Dehydroisohispanolone as a promising NLRP3 inhibitor agent. Bioevaluation and Molecular Docking. Laura González-Cofrade1, Irene Cuadrado1, Angel Amesty2, Ana Estévez-Braun2,*, Beatriz de las Heras1, *, Sonsoles Hortelano3,* 1Departamento de Farmacología, Farmacognosia y Botánica, Facultad de Farmacia, Universidad Complutense de Madrid (UCM), Plaza Ramón y Cajal s/n-28040, Madrid, Spain; lagonz11@ucm.es (L.G- C); icberrocal@ucm.es (I.C.); lasheras@ucm.es (B. de las H.). 2Departamento de Química Orgánica. Instituto Universitario de Bio-Orgánica Antonio González, Universidad de La Laguna, Avda. Astrofísico Francisco Sánchez Nº 2, 38206, La Laguna, Tenerife, Spain; aarnesty@ull.es (A.A.); aestebra@ull.es (A. E-B.) 3Unidad de Terapias Farmacológicas, Área de Genética Humana, Instituto de Investigación de Enfermedades Raras (IIER), Instituto de Salud Carlos III, Carretera de Majadahonda-Pozuelo Km 2-28220, Madrid, Spain; shortelano@isciii.es (S.H.) Content Preparation of deshydroisohispanolone (DIH) 1H NMR (CDCl3) of deshydroisohispanolone Figure S1 13C NMR (CDCl3) of deshydroisohispanolone Figure S2 NLRP3 inflammasome inhibition by MCC950 Figure S3 Raw data of Western blots Figure S4-S10 Primers used and their sequences Table S1 Antibodies used in Western Blot analysis Table S2 Preparation of deshydroisohispanolone (DIH). Deshydroisohispanolone was obtained from the natural diterpene hispanolone following the procedure described in reference [21]. Thus, to 3.0 g (9.45 mol) of hispanolone in 175 mL of EtOH were added 10 mL of concentrated HCl and the reaction mixture was heated under reflux for 18 h. Next, this was treated with 100 mL of H2O and extracted with CH2Cl2 (3 x 30 mL). The organic phases were collected, dried over anhydrous MgSO4, filtered, and the solvent removed. The residue was purified by column chromatography with hexanes-EtOAc (95:5) to yield 0.14 g (1.0 %) of deshydroisohispanolone (DIH) and 1.3 g of deshydrohispanolone (46%) as yellow oils. DIH: [α]20 D -91 (c 0.9, CHCl3); IR (neat) νmax 3150, 2970, 2850, 1665, 1505, 1465, 1305, 1160, 1030, 995, 765 cm-1; 1H NMR (CDCl3, 500 MHz) δ 7.26 (1H, bs, H-15), 7.11 (1H, bs, H-16), 6.18 (1H, s, H-14), 3.53 (1H, d, J = 14.8 Hz, H-6a), 3.25 (1H, d, J = 14.8 Hz, H-6b), 2.33 (2H, m, H-12), 1.86 (1H, dd, J = 13.7, 1.4 Hz, H-5), 1.59 (3H, m, H-2, H-1), 1.43 (1H, dd, J = 13.2, 1.4 Hz, H-3), 1.32 (1H, td, J = 13.4, 5.1 Hz, H-8), 1.19 (1H, td, J = 13.0, 5.1 Hz, H-8), 1.07 (3H, t, J = 7.7 Hz, H3-17), 0.99 (3H, s, H3-20), 0.98 (3H, s, H3-19), 0.91 (3H, s, H3-18); 13C NMR (CDCl3, 100 MHz) δ 204.7 (C, C-9), 158.6 (C, C-11), 142.5 (CH, C-15), 139.1 (CH, C-16), 130.8 (C, C- 7), 124.0 (C, C-13), 111.2 (CH, C-14), 48.4 (CH, C-5), 44.2 (C, C-10), 41.7 (CH2, C-3), 33.7 (CH2, C-1), 33.7 (C, C-4), 32.3 (CH3, C-19), 28.1 (CH2, C-6), 27.8 (CH2, C-12), 22.2 (CH3, C- 20), 20.8 (CH2, C-8), 18.3 (CH2, C-2), 17.2 (CH3, C-18), 12.4 (CH3, C-17); EIMS m/z 300 ([M+], 100) 285 (8), 271 (11), 267 (10), 229 (15), 149 (32), 147 (30), 81 (54); HRESIMS m/z 323.1981 [M+Na]+ (calcd for C20H28O2Na, 323.1987). Figure S1: 1H NMR (CDCl3, 500 MHz) of deshydroisohispanolone. Figure S2: 13C NMR (CDCl3, 100 MHz) of deshydroisohispanolone. Figure S3: NLRP3 inflammasome inhibition by MCC950. MCC950 was used as a positive control for NLRP3 inflammasome inhibition. (A, B, C) LPS-primed J774A.1 macrophages were stimulated with Nig in presence of DIH (10, 20 µM) or MCC950 (10 µM) and IL-1β release (A), Caspase-1 activity (B) and LDH release (C) were then measured as described. (D) LPS-primed BMDMs were stimulated with Nig in presence of DIH (10, 20 µM) or MCC950 (10 µM) and IL-1β release was measured. Results are expressed as means ± SD (n = 3). *p < 0.05 and ***p < 0.001 vs. LPS + Nig treatment. Figure S4. Original western blots for two repeats of Figure 2D. Whole blot of cell lysates after cutting membrane at molecular weight 35 kDa and 28 kDa for β-actin (42 kDa) and pro-IL-1β (31 kDa); and supernatants after cutting membrane at 28 kDa for cleaved IL-1β (17 kDa). Figure S5. Original western blots for two repeats of Figure 2E. Whole blot of cell lysates after cutting membrane at molecular weight 35 kDa and 28 kDa for β-actin (42 kDa) and pro-IL-1β (31 kDa); and supernatants after cutting membrane at 28 kDa for cleaved IL-1β (17 kDa). Figure S6. Original western blots for two repeats of Figure 2F. Whole blot of cell lysates after cutting membrane at molecular weight 35 kDa and 28 kDa for β-actin (42 kDa) and pro-IL-1β (31kDa); and supernatants after cutting membrane at 28 kDa for cleaved IL-1β (17 kDa). Figure S7. Original western blots for two repeats of Figure 3B. Whole blot of cell lysates after cutting membrane at molecular weight 48 kDa for pro-caspase-1 (45 kDa) and β-actin (42 kDa); and supernatants after cutting membrane at 10 kDa for caspase-1 p10 (10 kDa). Figura S8. Original western blots for two repeats of Figure 4B. Whole blot of cell lysates after cutting membrane at molecular weight 48 kDa and 35 kDa for GSDMD (53 kDa), β-actin (42 kDa) and GSDMD-N (32 kDa). Casp-1 p10 10KDaSN 63 48 β-actin 42kDa 35 Pro-caspase-1 45kDa Lys 10 48 28 75 Repeat 1 Repeat 2 63 48 75 35 48 28 10 - - + + + - - - 10 20 LPS Nig DIH (µM) - + + + + - - + + + - - - 10 20 LPS Nig DIH (µM) - + + + + Figure S9. Original western blots for two repeats of Figure 5B. Whole blot of cell lysates after cutting membrane at molecular weight 63 kDa, 35 and 28 kDa for NLRP3 (103 kDa), β-actin (42 kDa) and ASC (24 kDa). Figure S10. Original western blots for two repeats of Fig. 6B. Whole blot of cell lysates after cutting membrane at molecular weight 63 kDa, 48, 35 and 28 kDa for NLRP3 (103 kDa), pro-caspase-1 (45 kDa), β-actin (42 kDa), pro-IL-1β (31kDa) and ASC (24 kDa). Table S1. Primers used and their sequences. Gene Forward primer 5’-3’ Reverse primer 5’-3’ NOS-2 TCCACAGTATGTGAGGATCAAAAAC ATGTGGCCTTGTGGTGAAGAGT COX-2 GCTGTACAAGCAGTGGCAAAG GCGTTTGCGGTACTCATTGAGA TNFα CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC IL-6 GAGGATACCACTCCCAACAGACC AAGTGCATCATCGTTGTTCATACA Pro-IL-1β TCTTTGAAGTTGACGGACCC TGAGTGATACTGCCTGCC TG NLRP3 AGCCTTCCAGGATCCTCTTC CTTGGGCAGCAGTTTCTTTC IL-18 TGGTTCCATGCTTTCTGGACTCCT TTCCTGGGCCAAGAGGAAGTGATT Pro-caspase-1 AGATGGCACATTTCCAGGAC GATCCTCCA GCAGCAACTTC 36B4 AGATGCAGCAGATCCGCAT GTTCTTGCCCATCAGCACC Table S2. Antibodies used for Western Blot analysis. Antibody Source Identifiers Dilution Anti-mouse IL-1β (goat polyclonal) R&D systems AF-401-NA 1:500 Anti-pro Caspase-1 + p10 + p12 (rabbit monoclonal) Abcam ab179515 1:1000 Anti-NLRP3/NALP3 (Cryo-2) (mouse monoclonal) AdipoGen AG-20B-0014 1:1000 Anti-mouse ASC/TMS1 (D2W8U) (rabbit monoclonal) Cell Signaling Technology 67824T 1:1000 Anti-β-actin (mouse monoclonal) Sigma A5541 1:5000 Anti-GSDMD (rabbit monoclonal) Abcam ab209845 1:1000 Goat Anti-Rabbit IgG H&L (HRP) Abcam ab205718 1:10000 Anti-goat IgG HRP R&D systems HAF017 1:1000 Anti-mouse IgGκ BP-HRP Santa Cruz sc-516102 1:5000