showing in red font the AA mutation. (d) Zebrafish, human and mouse aptamers 3D structure. Prediction of tertiary structure of aptamers and TERC was obtained with the RNAComposer system. a CR4CR5 domain Pseudoknot/template domain C A A G C GU UU GG CU G U UU GU A C GC GG CAA GU U U G ACUGCC CG CAAGAG U U C GGCUCUG CUGCAACUUCGGCAGGUCUGUG . . . T1000mut aptamer *G194A T800 aptamer T1000 aptamer AAUCCCAAUC AGAUUAA ACA GA AG GU UU GC GG A CC UC AAACACUGA UCCGC U AAA UA C P6.1 P8 P5 P6 Template region BoxH ACA T800 aptamer T1000 aptamer c Aptamers Zebrafish Human Mouse T800 CACAGGUUUGGCUGUUUGUACGCGGACAGUUUGA CUGCCGCCAAGAGUUCGGCUCUGCUGCACAUUCGG CAGGUCUGUG (79 nt) CCCGCCUGGAGGCCGCGGUCGGCCCGGGGCU UCUCCGGAGGCACCCACUGCCACCGCGAAGAG UUGGGCUCUGUCAGCCGCGGG (84 nt) - CR7 GAAGGUUUGCGGACCUCAAACACUGAUCCUGCAAA UAC (38 nt) CCCCGCGCGCGGCGCGAUUCCCUGAGCUGUG GGACGUGCACCCAGG (46 nt) - T1000 CAAGAGUUCGGCUCUGC (17 nt) AAGAGUUGGGCUCUG (15 nt) GAAGAGCUCGCCUCUG (16 nt) T1000mut CAAGAAUUCGGCUCUGC (17 nt) AAGAAUUGGGCUCUG (15 nt) GAAGAACUCGCCUCUG (16 nt) P6.1 P5 T800 aptamer P8 CR7 aptamer P6.1 T1000 aptamer P6.1 T1000mut aptamer * d Ze br af ish hCR7 aptamer hT1000 aptamer hT1000mut aptamerhT800 aptamer Hu m an mT1000 aptamer mT1000mut aptamer M ou se Figure S2. Aptamers do not induce the expression of pro-inflammatory genes and do not affect neutrophil function. (a) Levels of CR7, T800 and T1000 aptamers measured by RT- qPCR. Gene expression was normalized to u6 gene and relative to control. Data are average of 6 biologically independent samples represented by dots. Bars represents mean ± SEM. For CR7 and T800, statistical analysis according to two-tailed Mann-Whitney test (95% confidence interval); and for T1000, statistical analysis according to Kruskal-Wallis followed by uncorrected Dunn’s test (95% confidence interval).(b) mRNA levels determined by RT-qPCR of the myeloid genes spi1b, gata1a and csf3b and spi1b/gata1a ratio in 48 hpf larval tails microinjected with the indicated aptamers. The expression was normalized to rps11 and relative to control sample. Data are average of 6 biologically independent samples represented by dots. Bars represents mean ± SEM. n.s., not significant, p > 0.05 according to Kruskal-Wallis followed by uncorrected Dunn’s test (95% confidence interval).(c) The levels of isg15, nlrp3 and tnfa were measured by RT-qPCR. Gene expression was normalized to rps11 gene and relative to control. Data are average of 6 biologically independent samples represented by dots. Bars represents mean ± SEM. n.s., not significant, p > 0.05 according to Kruskal-Wallis followed by uncorrected Dunn’s test (95% confidence interval). Figure S3. Hematopoietic differentiation of mouse bone marrow cells and EBs-derived iPSC treated with aptamers. (a) CFU quantification of wildtype, Tert-/- and Terc-/- mouse genotypes after aptamer treatment. Data are average of at least 5 biologically independent samples represented by dots (wt, n=7; Tert-/-, n=5; Terc-/-, n=7). Bars represent mean ± SEM. n.s., not significant, p > 0.05, according to Kruskal-Wallis followed by Dunn’s multiple comparison test (95% confidence interval) .(b) CFU quantification of HD, TERT-deficient and TERC- deficient EBs at day 14 after hematopoietic differentiation. Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM. n.s., not significant, p > 0.05, according to Kruskal-Wallis followed by Dunn’s multiple comparison test (95% confidence interval).(c) Dot plot and identification of different cell populations in EBs by flow cytometry. CD31+ HEP (bipotential precursors of hematopoietic and endothelial cells), CD45+ CD34+ HPC, and CD45+ mature blood cells.(d)Quantification of hematopoietic progenitor cells (HPC) population (CD31- /CD34+ /CD45+) in EBs of 15 days treated with the indicated aptamers. Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM for each group. n.s., not significant, p > 0.05, according to Kruskal-Wallis followed by Dunn’s multiple comparison test (95% confidence interval). (e) Quantification of mature blood cells population (CD34- /CD45+) in EBs of 15 days treated with the indicated aptamers. Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM for each group. n.s., not significant, p > 0.05, according to Kruskal-Wallis followed by Dunn’s multiple comparison test (95% confidence interval). Figure S4. Aptamer quantification in human iPSC. The levels of CR7, T800 and T1000 aptamers was measured by RT-qPCR in HD, TERT-deficient and TERC-deficient iPSC. Gene expression was normalized to U6 gene and relative to control. (a). Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM for each group. For CR7 and T800, statistical analysis according to two-tailed unpaired t-test (95% confidence interval); and for T1000, statistical analysis according to Kruskal-Wallis followed by uncorrected Dunn’s test (95% confidence interval). (b).Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM for each group. For CR7 and T800, statistical analysis according to two-tailed unpaired t-test (95% confidence interval); and for T1000, statistical analysis according to Kruskal-Wallis followed by uncorrected Dunn’s test (95% confidence interval). (c). Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM for each group. For CR7 and T800, statistical analysis according to two-tailed unpaired t-test with Welch’s correction (95% confidence interval); and for T1000, statistical analysis according to Kruskal-Wallis followed by uncorrected Dunn’s test (95% confidence interval). Figure S5. Gene expression profile of embryonic bodies treated with aptamers. The mRNA levels of SPI1 (a), GATA1 (a, b), CSF3 (a, c), TERT (d) and TERC (e) were determined by RT-qPCR in HD, TERT-deficient and TERC-deficient EBs treated with the indicated aptamers. Gene expression was normalized to GAPDH (a-e) and relative to control sample (b-e). (a). Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM for each group. n.s., not significant, p > 0.05, according to Kruskal-Wallis followed by uncorrected Dunn’s test (95% confidence interval). (b). Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM for each group. n.s., not significant, p > 0.05 according to Kruskal-Wallis followed by corrected Dunn’s test (95% confidence interval). (c): Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM for each group. n.s., not significant, p > 0.05, according to Kruskal-Wallis followed by corrected Dunn’s test (95% confidence interval).(d). Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM for each group. n.s., not significant, p > 0.05, according to Kruskal-Wallis followed by corrected Dunn’s test (95% confidence interval). (e) Data are average of 3 biologically independent samples represented by dots. Bars represent mean ± SEM for each group. n.s., not significant, p > 0.05, according to Kruskal-Wallis followed by corrected Dunn’s test (95% confidence interval). Table I. (a) Assessment of the toxicity of aptamers by analysing their effect on development. Based on Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of zebrafish embryonic development. Dev Dyn. 1995 Jul;203(3):253-310. Doi: 10.1002/aja.1002030302. PMID: 8589427. (b) Representative image of zebrafish larvae development with indicated treatment of aptamer and developmental time. BAR SCALE:500 um 24-25 hpf 30-31 hpf w t T1 00 0 m ut T1 00 0